07b - IBM Cloudburst

50
1 © 2011 IBM Corporation Septe te te te te temb mb mb mb mb mber 2 2 2 2 2 23, 2 , 2 , 2 , 2 , 2 , 2009 IBM C C C C C CloudBurst 2.1 o o o o o on Sy Sy Sy Sy Sy Syste ste ste ste ste stems x s x s x s x s x s x & p An integrated Private Cloud Service Delivery Platform January 2011

Transcript of 07b - IBM Cloudburst

Page 1: 07b - IBM Cloudburst

111111 © 2011 IBM CorporationSSSSSSeeeeeepppppptetetetetetembmbmbmbmbmbeeeeeerrrrrr 2 2 2 2 2 2333333, 2, 2, 2, 2, 2, 2000000000000999999

IIIIIIBBBBBBMMMMMM C C C C C ClllllloooooouuuuuuddddddBBBBBBuuuuuurrrrrrsssssstttttt 222222......111111 o o o o o onnnnnn SySySySySySystestestestestestemmmmmms xs xs xs xs xs x &&&&&& ppppppAn integrated Private Cloud Service Delivery Platform

January 2011

Page 2: 07b - IBM Cloudburst

222222 © 2011 IBM Corporation

Agenda

•Introducing IBM CloudBurst•Hardware Features and Functions•Software Features and Functions•Configurations•Product positioning•National Language Support•Statement of Direction•Summary•IBM differentiators•More information

Page 3: 07b - IBM Cloudburst

333333 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!Introducing IBM CloudBurst

Page 4: 07b - IBM Cloudburst

444444 © 2011 IBM Corporation

Ease immediate adoption of Cloud Computing

AAAAAAuuuuuuttttttomaomaomaomaomaomatttttteeeeee

CoCoCoCoCoConnnnnnssssssoooooolllllliiiiiiddddddaaaaaatttttteeeeeeSSSSSSiiiiiimmmmmmpppppplllllliiiiiiffffffyyyyyy

VVVVVViriririririrttttttuuuuuuaaaaaallllllizizizizizizeeeeee ClClClClClCloooooouuuuuudddddd PPPPPPllllllaaaaaattttttffffffoooooorrrrrrmmmmmm

SSSSSSeeeeeerrrrrrvvvvvviiiiiicccccceeeeee PPPPPPrrrrrroooooovvvvvviiiiiissssssiiiiiioooooonnnnnniiiiiinnnnnngggggg

SSSSSSeeeeeerrrrrrvivivivivivicccccceeeeee OOOOOOrrrrrriiiiiieeeeeennnnnntttttteeeeeedddddd

MMMMMMaaaaaassssssssssssiiiiiivvvvvveeeeeelllllly y y y y y SSSSSScacacacacacallllllaaaaaabbbbbblllllleeeeee

DDDDDDynynynynynynaaaaaammmmmmiiiiiic c c c c c SSSSSSeeeeeerrrrrrvvvvvviiiiiicccccceeeeee MMMMMMaaaaaannnnnnaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt

MMMMMMuuuuuullllllttttttiiiiii------tttttteeeeeennnnnnaaaaaannnnnnccccccyyyyyy

SSSSSSeeeeeecucucucucucurrrrrreeeeee

HHHHHHiiiiiigggggghhhhhh AAAAAAvvvvvvaaaaaaiiiiiillllllaaaaaabbbbbbiiiiiilllllliiiiiittttttyyyyyy

FFFFFFlllllleeeeeexixixixixixibbbbbblllllleeeeee

AsAsAsAsAsAssessessessessessesssssss

WithIBM CloudBurst,you are here yet

Eliminate the long, tedious and risky IT transformation path to reach the cloud “nirvana”

Page 5: 07b - IBM Cloudburst

555555 © 2011 IBM Corporation

Time

Manufacturing

IBM Plant

Shipment to designated client site

Installation Configuration

Training

Client Site

eeeeee......gggggg...... aaaaaa ffffffeeeeeewwwwww ddddddaaaaaayyyyyyssssss

Accelerates time to value

t

Page 6: 07b - IBM Cloudburst

666666 © 2011 IBM Corporation

IBM CloudBurst

CuCuCuCuCuCuststststststoooooommmmmmerererererer BBBBBBenenenenenenefefefefefefiiiiiitttttts:s:s:s:s:s:• IIIIIImmmmmmpppppprrrrrroooooovvvvvveeeeeedddddd ttttttiiiiiimmmmmmeeeeee t t t t t to vo vo vo vo vo valalalalalaluuuuuueeeeee------ Quickly deliver a

private cloud using a preloaded and integrated system

• IIIIIImmmmmmpppppprrrrrroooooovvvvvveeeeeedddddd iiiiiinnnnnnnnnnnnoooooovvvvvvatatatatatatiiiiiioooooonnnnnn------ Dramatically improve business value and IT’s effect on time-to-market by delivering services faster via automated service delivery while also lowering operating costs

• DeDeDeDeDeDeccccccrrrrrreeeeeeasasasasasaseeeeee I I I I I ITTTTTT ccccccoooooosssssstttttt------ Maximize capital usage and reduce need for future capital

• RRRRRReeeeeedddddduuuuuucccccceeeeee c c c c c coooooommmmmmpppppplllllleeeeeexxxxxxiiiiiittttttyyyyyy anananananandddddd r r r r r riiiiiisssssskkkkkk------ With automation and standardization the human error factor is minimized.

