-9, RADl 7, and RAD24 Are Required for S Phase Regulation in

Copyright 0 1997 by the Genetics Society of America

-9, RADl 7, and RAD24 Are Required for S Phase Regulation in Saccharomyces cerevisiae in Response to DNA Damage

A. G. Paulovich, R. U. Margulies, B. M. Garvik and L. H. Hartwell

Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 Manuscript received July 30, 1996

Accepted for publication October 1, 1996

ABSTRACT We have previously shown that a checkpoint dependent on MECl and RAD53 slows the rate of S

phase progression in Saccharomyces cereuisiae in response to alkylation damage. Whereas wild-type cells exhibit a slow S phase in response to damage, mal-1 and rad53 mutants replicate rapidly in the presence or absence of DNA damage. In this report, we show that other genes (RAD9, RADl 7, RAD24) involved in the DNA damage checkpoint pathway also play a role in regulating S phase in response to DNA damage. Furthermore, RAD9, RAD1 7, and RAD24 fall into two groups with respect to both sensitivity to alkylation and regulation of S phase. We also demonstrate that the more dramatic defect in S phase regulation in the mecl-l and rad53 mutants is epistatic to a less severe defect seen in rad9A, radl 7 A , and rad24A. Furthermore, the triple rad9A radl 7 A rad24A mutant also has a less severe defect than mcl-1 or rad53 mutants. Finally, we demonstrate the specificity of this phenotype by showing that the DNA repair and/or checkpoint mutants mgtlA, magla, apnlA, rev3A, radl8A, radl6A, dud-A100, sad4-1, tellA, rad26A, rad5lA, rad52-1, rad54A, radl4A, radlA, p0130-46, p0130-52, mad3A, pdslA/esp2A, pmlA, mlhlA, and m h 2 A are all proficient at S phase regulation, even though some of these mutations confer sensitivity to alkylation.

M ANY types of cells have been shown to respond to DNA damage by regulating progression through

the ensuing mitotic cell cycle (HARTWELL and WEINERT 1989; CARR 1995; MURRAY 1995). Regulation of cell cycle transitions in response to damage is a result of signal transduction pathways called “checkpoints” (HART- WELL and WEINERT 1989). In Saccharomyces cereuisim, checkpoint pathways responding to DNA damage or to inhibition of DNA replication regulate the entry into and progression through S phase and mitosis. Interest- ingly, many of the checkpoint genes that have been identified in yeast are necessary for controlling more than one cell cycle transition. For example, the G1-S phase DNA damage checkpoint is dependent on RAD9 (SIEDE et al. 1993, 1994), RAD24 (SIEDE et al. 1994), and RAD53/MEC2/SPKl/SADl (ALLEN et al. 1994) (G1 checkpoint status in m c l - 1 and radl 7A has not been determined), the S M checkpoint that inhibits mitosis when cells are blocked in S phase is dependent on MECl (WEINERT et al. 1994), RAD53 (ALLEN et al. 1994; WEINERT et al. 1994), and POLE (NAVAS et al. 1995), and the G2-M DNA damage checkpoint is dependent on RAD9 (WEINERT and HARTWELL 1988, 1990, 1993;), RADl 7 (WEINERT and HARTWELL 1993; WEINERT et al. 1994), RAD24 (WEINERT et at. 1994), MECI/ESRI (WEINERT et aZ. 1994), RAD53 (ALLEN et aZ. 1994; WEIN- ERT et al. 1994), MEc3 (WEINERT et al. 1994), and PDSI/

Cmesponding authw; Lee Hartwell, Fred Hutchinson Cancer Re- search Center, 11124 Columbia St., Seattle, WA 98104. E-mail: [email protected]

Genetics 145 45-62 (January, 1997)

ESP2 (YAMAMOTO et al. 1996a,b). How these same genes participate in seemingly different checkpoints at different cell cycle stages is still a mystery. However, recent evidence suggests the possibility that checkpoint genes may encode proteins involved directly in detection and/or processing of DNA lesions (LYDALL and WEIN-

We recently demonstrated that in wild-type S. cereuisiae the rate of ongoing S phase is slowed, although not blocked, when cells are subjected to alkylation damage by exposure to sublethal doses of the monofunctional alkylating agent methyl methanesulfonate (MMS) (PAULOVICH and HARTWELL 1995). Furthermore, we showed that the slowing of S phase progression in response to alkylation damage in yeast is dependent on the MECl and the RALl53 checkpoint genes (PAULOV- ICH and HARTWELL 1995); m c l - 1 or rad53mutants replicate damaged and undamaged DNA at comparable rates, ruling out a model in which lesions alone are able to slow replication and demonstrating that the slowing of S phase is an active process.

Inhibition of DNA replication in response to DNA damage had previously been demonstrated in Esche- richia coli (CAIRNEs and DAVERN 1966) as well as in mammalian cells (PAINTER and YOUNG 1980; YOUNG and PAINTER 1989; LARNER et aZ. 1994). This inhibition is due not only to a decrease in the initiation of replicons, but also to a decrease in the rate of elongation of preex- isting nascent strands (PAINTER and YOUNG 1980; LARNER et al. 1994). Cells isolated from patients afflicted by the cancer-prone, neurodegenerative disorder ataxia

ERT 1995, 1996).