• SSSSSSccccccalalalalalaleeeeees s s s s s ttttttoooooo tttttthhhhhheeeeee eeeeeennnnnntttttteeeeeerrrrrrpppppprrrrrriiiiiisssssseeeeee – Able to scale and manage additional Platforms and Workloads (x86, UNIX, System z, …)

SSSSSSiiiiiinnnnnngggggglllllleeeeee pppppprrrrrroooooodddddduuuuuucccccctttttt,,,,,, ssssssiiiiiinnnnnngggggglllllleeeeee ddddddeeeeeelllllliiiiiivvvvvveeeeeerrrrrryyyyyy,,,,,, ssssssiiiiiinnnnnngggggglllllleeeeee iiiiiinnnnnnssssssttttttaaaaaallllllllllllatatatatatatiiiiiioooooonnnnnn,,,,,, ssssssiiiiiinnnnnngggggglllllleeeeee iiiiiinnnnnnvvvvvvooooooiiiiiicccccceeeeee,,,,,, ssssssiiiiiinnnnnngggggglllllleeeeee ssssssuuuuuuppppppppppppoooooorrrrrrtttttt ssssssttttttrurururururuccccccttttttuuuuuurrrrrreeeeee

An iiiiiinnnnnnttttttegegegegegegrrrrrraaaaaattttttedededededed serserserserserservvvvvviiiiiicccccce e e e e e mmmmmmaaaaaannnnnnaaaaaagegegegegegemmmmmmeeeeeennnnnntttttt ppppppllllllaaaaaattttttffffffoooooorrrrrrmmmmmm with network, servers, storage, Quickstart services that enables the fastest Private Cloud Deployment TTTTTTooooooddddddaaaaaayyyyyy

x

p

Page 7: 07b - IBM Cloudburst

777777 © 2011 IBM Corporation

Delivers Results in Days Versus Months

FasFasFasFasFasFastttttteeeeeerrrrrr RRRRRReeeeeessssssuuuuuullllllttttttssssss LLLLLLeeeeeessssssssssss R R R R R Riiiiiisssssskkkkkk CCCCCCoooooosssssstttttt RRRRRReeeeeedddddduuuuuuccccccttttttiiiiiioooooonnnnnn

January

2

3

4

5

JanuaryJune

BBBBBBuuuuuuiiiiiilllllldddddd ffffffrrrrrromomomomomom ScScScScScScrrrrrraaaaaattttttcccccchhhhhh

MMMMMMonononononontttttthhhhhhssssss DayDayDayDayDayDayssssss

PrPrPrPrPrPreeeeee------BuBuBuBuBuBuiiiiiilllllltttttt

Pre-implementation System Sizing

Acquire Components

Installation & Configuration

Testing & Validation

Page 8: 07b - IBM Cloudburst

888888 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!HardwareFeatures

and Functions

Page 9: 07b - IBM Cloudburst

999999 © 2011 IBM Corporation

Main hardware components for IBM CloudBurst on x

42 U Rack BladeCenter H HS22V Blade x3550 M3 Server

DS3400

EXP300

10G Ethernet Networking 8G Fibre Channel

10G Switch Module

Page 10: 07b - IBM Cloudburst

111111000000 © 2011 IBM Corporation

Main hardware components for IBM CloudBurst on p

42 T Rack Power 750Management Server

DS5020

EXP520

10G Ethernet Networking FC Switch

Storage Controller

Power 750Computing Nodes

Page 11: 07b - IBM Cloudburst

111111111111 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!Software

Features and Functions

Page 12: 07b - IBM Cloudburst

111111222222 © 2011 IBM Corporation

Integrated Service Management for Clouds

Deploying Cloud Services Managing Cloud Services

SSSSSSececececececuuuuuurrrrrre Ue Ue Ue Ue Ue Userserserserserser CCCCCCeeeeeennnnnnttttttrrrrrriiiiiicccccc SSSSSSelelelelelelffffff------SSSSSSerererererervvvvvviiiiiicccccce e e e e e PPPPPPoooooorrrrrrttttttaaaaaallllll,,,,,, AAAAAAuuuuuuttttttoooooommmmmmaaaaaattttttiiiiiioooooonnnnnn

EEEEEEnnnnnnggggggiiiiiinnnnnne e e e e e aaaaaannnnnndddddd CaCaCaCaCaCattttttaaaaaalllllloooooogggggg

AAAAAAuuuuuuttttttoooooommmmmmaaaaaatttttted Ped Ped Ped Ped Ped Prrrrrroooooovivivivivivisisisisisisioooooonnnnnniiiiiinnnnnng g g g g g aaaaaannnnnndddddd IIIIIImmmmmmaaaaaagggggge Me Me Me Me Me Maaaaaannnnnnaaaaaaggggggememememememenenenenenentttttt

MMMMMMoooooonnnnnniiiiiittttttoooooorrrrrriiiiiinnnnnngggggg aaaaaannnnnndddddd MMMMMMetetetetetetererererereriiiiiinnnnnngggggg

For Locating and Requesting Services

Page 13: 07b - IBM Cloudburst

111111333333 © 2011 IBM Corporation

Self-Service Portal

•Users can request the services they need, when they need them, for the time they need them

•Eliminates manual processes for requesting resources

………………iiiiiimmmmmmpppppprrrrrroooooovvvvvveeeeee ccccccuuuuuussssssttttttoooooommmmmmeeeeeerrrrrr ssssssaaaaaattttttiiiiiissssssffffffaaaaaaccccccttttttiiiiiioooooonnnnnn bbbbbbyyyyyy aaaaaacccccccccccceeeeeelllllleeeeeerrrrrraaaaaattttttiiiiiinnnnnng g g g g g sssssseeeeeerrrrrrvvvvvviiiiiicccccceeeeee ddddddeeeeeelllllliiiiiivvvvvveeeeeerrrrrryyyyyy

Page 14: 07b - IBM Cloudburst

111111444444 © 2011 IBM Corporation

Service Catalog

•Single repository for all cloud services

•Allows end users to use IT services without being an expert in IT

•Supports faster delivery of business services

………………pppppprrrrrroooooommmmmmooooootttttteeeeee ccccccoooooonnnnnnssssssiiiiiisssssstttttteeeeeennnnnnccccccyyyyyy ooooooffffff sssssseeeeeerrrrrrvvvvvviiiiiicccccceeeeeessssss