46 A. G. Paulovich et al.

TABLE 1

Yeast strains

Strain Genotype

7830-2-4a yMP10177 yMP10247 yMP10252 yMP10261 yMP10318 yMP10333 yMP10359 yMP10365 yMP10366 yMP10381 yMP10382 yMP10425 yMP10428 yMP10447 yMP10464 yMP10507 yMP10519 yMP10521 yMP10537 yMP10538 yMP10590 yMP10788 yMP10789 yMP10796 yMP10798 yMP10801 yMP10844 yMP10845 yMP10847 yMP10848 yMP10850 yMP10852 yMP10853 yMP10856 yMP10860 yMP10863 yMP10882 yMP10884 yMP10886 yMP10887 yMP10889 yMP10903 yMP10904 yMP10910 yMP10931 yMP10932 yMP10934 yMP10936 yMP10942 yMP10943 yMPlO944 yMP10947 yMP10949 yMP10951 yMP10952 yMP10953 yMP10954 yMP10955

MATa ura3 leu2 trpl his3 MATa ura3 leu2 trpl his3 rad9::LEU2 MATa ade2 ade3-130 leul-12 ura3-52 canl cyh2 SCR.:URA3 sap3 rad52-1 MATa ura3 leu2 trpl his3 mecl-l::HIS3 smll MATa ade2 ade3-130 ura3-52 canl cyh2 SCR.:URA3 sap3 trpl radlA MATa ura3 leu2 trpl his3 rad9A::LEU2 rad24A::TRPl MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR:URA3 mgtlA::LEU2 MATa ura3 leu2 trpl his3 rad9A::HISjr rad24A::TRPl radl 7A::LEU2 MATa ura3 leu2 trpl his3 radl 7A::L.EU2 MATa ura3 leu2 trpl his3 rad24A::TRPl MATa ade2 ade3-I30 ura3 leu2 trpl cyh2 SCR:URA3 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR:URA3 rm3A::LEU2 MATa ade2 ade3-130 ura3 leu2 trpl qh2 SCR:URA3 radl8A::LEUZ MATa ura3 leu2 trpl his3 rad5lA::LEU2 MATa ura3 leu2 trpl his3 radl6A::URA3 MATa ura3 leu2 trpl his3 rad9A::LEU2 mec2-l::URA3 MATa ura3 leu2 trpl his3 rad24A::URA3 MATa his3 radl4A::HIS3 MATa ade2 ade3-I30 ura3 leu2 trpl cyh2 SCR.:URA3 mshZA::URA3 MATa ura3 leu2 trpl his3 rad9A::HIS3 radl 7A::LEU2 MATa ura3 leu2 trpl his3 rad24A::TRPl radl 7A::LEU2 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR:URA3 apnlA::LEU2 MATa ura3 leu2 trpl his3 rad53 MATa ura3 leu2 trpl his3 rad9A::TRPl MATa ura3 leu2 trpl his3 radl 7A::LEU2 rad53 MATa ura3 leu2 trpl his3 radl 7A::LEU2 rad53 MATa ura3 leu2 trpl his3 rad24A::TRPl rad53 MATa ura3 leu2 trpl his3 mecl-l smll MATa ura3 leu2 trpl his3 radl 7A::LEU2 smll MATa ura3 leu2 trpl his3 mecl-l smll MATa ura3 leu2 trpl his3 mecl-1 smll MATa ura3 leu2 trpl his3 radl 7A::LEU2 mecl-1 smll MATa ura3 leu2 trpl his3 radl 7A::LEUZ smll MATa ura3 leu2 trpl his3 radl 7A::LEU2 mecl-1 smll MATa ura3 leu2 trpI his3 radl 7A::LEUZ mecl-1 smll MATa ura3 leu2 trpl his3 smll MATa ura3 leu2 trpl his3 smll MATa ura3 leu2 trpl his3 rad9A::HIS3 mecl-1 smll MATa ura3 leu2 trpl his3 rad9A::HIS3 mecl-l smll MATa ura3 leu2 trpl his3 rad9A::HIS3 mecl-1 smll MATa ura3 leu2 trpl his3 rad9A::HIS3 smll MATa ura3 leu2 trpl his3 rad9A::HISjr smll MATa ura3 leu2 trpl his3 mecl-1 rad53 smll MATa ura3 leu2 trpl his3 mecl-1 rad53 smll MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCR::URA3 rad54A::LEU2 MATa ura3 leu2 trpl his3 mecl-1 rad24A::TRPl smll MATa ura3 leu2 trpl his3 rad24A::TRPl smll MATa ura3 leu2 trpl his3 rad24A::TRPl smll MATa ura3 leu2 trpl his3 mecl-1 rad24A::TRPl smll MATa ura3 leu2 trpl his3 mecl-l rad24A::TRPl smll MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 MATa ura3 leu2 trpl his3 rad53 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 MATa ura3 leu2 trpl his3 rad53 MATa ura3 leu2 trpl his3 rad53 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 MATa ura3 leu2 trpl his3 radYA::HIS3 rad53 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 MATa ura3 bu2 trbl his3 rad53

S Phase Regulation in S. cereuisiae

TABLE 1

Continued

47

Strain Genotype

yMP10956 MATa ura3 leu2 trpl his3 rad9A::HIS3 rad53 yMP10961 MATa ura3 leu2 trpl his3 rad24A::TRPl rad53 yMP10964 MATa ura3 leu2 trpl his3 rad24A::TRPl rad53 yMP10983 MATa ade2 ade3-I30 ura3 leu2 t q l cyh2 SCfi:URA3 m1hlA::TRPl yMPllO58 MATa ura3 leu2 trpl mad3A::LEU2 yMP11069 MATa ura3 leu2 trpl his3 rad53 smll yMP11070 MATa ura3 leu2 trpl his3 rad53 smll yMP11071 MATa ura3 leu2 trpl his3 rad53 smll yMP11072 MATa ura3 leu2 trpl his3 rad53 smll yMPllO73 MATa ura3 leu2 trpl his3 rad53 smll yMP11074 MATa ura3 leu2 trpl his3 rad53 smll yMPllO82 MATa ade2 ade3-130 ura3 leu2 trpl cyh2 SCfi:URA3 pmlA::LEU2

Y286 MATa canl-100 ade2-l his3-11,15 leu2-3,112 trpl-I ura3-100 dunI-A100::HIS3

sad4 MATa ura3-l his3-11,15 leu2-3,112 trpl-I ade2-1 cad-100 sad4-1 TELl MATa ade2 his3 trpl ura3 leu2 tell MATa ade2 his3 trpl ura3 leu2 PY38 MATa ura3-52 t q l A 9 0 1 leu2-3,112 canl po130Al+ pBL2II-POL30 p0130-46 MATa ura3-52 trplA901 leu2-3,112 canl po13OAl + p230-46

Y202 MATa canl-100 ade2-1 hsi3-11,15 leu2-3,112 tq l -1 ura3-IO0

Y80 MATa ura3-1 his3-11,15 leu2-3,112 trpl-I ade2-1 cad-100

~0130-52 MATa ura3-52 trplA 901 leu2-3,112 canl po130AI + p230-52

telangiectasia (AT) fail to inhibit both the initiation and elongation of DNA replicons in response to DNA damage (PAINTER and YOUNG 1980), leading to the hypothesis that AT cells lack a factor or process that delays replication in normal cells after DNA damage (PAINTER and YOUNG 1980). Interestingly, MECl is a homologue of ATM (AT-mutated), the gene mutated in AT patients (SAVITSKY et al. 1995a,b).

In this report, we describe further genetic characterization of the role of the DNA damage checkpoint in controlling S phase progression. We examine the con- tributions of other known checkpoint genes to this process and find that RAD9, R A D 1 7, and RAD24 are all involved in controlling the S phase rate, although to a lesser extent than MECl and RAD53. A role for RAD9, RAD1 7, and RAD24 in the control of S phase was unexpected, since none of these genes appears to be required for the control of mitosis in response to HU exposure or Cdc8p limitation (WEINERT and HARTWELL 1993; WEINERT et al. 1994). (The possibility that some unrecognized aspects of the cell cycle continue in HU- treated rad9, radl 7, o r rad24 mutants cannot be excluded.) We also survey a collection of DNA repair mutants, including representatives from nucleotide excision repair, base excision repair, recombinational repair, postreplication repair, and mismatch repair, and find that not all mutants sensitive to MMS are defective in S phase regulation, demonstrating the specificity of the DNA damage checkpoint in the control of S phase.

MATERIALS AND METHODS Media and growth conditions: YEPD and dropout media

have been described (SHERMAN et al. 1981). Y"1 is described in HARTWELL (1967).

Yeast strains: All yeast strains with the designation yMP (Table l), and also strain 7830-24a, are in the A364a background. rad9A, radl 7A, rad24A, mecl-1, and rad53 single mutants in the A364a background were kindly provided by TED WEINERT (WEINERT and HARTWELL 1990; WEINERT et al. 1994; LYDALL and WEINERT 1995) and subsequently crossed to other mutants in the A364a background during the course of this study to generate the double and triple mutants described herein. The rad53 allele used in this study was originally is* lated as mec2-l (WEINERT et al. 1994). The radlA mutant was described previously (KADYK and HARTWELL 1993). The radl4A mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the EcoRV-SpeI fragment of plasmid pBRWSradl4:: HZS3, missing the HindlII-Sac1 fragment of RADl4, kindly provided by W. SIEDE and E. FRIEDBERG. The radl6A mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the huII fragment of plasmid pBLY22, kindly provided by C. LAURENT (SCHILD et al. 1992). The radl8A mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the BamHI-Hpd fragment of plasmid radl8A1, kindly provided by F. FABRE. The rad26A mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the DraI fragment of plasmid pra- d26:: URA3, kindly provided by J. BROUWER (VAN MOL et al. 1994). The rad5lA mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the B a d 1 fragment of plasmid rad5lALEU2, kindly provided by F. FABRE. The rad54A mutant was constructed by PCR-based gene replacement (BAUDIN et al. 1993) using oligonucleotides designed to delete over 90% of the coding sequence. [Oligonucleotides contained sequences internal to RAD54 and sequences flanking LEU2. PCR using pRS305 (SIKORSKI and HIETER 1989) as a template generated an intact LEU2 gene flanked by sequence homology to RAD54. oligo 1: 5'-ACA GAC CAC CAA ATG GAATAGGAGCCGGTGAACGGCCGAGAGCGGTCT AAG GCG CCT GAT-3'; oligo 2: 5'-CCA AGT TGT CGC ATC ACCATATAACATTGCAGG GGCTCT CGGAAC TTT CAC CAT TAT GGG-3'1. The apnlA mutant was constructed by PCR-based gene replacement (BAUDIN et al. 1993) using


oligonucleotides designed to delete over 90% of the coding sequence. [Oligonucleotides contained sequences internal to APNl and sequences flanking LEU2. PCR using pRS305 (SI- KORSKI and HIETER 1989) as a template generated an intact LEU2 gene flanked by sequence homology to APNI. oligo 1:

CTA GCT TAG CGG TCT AAG GCG CCT GAT-3'; oligo 2:

TCC TCT TGG AAC TTT CAC CAT TAT GGGS']. The nzaglA mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the EcoRI fragment of plasmid pUC 5.1, kindly provided by L. SAMSON (CHEN et al. 1990). The mgtlA mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the Hind111 fragment of plasmid pYMTA, kindly provided by L. SAMSON (XMO et at. 1991). The msh2A mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the AatII-PuuII fragment of plasmid pEN63, kindly provided by R. KOLODNER. The pmslA mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the A@-MluI fragment of plasmid PAM58, kindly provided by A. SUCINO (MORRISON et al. 1993). The rm3A mutant was constructed by one-step gene replacement (ROTHSTEIN 1983) using the Sad-SmaI fragment of plasmid pRS101, kindly provided by C. LAWRENCE (MORRISON et al. 1989). The mad3A mutant was constructed using one-step gene replacement (ROTHSTEIN 1983) to delete the genomic interval from -14 to +1427 nucleotides of MAD3 coding sequence (D. TOCZYSKI, personal communication). The mlhIA mutant was constructed by PCR-based gene replacement (BAUDIN et al. 1993) using oligonucleotides designed to delete over 90% of the coding sequence. (Oligonucleotides contain sequences internal to MLHl and sequences flanking TRPI. PCR using pRS304 (SIKORSKI and HIETER 1989) as a template generated an intact TRPl gene flanked by sequence homology to "1. oligo 1: 5'CGA GAA ATT AGC AGT TTT CGG TGT TTA GTA ATC GCG CTA GAG ATT GTA CTG AGA GTG CAC-3'; oligo 2: 5'-GTA TAG ATC TGG AAG GTT GGC TAT TTC CAC GAC ATC CTT GCT GTG CGG TAT TTC ACA CCG3'. The p d s l A mutant was constructed by PCR- based gene replacement (BAUDIN et al. 1993) using oligonucleotides designed to delete over 90% of the coding sequence. [Oligonucleotides contain sequences internal to PDSl and sequences flanking LEU2. PCR using pJ250 (JONES and Pu- KASH 1990) as a template was used to generate an intact L!?U2 gene flanked by sequence homology to PDSI. oligo 1: 5'-CTA GAT TAA GTG CTA GAT AAT AAA CCT TTA TGA TGC CAG CAG GAA ACA GCT ATG ACC ATG3'; oligo 2: 5'-ATG AGC AGT GGA TCT AAG TAA CTA AGT CCT CTA GTT CTT CGT TGT AAA ACG ACG GCC ACT-3'1 . Genomic struc- tures of all mutants were confirmed using either Southern blot analysis or PCR followed by diagnostic restriction map- ping (data not shown). dun1 (ZHOU and ELLEDCE 1993), sad4 (STEVE ELLEDGE), telIA (GREENWELL et al. 1995), and pol?O (AWACARI et al. 1995) mutants, as well as congenic wildtype parental controls, were kindly provided by other labs (as refer- enced) and are not in the A364a background.

MMS-asynchrony experiment: Cells (2.9 x 10') were harvested from a log phase culture grown overnight at 30" in Y" 1 + 2% glucose. Cells were resuspended in 60 ml Y"1 + 2% glucose + 0.03% MMS (final concentration). One MMS solution was used for all strains in a given experiment to assure identical MMS concentrations between cultures. Cul- tures were incubated at 30", and at various times after resuspension in 0.03% MMS samples of 1 1 ml were removed for cell cycle analysis and viability assessment.

MMS-synchrony experiment: Cells (1 X 10') were harvested from log phase cultures grown overnight at 30" in Y" 1 medium + 2% glucose. Cells were resuspended in 210 ml

5"GGC ATA TCG GAA CCA TCG TAA TGC CTT CGA CAC

5"TTCTTCTCGCTTCTCATTATTCTTTCTTAGTCT

Y"1 + 2% glucose, 10 ml were removed for flow cytometry, and the remainder of the culture was synchronized in the G1 phase by the addition of alpha factor to a final concentration of 3 p ~ . After 2 hr of incubation at 30°, the culture was split in half, and one half was treated with 667 pL of 5% MMS in Y"1 (0.033% final concentration of MMS). The incubation was continued at 30" for an additional 30 min, after which 10 ml were removed ( t = 0) for cell cycle analysis. The cultures were harvested and released into the cell cycle by resuspension in 100 ml YM-I + 2% glucose + 0.1 mg/ml pronase, 2 0.033% MMS final concentration. At the indicated times after release, samples were removed for viability assessment and/ or cell cycle analysis.

MMS kill curves: Cells (2.9 X loH) were harvested from a log phase culture grown overnight at 30" in Y"1 + 2% glucose. Cells were resuspended in 60 ml Y"1 + 2% glucose + 0.03% MMS (final concentration). One MMS solution was used for all strains in a given experiment to assure identical MMS concentrations between cultures. Cultures were incubated at 30°, and samples were removed at t = 1, 2, 3, and 4 hr. For the kill curves in Figure lH, 1 ml was harvested, sonicated, and used for viability assessment. For the kill curves shown in Figure 4, at various times after resuspension in 0.03% MMS, 10 ml were harvested, resuspended in 1 ml 5% sodium thiosulfate to inactivate the MMS, sonicated, and used for viability assessment. Initial viabilities ( t = 0) were determined from the starting culture, before exposure to MMS.

Viability assessment: Following sonication and dilution of the sample into normal saline, cell concentration was determined using a Coulter Channelizer. Viable cells/ml was determined by plating serial dilutions of cultures onto C plates and scoring the number of colony-forming units (CFU) after 2 - 3 days at 30". Viability was calculated as CFU/total cells.

Statistical analysis of data: So that the kill curve data could be accurately represented using a logarithmic yaxis, the mean and the standard deviation calculations were done as follows.

Let y( t ) = percentage of cells surviving at time t.

Y(0 = CFU per mL at time t

total cells per mL at time t ] x 100.

For n independent experiments,

mean Log y( t ) = x:= I Log yx( t )

n

The ordinates of the kill curves in Figure 1H and Figure 4 are mean r ( t ) = 1 p C a t l 1.1% v ( 0

Standard deviation (SD) Log y( t )

- - [Log mean y( t ) - Log yx(t)12 n

Finally, error bars were determined as follows: Error y ( t ) =

Flow cytometry: For flow cytometry, 10-mi samples were harvested and cells were fixed in 70% ethanol for 12-24 hr at 4". Samples were then washed once with 5 ml50 mM sodium citrate pH 7.5, and resuspended in 1 ml50 mM sodium citrate. Cell concentration was determined using a Coulter Channel- izer, 8 X lo6 cells were transferred to a new tube, and the total volume was adjusted to 1 ml with 50 mM sodium citrate. Twenty-five microliters of 10 mg/ml RNase A was added to each sample, and after a 1-hr incubation at 50", 50 pl of 20 mg/ml proteinase K was added. The incubation was continued an additional 1 hr at 50", after which 1 ml of 50 mM sodium citrate containing 16 pg/ml propidium iodide was added. Samples were incubated in the dark for 12-48 hr at 4" and analyzed using a Becton-Dickinson fluorescence-

10[mcan Log v(r).-so L,ogv(/~]

activated cell analyzer. Fifteen thous;uld cells were analyzed for each histogram.