Page 15: 07b - IBM Cloudburst

111111555555 © 2011 IBM Corporation

………………ssssssppppppeeeeeeeeeeeedddddd ddddddeeeeeelllllliiiiiivvvvvveeeeeerrrrrryyyyyy ooooooffffff sssssseeeeeerrrrrrvvvvvviiiiiicccccceeeeeessssss vvvvvviiiiiiaaaaaa eeeeeeaaaaaassssssyyyyyy-t-t-t-t-t-toooooo-u-u-u-u-u-usssssseeeeee pppppprrrrrroooooovvvvvviiiiiissssssiiiiiioooooonnnnnniiiiiinnnnnngggggg

Automated (De)-Provisioning

•Resources can be provisioned in minutes versus weeks

•Resources are provisioned consistently every time

•Resources are quickly returned to pool when no longer needed instead of sitting idle

•Easily customizable by role

Page 16: 07b - IBM Cloudburst

111111666666 © 2011 IBM Corporation

Pre-packed Automation Templates

•Library of scenarios available for common provisioning tasks

•Plus Web replay to record provisioning tasks once, then share with less-skilled administrators

………………ssssssaaaaaavvvvvveeeeee ttttttiiiiiimmmmmmeeeeee aaaaaannnnnndddddd rrrrrreeeeeedddddduuuuuucccccceeeeee sssssskkkkkkiiiiiillllllllllll lllllleeeeeevvvvvveeeeeellllll rrrrrreeeeeeqqqqqquuuuuuiiiiiirrrrrreeeeeedddddd ffffffoooooorrrrrr pppppprrrrrroooooovvvvvviiiiiissssssiiiiiioooooonnnnnniiiiiinnnnnngggggg

Page 17: 07b - IBM Cloudburst

111111777777 © 2011 IBM Corporation

………………pppppprrrrrroooooovvvvvviiiiiiddddddeeeeee ddddddaaaaaattttttaaaaaa ffffffoooooorrrrrr ppppppllllllaaaaaannnnnnnnnnnniiiiiinnnnnngggggg,,,,,, bbbbbbuuuuuuddddddgegegegegegettttttiiiiiinnnnnng,g,g,g,g,g, bbbbbbiiiiiilllllllllllliiiiiinnnnnng g g g g g aaaaaannnnnndddddd aaaaaaccccccccccccuuuuuurrrrrraaaaaatttttteeeeee cccccchhhhhhaaaaaarrrrrrgegegegegegebbbbbbaaaaaacccccckkkkkk ffffffoooooorrrrrr sssssseeeeeerrrrrrvvvvvviiiiiicccccceeeeeessssss

Integrated Usage & Accounting Chargeback Capabilities

•Understand costs, track, allocate and invoice by department, user and many additional criteria

•Collect, analyze and bill based on usage and costs of shared assets

•Deliver detailed information and reports about the intricate use of shared resources

Page 18: 07b - IBM Cloudburst

111111888888 © 2011 IBM Corporation

………………pppppprrrrrrooooooaaaaaaccccccttttttiiiiiivvvvvveeeeeellllllyyyyyy mmmmmmaaaaaannnnnnaaaaaagegegegegege eeeeeennnnnneeeeeerrrrrrgygygygygygy uuuuuussssssaaaaaagegegegegege aaaaaannnnnndddddd rrrrrreeeeeedddddduuuuuucccccceeeeee ffffffoooooooooooottttttpppppprrrrrriiiiiinnnnnntttttt

Makes your Cloud ggggggrrrrrreeeeeeeeeeeennnnnn

•Provide visibility into key energy metrics across IT and facility assets

•Identify areas where energy consumption can be reduced

•Provide energy metrics to other management products to drive actions

Page 19: 07b - IBM Cloudburst

111111999999 © 2011 IBM Corporation

Platform/Virtualization Management

•Monitor and manage physical and virtual resources in same manner

•Dynamically manage virtual workloads to optimize resource usage

•Automatically migrate virtual machines across systems to maintain service levels

•Management of VLANs to support multi-tenancy

………………iiiiiinnnnnnccccccrrrrrreeeeeeaaaaaasssssseeeeee uuuuuuttttttiiiiiilllllliiiiiizzzzzzaaaaaattttttiiiiiioooooonnnnnn ffffffoooooorrrrrr lllllloooooowewewewewewerrrrrr ccccccaaaaaappppppiiiiiittttttaaaaaallllll eeeeeexxxxxxppppppeeeeeennnnnnsssssseeeeee wwwwwwiiiiiitttttthhhhhh iiiiiimmmmmmpppppprrrrrroooooovvvvvveeeeeedddddd aaaaaapppppppppppplllllliiiiiiccccccaaaaaattttttiiiiiioooooonnnnnn aaaaaavvvvvvaaaaaaiiiiiillllllaaaaaabbbbbbiiiiiilllllliiiiiittttttyyyyyy

Page 20: 07b - IBM Cloudburst

222222000000 © 2011 IBM Corporation

Storage Virtualization (SAN Volume Controller*)

•Make better use of existing storage and controlling growth

•Make changes to storage and move data without taking applications down

•Simplify management to provide greater efficiency and productivity for storage management staff

………………hhhhhheeeeeelplplplplplp eeeeeennnnnnaaaaaabbbbbblllllleeeeee grgrgrgrgrgreeeeeeaaaaaatttttteeeeeerrrrrr cccccchhhhhhooooooiiiiiicccccceeeeee wwwwwwhhhhhheeeeeennnnnn aaaaaaccccccqqqqqquuuuuuiiiiiirrrrrriiiiiinnnnnng g g g g g ssssssttttttoooooorrrrrraaaaaaggggggeeeeee

* Optional SVC feature on x

Page 21: 07b - IBM Cloudburst

222222111111 © 2011 IBM Corporation

IBM CloudBurst on x is Extensible in two ways and …

………………mmmmmmoooooorrrrrreeeeee eeeeeeffffffffffffeeeeeeccccccttttttiiiiiivvvvvveeeeeelylylylylyly mmmmmmaaaaaannnnnnaaaaaagegegegegege aaaaaannnnnndddddd lllllleeeeeevvvvvveeeeeerrrrrraaaaaaggggggeeeeee yyyyyyoooooouuuuuurrrrrr eeeeeexxxxxxiiiiiissssssttttttiiiiiinnnnnng g g g g g ccccccaaaaaappppppiiiiiittttttaaaaaallllll iiiiiinnnnnnvvvvvveeeeeessssssttttttmmmmmmeeeeeennnnnntttttt