RESCLTS

rad9A, rad1 7 A , and rad24A mutants are defective in S phase regulation, although to a lesser extent than mecl-1 and rad53 \Ye previorlsly showed that when a logarithmically growing population of wild-type yeast cells is exposed to a sublethal dose (0.015%) of the monofunctional alkylating agent MMS, the distribution of cells in the cell cycle is dramatically altered (PM~I.O\- I<:11 and H,\KITYIXL. 199.5). Cell division is inhibited within one cell cycle time, and cells accumulate with a large-budded morphology, indicating that they have passed "start." Concomitant with the large-budded arrest, cells accumulate first with a G1, and then with an S phase content of DNA, and replication continues at a slower than normal rate in response to the damage. As a standard to compare with the mutants examined herein, this effect is reproduced in Figure lA, at a higher dose (0.033%) than was previously used (0.015%). Wild-type cells were grown to mid-log phase, harvested, and resuspended in medium containing 0.033% MMS. The culture was placed at 30", and samples were withdrawn at hourly intervals. Cells were removed from the MMS, and one aliquot was fixed for flow cvtometric analysis (Figure 1A) whereas a second aliquot was plated onto rich medium to determine viability (Figure IH) . The wild-type cells first accumulate with a Gl/earlv S phase DNA content, and then pro- ceed throng11 a greatly extended S phase: replication in the absence of MMS takes fewer than 30 min (see Figure 2). whereas replication in the presence of 0.015% MMS takes -3-4 hr (P,WI.O\~ICII and HAKT- MWL 199.5), and in the presence of 0.033% MMS takes even longer (Figure 1A).

M'e previously reported three controls (PAUI.O\~I<:FI and HAKTIVIXI. 199.5) that demonstrated that the peak- shifting we observe in our flow cytometry histograms is a reflection of chromosomal DNA synthesis antl not an artifact of prolonged cell cycle arrest at the G1 checkpoint or of MMS treatment. First, the slow shifting of the flow cytometry histogram from G1 to G2 positions in cells treated with MMS is inhibited by alpha factor, which induces GI arrest but allows cells to continue growing. Second, the slow shifting of the histogram is inhibited by hvdroxy~rea (HU), which inhibits replicative DNA synthesis. Finally, the slow shifting is associ- ated with the slow acquisition of a G2 level of X-ray resistance, unequivocally demonstrating that these wild- type cells completed chromosomal replication, and allowing u s to conclude that the flow cytometry profiles we obtain from MMStreated cells accurately reflect nuclear DNA content.

M'e also demonstrated previously, and reproduce here for comparison (Figure 1, R and C; see Figure

WT

9A 17A

24 A 17A24A

9A17A 9Al7A24A 9 A24A

0.01 *, 0 1 2 3 4 5

Hours in MMS

FIGL'RI: I.-CeII cycle redistrihution and viahilit\. following conlintlous exposure of asynchronous populations of wild-~pe or checkpoint mrltmt yewt cells to MMS. Exponentially grow ing populations of wild type (7830-24). mrcl-1 (yMP10848). rod53 (yblP10788), mdl7A (yMP1036.5), rrrr124A (yMP10366), rd9A (yMP10789), md9A rod1 7A (yMP10537), r n d M rnd24A (yW"p03I8), rndl7A md24A (yMPI0.',38). or md9A rndl7A d 2 4 A (yMP10359) were subjected to continuolts exposure to 0.03% MMS. At the indicated times after exposure, samples were removed, plated for determination of \iahiIity, ;~nd ana- Iyxd hy f l o w cytomety. (A-C;) Each panel contains two histograms. Shaded histograms represent the cell cycle distrihution o f the as!mchronous culture, before addition of MUS. Overlaid histograms represent the cell cycle distrihution at various times after addition of MMS. Upon exposure to MltS, all strains accumulated with a uniform large-hudded morpholop (Pt\r- 1.0\7(:11 and HARTNTIJ, 1995; A. G. P,.\L'I.O\W:ll, R. U . MARGL'- I.IES antl 1.. H. H A K ~ \ T I . I . , unpuhlished result?). (H) Each kill curve represents the mean of at least three independent expcri- ments, and SDs (see \~I;\TI.:Rl;\IS ANI) AII.:TIIOI)S) are shown for each data point.

2), that the slowing of S phase in response to MMS is dependent on MlK*I and RAD53, since cells mutant for either of these hvo genes are sensitive to MMS and replicate at comparable rates in the presence or absence of DNA damage. To assess whether other checkpoint genes are necessan, for S phase regulation in response to alkylation damage, we performed these same experiments on rud9A, rndl7A, and rnd24A mu-

50 A. G. Paulovich e/ nl.

WT mecl-1 rad174 rad24A rad9A 94244 MMS: - + - + - + - + - + - +

FIGURE: Z.-Determination of S phase progression rate in synchronized populations of wild-type and checkpoint mutant cells. Cells were synchronized in GI and released in either the presence or the absence of 0.033% MMS. Shaded histograms represent the cell cycle distribution of the asynchronous culture, before alpha factor treatment. Overlaid histograms represent the cell cycle distribution after release from alpha factor into 20.033% MMS for the indicated times. Viabilities determined 120 min after alpha factor release into MMS were as follows: wild-type (7830-2-4a), viability 22%; mecl-I (yMP10252), viability <0.05%; rnd17A (yMP10365), viability 0.5%; rud24A (yMP10366), viability 0.7%; m d 9 A (yMP10177), viability 2.4%; rud9A rnd24A (yMP10318), viability 0.07%.

tants. As with wild type, all three mutants show an initial accumulation in G1 and early S phase 1 hr after exposure to 0.033% MMS (Figure 1, D-F). Also similar to the wild type, S phase is lengthened in response to the MMS; rad9A, rad1 7A , and rad24A barely complete one full round of replication throughout this entire 4 h r exposure (Figure 1, D-F), whereas replication is nor- mally completed within 15-30 minutes (see Figure 2). However, the extent to which S phase is inhibited in these three checkpoint mutants is clearly much less than the extent of inhibition in wild-type cells, since the wild type is only approximately halfway through S phase after four hours (Figure 1A). Hence, rad9A, rad1 7A, and rad24A show attenuated, although not ab- sent (as in m c l - I and rad53), S phase regulation in response to MMS. In addition to the partial defect in S phase regulation, rad9A, rad1 7A , and rad24A have intermediate sensitivity to MMS; they are 30-60 times more sensitive than the wild type, and 10-180 times more resistant than the m c l - I and rad53 mutants (see Figure 4, 4-hr timepoints).

RAD9 is in a different epistasis group from RAD1 7 and RAD24: RAD9is in a different epistasis group from

R A D 1 7 and RAD24, as determined by the sensitivity of the double and triple mutants to MMS. rad9A, radl 7A, and rad24A single mutants, as well as a radl 7 A rad24A double mutant, are 30-60 times more sensitive to MMS than the wild type (Figure lH, 4 h r timepoints). How- ever, rad9A radl 7 A and rad9A rad24A double mutants, as well as the rad9A radl 7 A rad24A triple mutant, are 200-300 times more sensitive than the wild type (Figure lH, 4 h r timepoints). These quantitative data are in agreement with the previous qualitative report of LY- DALL and WEINERT (1995).

The rad9A radl 7A d 2 4 A triple mutant is only par- tially defective at S phase regulation: The partial defects in S phase regulation in rad9A, radI7A, and rad24A as compared to the complete defect in m c l - 1 and rad53could indicate that RAD9, R A D 1 7, and RAD24 are each necessary for only a subset of functions that are dependent on mecl-1 and rad53 and that are necessary for the wild-type level of S phase regulation. If each were involved in a different subset of functions, rad9A, rudl7A, and rad24A double or triple mutants might have a complete defect in S phase regulation, similar to mecl-1 and md53. To test this possibility, we constructed

S Phase Regulation in S. cereuisiae 51

rad9A radl 7A, radl 7A rad24A, and rad9A radl 7 0 rad24A mutants and assessed their ability to regulate S phase progression in response to MMS exposure. Nei- ther double mutant (data not shown) nor the triple rad9A radl 7A rad24A (Figure 1G) mutant showed the complete defect in S phase regulation displayed by the mecl-1 and rad53 mutants. The triple mutant may have a slightly faster S phase than any of the single mutants (compare Figure 1, D-G), although this reproducible effect is at the limits of resolution for this assay.

Synchronization of cells in G1 before challenge with MMS yields similar results and reveals that rad1 7A and d24A progress through the cell cycle slightly faster than rad9A: It is possible that the apparent ability of a particular mutant to regulate the rate of S phase progression appropriately in response to MMS is affected by the position of the cells in the cell cycle when the cells are exposed to MMS. In fact, we have seen such an effectwith other mutants (see Figure 5, radl8A mutant; A. G. PAULOVICH, R. U. MARGULIES and L. H. HART-

WELL, unpublished observations). Therefore, to compare the S phase rates of these mutants more rigorously, we repeated these experiments with cells synchronized in the G1 phase and then released into the cell cycle in either the presence or the absence of MMS (Figure 2). As previously shown (PAULOVICH and HARTWELL

1995), wild-type cells synchronized in G1 by alpha factor treatment and then released into the cell cycle in the presence of MMS replicate their DNA more slowly than control cells that were not exposed to MMS. Cells complete replication within 30 min in the absence of MMS, whereas cells replicating in the presence of 0.033% MMS have still not completed replication 180 min after release from alpha factor arrest (Figure 2). Note that S phase progression appears to be less slowed in this synchrony experiment than it was in the asynchrony experiment at the same dose of MMS (compare Figure 1A and Figure 2,0.033% MMS). This is most likely due to the fact that most cells would experience more lesions before entering S phase in the asynchrony experiment (Figure 1) than in the synchrony experiment (Fig- ure 2) for the same dose of MMS. Unlike cells in the synchrony experiment (Figure 2), the majority of cells in the asynchronous culture spend at least 1 hr in MMS before entering S phase (Figure 1A) . In fact, if the dose- response is compared between two synchrony experiments, as well as between two asynchrony experiments, it is clear that the degree to which S phase is prolonged is directly proportional to the dose of MMS delivered (PAULOVICH and HARTWELL 1995; data not shown).

The rad9A, radl 7A, and rad24A mutants behave similarly in this synchrony experiment to their behavior in the asynchrony experiment. All three mutants show a G1 delay in response to MMS (Figure 2, compare 15- min timepoints ? MMS), and all three mutants show some slowing of S phase progression in MMS. However, the degree to which S phase is slowed in the mutants

is much less than the degree to which it is slowed in the wild type. For example, 105 min after release into MMS, radl7A and rad24A have completed S phase, whereas the wild type still shows significant accumulation in the S phase (Figure 2). Note the subtle, yet very reproducible (data not shown) difference between rad9A and radl 7A or rad24A; rad9A completes S phase slightly more slowly than radl 7A or rad24A (compare 45-105-min timepoints, Figure 2). This difference is intriguing given that RAD9 is in a different epistasis group from R A D 1 7and RAD24 (FIGURE 1H; LYDALL and WEINERT 1995), and it could be due either to different requirements for these two epistasis groups within the S phase, to different requirements in G1, or both. For example, in addition to showing slightly faster progression to G2, radl 7A and rad24A may also show a slightly attenuated G1 delay than rad9A in response to MMS; 15 min after release into MMS, all mutants and the wild type have a similar fraction of cells in G1, but at 30 min after release, radl 7A and rad24A reproducibly have a slightly smaller fraction of cells in the G1 peak than does rad9A. However, one cannot distinguish G1 from early S phase using this assay. To determine whether combining mutations from the two epistasis groups (Figure 1H) would result in a mecl-1- or rad53like complete defect in S phase regulation, we constructed a rad9A rad24A double mutant and tested its ability to regulate S phase. The rad9A rad24A double mutant shows a defect in S phase regulation comparable to the rad24A single mutant, consistent with results we obtained with the rad9.A radl 7A rad24A triple mutant (Figure lG) . We conclude that double mutants between the two epistasis groups do not have the complete defect in S phase regulation seen in mal-l and rad53.