•Ability to add blade compute servers to your initial IBM CloudBurst environment

•IBM CloudBurst management server can be used to discover, enroll, manage and use resources across your environment

•Enables scalability by leveraging other enterprise resources

POWER

z/VM OOOOOOEEEEEEMMMMMM xxxxxx888888666666

SSSSSSAAAAAANNNNNNPPPPPPOOOOOOWWWWWWEEEEEERRRRRR

WWWWWWeeeeeebbbbbbSSSSSSpppppphhhhhheeeeeerrrrrreeeeeeCCCCCClllllloooooouuuuuuddddddbbbbbbuuuuuurrrrrrsssssstttttt

Page 22: 07b - IBM Cloudburst

222222222222 © 2011 IBM Corporation

IBM CloudBurst on p is Extensible in two ways and …

………………mmmmmmoooooorrrrrreeeeee eeeeeeffffffffffffeeeeeeccccccttttttiiiiiivvvvvveeeeeelylylylylyly mmmmmmaaaaaannnnnnaaaaaagegegegegege aaaaaannnnnndddddd lllllleeeeeevvvvvveeeeeerrrrrraaaaaaggggggeeeeee yyyyyyoooooouuuuuurrrrrr eeeeeexxxxxxiiiiiissssssttttttiiiiiinnnnnng g g g g g ccccccaaaaaappppppiiiiiittttttaaaaaallllll iiiiiinnnnnnvvvvvveeeeeessssssttttttmmmmmmeeeeeennnnnntttttt

•Ability to add Power 750 servers to your initial IBM CloudBurst environment

•IBM CloudBurst management server can be used to discover, enroll, manage and use resources across your environment

•Enables scalability by leveraging other enterprise resources

IBM x

z/VM OOOOOOEEEEEEMMMMMM xxxxxx888888666666

SSSSSSAAAAAANNNNNN

WWWWWWeeeeeebbbbbbSSSSSSpppppphhhhhheeeeeerrrrrreeeeeeCCCCCClllllloooooouuuuuuddddddbbbbbbuuuuuurrrrrrsssssstttttt

Page 23: 07b - IBM Cloudburst

222222333333 © 2011 IBM Corporation

IBM QuickStart Services Included

•Installation & Configuration– Integrate IBM CloudBurst in data

center and network

– Set up users and security profiles

– Configure virtualization resources and self-serve portal

•Hands-on Training– Covers broad range of management

considerations

– Addresses administrator and user levels

………………yyyyyyoooooouuuuuurrrrrr pppppprrrrrriiiiiivvvvvvaaaaaatttttteeeeee CCCCCClllllloooooouuuuuudddddd ppppppllllllaaaaaattttttffffffoooooorrrrrrmmmmmm iiiiiissssss uuuuuupppppp aaaaaannnnnndddddd rrrrrruuuuuunnnnnnnnnnnniiiiiinnnnnng g g g g g iiiiiinnnnnn 555555-8-8-8-8-8-8 ddddddaaaaaayyyyyyssssss,,,,,, ssssssuuuuuuppppppppppppoooooorrrrrrtttttteeeeeedddddd bbbbbbyyyyyy kkkkkknnnnnnoooooowwwwwwlllllleeeeeeddddddgegegegegege ttttttrrrrrraaaaaannnnnnssssssffffffeeeeeerrrrrr

Page 24: 07b - IBM Cloudburst

222222444444 © 2011 IBM Corporation

A turnkey and mature IBM Cloud offering

•Single delivery•Single installation•Single price•Single support

………………eeeeeeaaaaaasssssseeeeee tttttthhhhhheeeeee hhhhhheeeeeeaaaaaaddddddaaaaaacccccchhhhhheeeeeessssss ooooooffffff ttttttrrrrrraaaaaaddddddiiiiiittttttiiiiiioooooonnnnnnaaaaaallllll iiiiiinnnnnnffffffrrrrrraaaaaassssssttttttrrrrrruuuuuuccccccttttttuuuuuurrrrrreeeeee pppppprrrrrroooooojjjjjjeeeeeecccccctttttt

Page 25: 07b - IBM Cloudburst

222222555555 © 2011 IBM Corporation

The Benefits

• ImImImImImImprprprprprprovovovovovoveeeeeedddddd ttttttiiiiiimmmmmmeeeeee tttttto o o o o o vvvvvvaaaaaalllllluuuuuueeeeee – Reduces the amount of integration work required to deploy a cloud by

offering a pre-bundled and integrated service delivery software stack

•AAAAAAcccccccccccceeeeeelllllleeeeeerrrrrraaaaaatetetetetetedddddd ddddddeeeeeeplplplplplplooooooyyyyyymmmmmmeeeeeennnnnntttttt – Automated image deployment, cross connection and activation of

components allows clients to shorten deployment times

•RRRRRReeeeeedddddduuuuuucccccceeeeee ccccccomomomomomompppppplllllleeeeeexixixixixixittttttyyyyyy – Self service, standardization and automation simplify use and minimize

errors

•LLLLLLeeeeeevvvvvveeeeeerrrrrraaaaaaggggggeeeeee eeeeeexxxxxxiiiiiisssssstitititititinnnnnngggggg hhhhhhaaaaaarrrrrrddddddwwwwwwaaaaaarrrrrreeeeee– Allows businesses to leverage existing hardware while reducing capital

expenditures and generate greater ROI

Page 26: 07b - IBM Cloudburst

222222666666 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!ConfigurationsOption for x