mecl-1 is lethal in the A364a background, and mecl-1 strains in this background contain a second-site bypass suppressor of the essential function of mecl-1: We wished to combine mecl-1 with rad9.4, radl 7A, and rad24A mutations for a series of experiments described below. While crossing mecl-1 strains to a variety of other strains, we noted a preponderance of tetrads showing 3:l segregation of viability (Table 2, cross one). The one dead segregant formed a large (>50 cells) microcolony and was almost always inferred to have inherited a m c l - 1 allele, based on the segregation of the hydroxyurea- sensitive phenotype in the three viable spore products. Likewise, in tetrads giving rise to only two viable segregants, the two dead segregants were almost always inferred to be mecl-1. We hypothesized that mcl-1 is a lethal mutation that could be suppressed by a second- site mutation. To test this hypothesis, we obtained two MECl (hydroxyurea-resistant) segregants from a tetrad segregating 2:2 for viability (derived from a mecl-1 X MECl diploid; see Table 2, cross one), assumed that these two segregants must have inherited the putative suppressor, and crossed both to a mcl-1 strain (see Table 2, crosses two and three). If the suppressor hy-


TABLE 2

The mecl-1 mutation is lethal in A364a

Cross one: m a l - 1 X wt 22 X 4 viable spore tetrads (vst) 52 X 3 vst 10 x 2 vsta 5 x 1 vst

Cross two: mecl-1 X 38 X 4 vst MECl spore #1 9 x 3 VSt

(suppressor?) 1 x 2 vst 0 x 1 vst

Cross three: mecl-1 X 36 X 4 vst MECl spore #2 8 x 3 vst (suppressor?) 0 x 2 VSt

1 x 1 vst

a Both MECl viable spores from one of these tetrads showing 2:2 segregation for viability were crossed to a mecl-1 strain, and the results are shown under cross two and cross three above.

pothesis were correct, these diploids should be homozy- gous for the presence of the suppressor and therefore should give rise to a preponderance of four viable spore tetrads. As can be seen from the data in Table 2 (crosses two and three), this is indeed the case. The majority of tetrads from both crosses contained four viable spores (38/48 and 36/45). We conclude that mecl-1 is lethal in the A364a background, but that its essential function can be bypassed by a second site suppressor, which we call smll buppressor of mecl lethality). Furthermore, the ability of smll to suppress mecl-1 is not dependent on RAD53, RAD9, RAD1 7, or RAD24 (see Figure 3). smll can also rescue the inviability of a meclA deletion allele (E. FOSS and L. H. HARTWELL, unpublished observations). Hence smll bypasses the essential function of MECI, but not its checkpoint function, showing that the checkpoint function and the essential function of MECl can be genetically separated.

Aside from suppressing mecl-1, there is no other known phenotype conferred by smll. Specifically, smll single mutants grow at wild-type rates, are not sensitive to HU, MMS, or UV-irradiation, do not have a meiotic defect, and show wild-type levels of S phase regulation in response to MMS (Figure 3; A. G. PAULOVICH, R U. MARGULIES and L. H. WWLL, unpublished data). Nonetheless, it was formally possible that smZl could unexpectedly confer a phenotype when combined with other checkpoint mutations. To control for any such effects, all experiments described below in which mecl-1 is combined with another checkpoint mutation have been appropriately controlled for the presence of smll (Figure 3), such that all single and double mutants being compared contain the smll mutation (see Figure 3, Figure 4, A-D).

The more severe defect of mecl-1 and rad53 mutants is epistatic to the partial defects of radSA, radl7A or rud24A: It was possible that the residual S phase slowing in rad9A, radl 7 0 , and rad24A was not a result of regulation. For example, these mutations may result in the accumulation of DNA lesions that are capable of

physically blocking DNA polymerase, thereby resulting in slowing of S phase progression. If the residual slowing of S phase progression in rad9A, radl7A, and rad24A were due to regulation, then the slowing would require MECl and RAD53. However, if the slowing were due to the accumulation of polymerase-blocking lesions, the slowing would not require MECl and RAD53. To determine whether the slowing of S phase in these mutants was checkpoint-dependent, we constructed all possible double mutant combinations between mecl-1, rad53, rad9A, radl 7 4 , and rad24A and tested their ability to regulate S phase progression in response to MMS.

Cells were grown to mid-log phase, harvested, and resuspended in medium containing 0.033% MMS. Cul- tures were placed at 30°, and samples were withdrawn at hourly intervals. Under these conditions, examina- tion of the flow cytometry profiles after 2 and 4 hr of incubation with MMS allows the wild-type response to be distinguished from the mecl-I or rad53 responses and from the rad9A, radl 7A, or rad24A responses (see also Figure 1, 2- 4 h r timepoints); at the 2-hr timepoint, wild-type cells are predominantly in the early S phase, whereas radl 7 4 and rad24A are predominantly in late S phase and mecl-1 and rad53 are predominantly in the G2 phase (Figure 1, A-E and Figure 3). At the 4 h r timepoint, wild-type cells remain in mid-S phase, whereas radl 7A and rad24A mutant cells are now predominantly in the G2 phase (Figure 1, A-E and Figure 3), and rad9A mutant cells are in late S phase. As can be seen in Figure 3, A and B, the more severe defects of mecl-1 and rad53 are epistatic to the partial defects of rad9A, radl 7A, and rad24A, leading us to conclude that the partial slowing of S phase progression in the rad9A, radl 7 4 , and rad24A mutants is indeed the result of a MECI- and RAD53dependent control.