Page 27: 07b - IBM Cloudburst

222222777777 © 2011 IBM Corporation

T-Shirt Sizes Comparison

Optional via on-site servicesIBM System Storage SAN Volume Controller

1100Redundant Scale Out Fiber Channel (FC) Switch:IBM SAN 40B-4 40 Port Switch (supports up to two racks)

420 port

220 port

120 port

120 port

Redundant 8Gb Fiber Channel (FC) Connectivity:2 x Qlogic FCSM 20p FC Blade Switch

64.8 to 115.236.0 to 57.614.4 to 28.87.2Raw Storage Capacity (TB)

1Not applicable

Not applicable

Not applicable

Redundant 10 Gb Ethernet Rack Switch: 2 x BLADE G8124 10GbE Rack Switch :

2211Redundant 10Gb Ethernet Networking: 2 x BNT Virtual Fabric Switch Module

2111Redundant 1Gb Ethernet Networking: 2 x SMC 8126L2 26p Rack Ethernet Switch

Networking

111Not applicable

Additional HS22V diskless w/ embedded VMware ESXi 4.1 hypervisor

(optional) High Availability

28 to 5514 to 274 to 133HS22V diskless w/ embedded VMware ESXi 4.1 hypervisorBlades for cloud nodes

1111HS22V diskless w/ embedded ESXi 4.1 hypervisor, plus IBM CloudBurst Software stack, and VMware vSphere Enterprise 4.1First blade

3 to 4211H Chassis with 14 slotsBladeCenter

211142 U (1410 Rack)Rack

xxxxxxLLLLLLaaaaaarrrrrrggggggeeeeeeLLLLLLargargargargargargeeeeeeMMMMMMeeeeeeddddddiiiiiiuuuuuummmmmmSSSSSSmmmmmmaaaaaallllllllllllDDDDDDeeeeeessssssccccccrrrrrriiiiiippppppttttttiiiiiioooooonnnnnn CoCoCoCoCoCommmmmmppppppoooooonnnnnneeeeeennnnnntttttt

1 This option re duce s by one the total numbe r of blades for the cloud

All Hardware Configurations include Power Distribution Units, Keyboard & Monitor, Cables, SFPsNew

Page 28: 07b - IBM Cloudburst

222222888888 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!ConfigurationsOption for p

Page 29: 07b - IBM Cloudburst

222222999999 © 2011 IBM Corporation

T-Shirt Sizes Comparison

Not applicable11Redundant Scale Out Fiber Channel (FC) Switches:IBM SAN 40B-4 40 Port Switch (supports up to two racks)

2 or 442SAN Volume Controller (SVC): Node cluster

1 to 24240Storage Expansions: EXP520 includes 16DDMsx (300 or 450 or 600 GB)

2 to 441Entry FC/SAS Storage:DS5020 with dual controller, including 16DDMsx (300 or 450 or 600 GB)

Up to 262,5262,59,375Raw Storage Capacity (TB) if using 600 GB Disk Drives

Not applicable22Redundant 10Gb Ethernet Switches: 24 port 10Gb IBM 4002-X2A switch (Brocade Ethernet Switch)

2 to 442Redundant 1Gb Ethernet Switches: 48 port 1Gb Juniper EX4200 Ethernet Switch

Networking

additional 280VMs* per Power 750

server addedUp to 2960Up to 160

*Based on standard support of 1/10 of processor per LPAR on Power serversNumber of VMs supported

2 to 10101Power 750 Server with 8-core 3.0 GHz POWER7 Processors 256 GB (up to 512 GB) memory Redundant 10Gb and 1Gb Ethernet adaptersRedundant 8Gb Fiber Channel adapters

Computing Nodes

1 to 221Rack mounted Hardware Management Console with integrated KVMManagement Console

111Power 750 Server with 8-core 3.0 GHz POWER7 Processors 256 GB (up to 512 GB) memory Redundant 10Gb and 1Gb Ethernet adapters Redundant 8Gb Fiber Channel adapters

Management Server

Up to 551T42 including intelligent PDUsRack

SSSSSScacacacacacallllllaaaaaabbbbbblllllleeeeee ooooooppppppttttttiiiiiioooooonnnnnnssssssLaLaLaLaLaLarrrrrrggggggeeeeeessssssttttttSSSSSSmmmmmmaaaaaalllllllllllleeeeeessssssttttttDDDDDDeeeeeesssssscrcrcrcrcrcriiiiiippppppttttttiiiiiioooooonnnnnn CCCCCCoooooommmmmmppppppoooooonnnnnneeeeeennnnnntttttt

All Hardware Configurations include Power Distribution Units, Keyboard & Monitor, Cables, SFPs

Page 30: 07b - IBM Cloudburst

333333000000 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!High Availabilityon x

Page 31: 07b - IBM Cloudburst

333333111111 © 2011 IBM Corporation

Cloud Management Platform

TSAM

Adm

in W

orks

tatio

n

Tivoli Service Automation Manager

Tivoli Usage and Accounting Manager

TivSAM VM ITUAM VM

Tivoli Enterprise Portal

ITM VM NFS/Samba VM

Tivoli Provisioning Manager

DB2

Tivoli Directory Server

Tivoli System Automation

ITUAM Web Reporting

DB2

Tivoli Enterprise Management Server

DB2

IBM HTTP Server

NFS Server

Samba Server

Tivoli System Automation

Linux SUSE Linux SUSE Linux SUSELinux SUSE

Service Automation

Usage and Accounting

Monitoring File repository URL redirector

Page 32: 07b - IBM Cloudburst

333333222222 © 2011 IBM Corporation

… VMware vSphere* of the other VMs

ITMImage

TUAMImage

VM VM

ITUAMImage

ITMImage

VM VM

First HS22V blade - VMware ESXi HS22V - VMware ESXi

IBM BladeCenter H

DS3400

* VMware High Availability and Data Recovery features are shipped with VMware vSphere Enterprise

Page 33: 07b - IBM Cloudburst

333333333333 © 2011 IBM Corporation

The combination of both options are supported

ITMImage

TUAMImage

TivSAMImage

NFSImage

VM VM VM VM

First HS22V blade - VMware ESXi HS22V - VMware ESXi

IBM BladeCenter H

DS3400MastervDisk

Shared RawDisk

BackupvDisk

* TSA-MP is pre-loaded with IBM CloudBurst but activated with an appropriated SW license

TivSAMHA

Image

NFS HA

Image

VM VM

IP 1 IP 2 IP 3 IP 4 IP 5 IP 6

Se rviceIP3

Se rviceIP4

Se rviceIP3

Se rviceIP4

*TSA-MP HA Cluster

ITUAMImage

ITMImage

VM VM

VMware HA

Page 34: 07b - IBM Cloudburst

333333444444 © 2011 IBM Corporation

New HA considerations with CloudBurst 2.1

•TSA is always running, even if you do not do dual node HA.•It works in single node mode as a watchdog.•If a service goes down TSA tries to restart it on the same VM.

Page 35: 07b - IBM Cloudburst

333333555555 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!National LanguageSupport

Page 36: 07b - IBM Cloudburst

333333666666 © 2011 IBM Corporation

Enabled to support all language environments and is translated into the following languages*

•Brazilian Portuguese

•English

•French

•German

• Italian

•Spanish

• Japanese

•Korean

•Simplified Chinese

•Traditional Chinese

*i.e. the Tivoli SW stack

PPPPPPlllllleaeaeaeaeaease se se se se se ccccccoooooonnnnnnttttttaaaaaacccccctttttt yyyyyyoooooouuuuuurrrrrr llllllooooooccccccaaaaaallllll SSSSSSTTTTTTGGGGGG ffffffoooooorrrrrr a a a a a annnnnnyyyyyy o o o o o otttttthhhhhherererererer llllllooooooccccccaaaaaalllllliiiiiizzzzzzaaaaaattttttiiiiiioooooonnnnnn

Page 37: 07b - IBM Cloudburst

333333777777 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!Positioning

Page 38: 07b - IBM Cloudburst

333333888888 © 2011 IBM Corporation

PPPPPPoooooolllllliiiiiiccccccyyyyyy BBBBBBaaaaaasssssseeeeeedddddd RRRRRReeeeeessssssoooooouuuuuurrrrrrcccccceeeeee AAAAAAllllllllllllooooooccccccatatatatatatiiiiiioooooonnnnnn

HHHHHHeeeeeetttttteeeeeerrrrrrooooooggggggeeeeeennnnnneeeeeeoooooouuuuuussssss O O O O O OSSSSSS DeDeDeDeDeDeppppppllllllooooooyyyyyymmmmmmeeeeeennnnnntttttt an an an an an andddddd m m m m m maaaaaannnnnnagagagagagageeeeeemmmmmmeeeeeennnnnntttttt

IIIIIImmmmmmaaaaaaggggggeeeeee MMMMMMananananananaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt

RRRRRReeeeeesousousousousousourrrrrrcccccceeeeee PPPPPPrrrrrroooooovvvvvviiiiiissssssiiiiiioooooonnnnnniiiiiinnnnnngggggg anananananandddddd C C C C C Coooooonnnnnnffffffiiiiiigggggguuuuuurrrrrratatatatatatiiiiiioooooonnnnnn MMMMMMananananananagagagagagageeeeeemmmmmmeeeeeennnnnntttttt

PPPPPPoooooolllllliiiiiiccccccyyyyyy BBBBBBaaaaaasssssseeeeeedddddd RRRRRReeeeeessssssoooooouuuuuurrrrrrcccccceeeeee AAAAAAllllllllllllooooooccccccatatatatatatiiiiiioooooonnnnnn

TTTTTTPPPPPPMMMMMM ffffffoooooorrrrrr OOOOOOSSSSSSDDDDDDeeeeeeppppppllllllooooooyyyyyymememememementntntntntnt

777777......111111......111111

ITITITITITIT SSSSSSeeeeeerrrrrrvvvvvviciciciciciceeeeee DeDeDeDeDeDelilililililivvvvvveeeeeerrrrrryyyyyy ffffffoooooorrrrrr CloCloCloCloCloClouuuuuudddddd:::::: ccccccoooooorrrrrreeeeee ccccccoooooommmmmmppppppoooooonnnnnneeeeeennnnnnttttttssssss

(re que st, de live r, and manage se rvice s)

TTTTTTPPPPPPMMMMMM 777777......222222

TTTTTTPPPPPPMMMMMM ffffffoooooor r r r r r OOOOOOSSSSSSDDDDDDeeeeeeppppppllllllooooooyyyyyymememememementntntntntnt

777777......111111......111111IIIIIInnnnnncccccclulululululuddddddeeeeeedddddd iiiiiinnnnnn

TTTTTTPMPMPMPMPMPM

TTTTTTPPPPPPM M M M M M ffffffoooooorrrrrr ImImImImImImaaaaaaggggggeeeeeessssss 777777......111111......111111

CCCCCChhhhhhaaaaaarrrrrrggggggeeeeeeaaaaaabbbbbblllllleeeeee CCCCCCoooooommmmmmpopopopopoponnnnnneeeeeennnnnntttttt

TTTTTTPPPPPPMMMMMMffffffoooooorrrrrr ImImImImImImaaaaaaggggggeeeeeessssss

777777......111111......111111

TTTTTTPPPPPPMMMMMM ffffffoooooor r r r r r OOOOOOSSSSSSDDDDDDeeeeeeppppppllllllooooooyyyyyymemememememennnnnntttttt

777777......111111......111111

TTTTTTSSSSSSAAAAAAMMMMMM 777777......222222......111111

iiiiiinnnnnnccccccl.l.l.l.l.l. SSSSSSRRRRRRMMMMMM 777777......222222......0.0.0.0.0.0.111111ccccccaaaaaattttttaaaaaalllllloooooogggggg------oooooonnnnnnlylylylylyly

TTTTTTPPPPPPMMMMMM 777777......222222IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeedddddd iiiiiinnnnnn

TSTSTSTSTSTSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMM ffffffoooooor r r r r r OOOOOOSSSSSSDDDDDDeeeeeeppppppllllllooooooyyyyyymememememementntntntntnt

777777......111111......111111IIIIIInnnnnncccccclulululululuddddddeeeeeedddddd iiiiiinnnnnn

TTTTTTSSSSSSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMM ffffffoooooorrrrrr ImImImImImImaaaaaaggggggeeeeeessssss 777777......111111......111111

IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeed d d d d d iiiiiinnnnnn TSTSTSTSTSTSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMM 777777......222222IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeedddddd iiiiiinnnnnn

TTTTTTSSSSSSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMM ffffffoooooorrrrrr OOOOOOSSSSSSDeDeDeDeDeDepppppplolololololoyyyyyymmmmmmeeeeeennnnnntttttt

777777......111111......111111IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeed d d d d d iiiiiinnnnnn

TSTSTSTSTSTSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMMffffffoooooorrrrrr ImImImImImImaaaaaaggggggeeeeeessssss

777777......111111......111111IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeedddddd iiiiiinnnnnn

TSTSTSTSTSTSAAAAAAMMMMMM

TTTTTTSSSSSSAAAAAAMMMMMM 777777......222222......111111

iiiiiinnnnnnccccccl.l.l.l.l.l. SSSSSSRRRRRRM M M M M M 777777......222222......000000......111111ccccccaaaaaattttttaaaaaalolololololog-g-g-g-g-g-oooooonnnnnnllllllyyyyyy

HHHHHHeeeeeetttttteeeeeerrrrrroooooogegegegegegennnnnneeeeeeoooooouuuuuussssss OOOOOOSSSSSS DeDeDeDeDeDepppppplolololololoyyyyyymmmmmmeeeeeennnnnntttttt aaaaaannnnnndddddd

MaMaMaMaMaMannnnnnaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt

IIIIIImmmmmmaaaaaagegegegegege MMMMMMaaaaaannnnnnaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt (discove r, deploy, conve rt, maintain)

RRRRRReeeeeessssssoooooouuuuuurrrrrrcccccceeeeee PPPPPPrrrrrroooooovvvvvv &&&&&& CoCoCoCoCoConnnnnnffffffigigigigigig MgmMgmMgmMgmMgmMgmtttttt

(Inc l. Composite image mgmt and fede rated

image re pository)

ITITITITITIT SSSSSSeeeeeerrrrrrvvvvvviciciciciciceeeeee DeDeDeDeDeDelilililililivvvvvveeeeeerrrrrryyyyyy ffffffoooooorrrrrr CCCCCClolololololouuuuuudddddd:::::: ccccccoooooorrrrrreeeeee pppppplllllluuuuuussssss aaaaaaddddddddddddiiiiiititititititioooooonnnnnnaaaaaallllll

sssssseeeeeerrrrrrvvvvvviiiiiicccccceeeeee mmmmmmaaaaaannnnnnaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt (incl. Usage & Accounting,

Energy Mgmt, HA) IIIIIITTTTTTUUUUUUAAAAAAMMMMMM 777777......111111......222222

IIIIIITTTTTTMMMMMM 666666......222222......222222 OOOOOOSSSSSS aaaaaaggggggeeeeeennnnnnttttttssssss,,,,,, GGGGGGEEEEEEMMMMMM

IIIIIISSSSSSDDDDDDMMMMMM 777777......222222......111111

TTTTTTPPPPPPMMMMMM 777777......222222IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeedddddd iiiiiinnnnnn

TTTTTTSSSSSSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMM ffffffoooooorrrrrr OOOOOOSSSSSSDeDeDeDeDeDepppppplolololololoyyyyyymmmmmmeeeeeennnnnntttttt

777777......111111......111111IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeed d d d d d iiiiiinnnnnn

TSTSTSTSTSTSAAAAAAMMMMMM

TTTTTTPPPPPPMMMMMMffffffoooooorrrrrr ImImImImImImaaaaaaggggggeeeeeessssss

777777......111111......111111IIIIIInnnnnncccccclllllluuuuuuddddddeeeeeedddddd iiiiiinnnnnn

TSTSTSTSTSTSAAAAAAMMMMMM

IIIIIITTTTTTUUUUUUAAAAAAMMMMMM 777777......111111......222222

IIIIIITTTTTTMMMMMM 666666......222222......222222 OOOOOOSSSSSS aaaaaaggggggeeeeeennnnnnttttttssssss,,,,,, GGGGGGEEEEEEMMMMMM

CCCCCClllllloooooouuuuuuddddddBBBBBBuuuuuurrrrrrsssssst t t t t t 222222......111111

HHHHHHWWWWWWCCCCCCuuuuuussssssttttttoooooommmmmm b b b b b buuuuuuiiiiiilllllltttttt//////uuuuuusssssseeeeeedddddd VVVVVViiiiiirrrrrrttttttuuuuuualalalalalaliiiiiizzzzzzaaaaaattttttiiiiiioooooonnnnnn IIIIIInnnnnnffffffrrrrrrasasasasasasttttttrurururururuccccccttttttuuuuuurrrrrreeeeee

BBBBBBllllllaaaaaaddddddeeeeeeCCCCCCeeeeeennnnnntttttteeeeeer r r r r r xxxxxx

IBIBIBIBIBIBMMMMMM SSSSSSyyyyyysssssstttttteeeeeemsmsmsmsmsms DDDDDDiiiiiirrrrrreeeeeeccccccttttttoooooorrrrrrVVVVVVMMMMMMCCCCCCoooooonnnnnnttttttrorororororollllll

IIIIIIBBBBBBMMMMMM SSSSSSyyyyyysssssstttttteeeeeemsmsmsmsmsms DDDDDDiiiiiirererererereccccccttttttoooooorrrrrrVVVVVVMMMMMMCCCCCCoooooonnnnnnttttttrorororororollllll

TTTTTTSSSSSSAAAAAA TTTTTTSSSSSSAAAAAA

TTTTTTSSSSSSAAAAAAMMMMMM 777777......222222......111111

iiiiiinnnnnnccccccl.l.l.l.l.l. SSSSSSRRRRRRM M M M M M 777777......222222......000000......111111ccccccaaaaaattttttaaaaaalolololololog-g-g-g-g-g-oooooonnnnnnlylylylylyly

IBM Service Automation Solutions

Page 39: 07b - IBM Cloudburst

333333999999 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!Summary

Page 40: 07b - IBM Cloudburst

444444000000 © 2011 IBM Corporation

SSSSSSeeeeeerrrrrrvivivivivivicccccceeeeee AAAAAAuuuuuuttttttoooooommmmmmaaaaaattttttiiiiiioooooonnnnnn

IIIIIIBBBBBBMMMMMM QQQQQQuuuuuuiiiiiicccccckkkkkkSSSSSSttttttaaaaaarrrrrrtttttt SSSSSSerererererervvvvvviiiiiicccccceseseseseses

Orchestration of Cloud operations

Integration point for service mgmt capabilities

Service catalog and templates

Automated provisioning of virtual systems

Monitor both physical and virtual server environments

MMMMMMoooooonnnnnniiiiiittttttoooooorrrrrriiiiiinnnnnngggggg

Redundancy built in for high availability

HHHHHHiiiiiigggggghhhhhh AAAAAAvavavavavavaiiiiiillllllaaaaaabbbbbbiiiiiilllllliiiiiittttttyyyyyy

Provide metering and accounting for cloud services

Enable integration to billing systems if needed

UUUUUUssssssaaaaaaggggggeeeeee aaaaaannnnnndddddd AAAAAAcccccccocococococouuuuuunnnnnnttttttiiiiiinnnnnngggggg

Enhanced management of the virtual environment

PPPPPPllllllaaaaaattttttffffffoooooorrrrrrmmmmmm &&&&&& VVVVVViiiiiirrrrrrttttttuuuuuuaaaaaalllllliiiiiizzzzzzaaaaaattttttiiiiiioooooonnnnnn MMMMMMaaaaaannnnnnaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt

Energy management of the hardware infrastructure

EEEEEEnnnnnneeeeeerrrrrrggggggy y y y y y MMMMMMaaaaaannnnnnaaaaaaggggggeeeeeemmmmmmeeeeeennnnnntttttt

Preinstalled and configured on IBM hardware

SSSSSSeeeeeerrrrrrveveveveveverrrrrr,,,,,, SSSSSSttttttoooooorrrrrraaaaaaggggggeeeeee,,,,,, NNNNNNeeeeeettttttwwwwwwoooooorrrrrrkkkkkk HHHHHHWWWWWW

Improve storage utilization

Enable multi-tenancy support

SSSSSSttttttoooooorrrrrraaaaaaggggggeeeeee aaaaaannnnnndddddd NNNNNNeeeeeettttttwwwwwwoooooorrrrrrkkkkkk VVVVVViiiiiirrrrrrttttttuuuuuuaaaaaalllllliiiiiizzzzzzaaaaaattttttiiiiiioooooonnnnnn

“Built for Purpose” Cloud Solution

Page 41: 07b - IBM Cloudburst

444444111111 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!IBM Differentiators

Page 42: 07b - IBM Cloudburst

444444222222 © 2011 IBM Corporation

Cloud ready solution for multiple workloads and platforms

•Simplified service request lifecycle to increase visibility, control and management and integrated to IBM Service Management capabilities

•Automated (de-)provisioning of IBM and non-IBM HW, OS, Middleware, Applications, Images, Network and Storage components using the same infrastructure, tools and processes

•Usage and accounting, security, scalability and green built-in

• Independent of hypervisor and virtualization technologies

•Manage both physical and virtual environments

•On-, -off premises implementation

•Leverage the IBM Cloud Management Platform Reference Architecture

Page 43: 07b - IBM Cloudburst

444444333333 © 2011 IBM Corporation

Optionally

•High availability of Cloud Management Platform

•SVC

•Appliances:– IBM WebSphere CloudBurst

– IBM WebSphere DataPower Cast Iron (hybrid cloud)

•Capacity planning:– Infrastructure Planner for Cloud Computing

Page 44: 07b - IBM Cloudburst

444444444444 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!More Information

Page 45: 07b - IBM Cloudburst

444444555555 © 2011 IBM Corporation

on ibm.com

• IBM CloudBurst on x http://www-03.ibm.com/systems/x/solutions/infrastructure/cloud/index.html

• IBM CloudBurst on p http://www-03.ibm.com/systems/power/solutions/cloud/cloudburst/index.html

Page 46: 07b - IBM Cloudburst

444444666666 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!Questions?

Page 47: 07b - IBM Cloudburst

444444777777 © 2011 IBM Corporation

TTTTTThhhhhhaaaaaannnnnnkkkkkk yyyyyyoooooouuuuuu!!!!!!Thank you

Page 48: 07b - IBM Cloudburst

444444888888 © 2011 IBM Corporation

Copyright information

IBM Corporation 2010• AIX, IBM, the IBM logo, ibm.com,Tivoli, System x, p, z are trademarks or registered trademarks

of International Business Machines Corporation in the United States, other countries, or both. If these and other IBM trademarked terms are marked on their first occurrence in this information with the appropriate symbol (® or ™), these symbols indicate US registered or common law trademarks owned by IBM at the time this information was published. Such trademarks may also be registered or common law trademarks in other countries. A current list of IBM trademarks is available on the Web at “Copyright and trademark information” at www.ibm.com/legal/copytrade.shtml.

• http://www.ibm.com/legal/copytrade.shtml#section-special• Other company, product and service names may be trademarks or service marks of others.• References in this publication to IBM products or services do not imply that IBM intends to

make them available in all countries in which IBM operates.

Page 49: 07b - IBM Cloudburst

444444999999 © 2011 IBM Corporation

Backup

Page 50: 07b - IBM Cloudburst

555555000000 © 2011 IBM Corporation

The end