MMS-sensitivity conferred by mecl-1 and rad9A is additive: To determine whether MECl acts in the same or in different pathways as the other checkpoint genes in responding to MMS, we assayed the sensitivity of all possible double mutants to MMS exposure. The smll mutation was present in each of these strains. In addition, to control for any other unknown modifiers that might be segregating in crosses among these genetically unstable mutants, two or three independent isolates of each genotype were examined. The mecl-1 rad9A double mutant is 22 times more sensitive to MMS than the mecl-1 single mutant following 4 hr of exposure (Figure 44). In contrast, mecl-1 radl 7 4 (Figure 4B), mecl-I rad24A (Figure 4C), and mecl-I rad53 (Figure 4D) double mutants all show sensitivities to MMS comparable to that of the mecl-1 single mutant, although mecl-1 rad24A may be slightly more sensitive to MMS than mecl-1 (Figure 4C). We conclude that in response to MMS, RAD9must have at least one function not entirely dependent on MECI. This greater effect of rad9A than radl 7 A or rad240 on the MMSsensitivity in the double mutant is consistent with R A D 9 s being in a different

S Phase Regulation in S. cprpvisim 53

B k A

W T

rad94

radl 73

rad24-4 2 Hr. 4 Hr.

mecl-1

mecl-lradl74

2 Hr. 4 Hr.

WT

rad9il

radl 7~1

rad53

rad53rad9.4

rad53radl z I

rad53rad24~ 2 Hr. 4 Hr.

FIGURE 3.-The mcl -1 and rad53 phenotypes are epistatic to the rad9A, md17A, and md24A phenotypes. Exponentially growing populations of wild-type or checkpoint mutant cells were exposed to 0.03% MMS. Following 2 and 4 hr of continuous exposure, samples were removed and analyzed by flow cytometry. Each panel contains two histograms. Shaded histograms represent the cell cycle distribution of the asynchronous culture, before addition of MMS. Overlaid histograms represent the cell cycle distribution at various times after addition of MMS. All strains in B contain the smll supressor of mecl-1 lethality. Strains used are as follows: (A) wild type (7830-2-4a), md9A (yMP10789), rad17A (yMPI0365), md24A (yMP10366), rad53 (yMP10788), rad53 rad9A (yMP10952). rad53 rad17A (yMPI0796), rad53 rad24A (yMPl0961). (B) wild type (yMP10863), md9A (yMP10887), rad17A (yMP10852), rad24A (yMPI0934), m c l - 1 (vMP10844), mecl-I md9A (yMP10882), mpcl-1 rad17A (yMP10856), m c l - I md24A (yMP10936).

epistasis group from R A D l 7 and RAD24 (Figure lH, Figure 2; LYDALL and WEINERT 1995).

Given that A4ECI and RAD53 are in the same epistasis group (Figure 4D), we expected RAD53 to show the same epistatic relationship to RAD9, RADl 7, and RAD24 as does MECI. Consistent with this expectation, rad53 rad9A double mutants are more sensitive to MMS than is the rad53 single mutant (Figure 4E), and rad53 radl 7 A (Figure 4F) and rad53 rad24A (Figure 4G) double mutants have sensitivity to MMS that is comparable to, although slightly greater than, the rad53 single mutant.

Defects in S phase regulation are specific to checkpoint mutants: To determine whether all mutations that conferred sensitivity to MMS showed a defect in S phase regulation, we surveyed a large collection of DNA repair mutants using the protocol in Figure 3. The results are shown in Figure 5 , which is organized such that the first column shows the 2- and 4-hr timepoints for A364a wild- type and checkpoint mutant strains, the second and third columns show the corresponding timepoints for a panel of DNA repair mutants that we constructed in the A364a background for direct comparisons with known checkpoint mutants. The fourth and fifth columns show the same timepoints for several mutants we obtained from other labs, in addition to a congenic wild-type control for each. The viability of each mutant at the 2-hr timepoint is

shown in parentheses. Nucleotide excision repair-clefec- tive mutants ( m d l A , rad14A, rdl6A, rad26A) are relatively resistant to MMS and show significant accumulation within the S phase in response to MMS, similar to the wild-type control. Recombination-defective mutant$ ( r d 5 l A , rad52-1, and r d 5 4 A ) are considerably more sensitive to MMS than the wild type, although each shows accumulation within the S pha$e similar to the wild type in response to MMS. rcull8A, involved in postreplication repair, shows sensitivity to MMS comparable to m c l - 1 and r d 5 3 , yet shows wild-type S phase regulation. [Al- though at the 4 h r timepoint this mutant appears to have a defect in S phase regulation similar to r d 2 4 A , we have followed up this study with careful synchrony experiments (data not shown) that clearly demonstrate normal S phase regulation in this mutant in response to MMS. We suspect that the apparent difference between r d 1 8 A and the wild type in this asynchrony experiment may be due to differences in the cell cycle distribution of the starting cultures of these two strains, and therefore any mutant showing an apparent defect in S phase regulation in an asynchrony experiment was examined in a synchrony experiment (Figure 2)].

One quantitatively minor (SINGER and GRUNRERGER 1983) yet highly mutagenic lesion (reviewed in FRIEDBERG et al. 1995) induced by MMS is 06methyl- panine. This lesion is removed by an 06methylgua-


"-{ , , f\,j mecl rad9A 0.0001

0 1 2 3 4 5 Hours In MMS

B

WT

rad 174

mecl mecl rad1

o.wo1 I

76

0 1 2 3 4 5 Hours in YPS

C

.-$ mecl rad24A

0 1 2 3 4 5

Hours in MMS

5 W

n - 5 8

WT

rad53 mecl rad53 mecl

WT

rad9A

rad53

rad53 rad9A

0 1 2 3 4

Hours In MMS

F

5

0.0001 I

0.001 i

WT

rad77A

rad53 rad53 radl7A

0 1 2 3 6 5

G Hours in MMS

WT

radZ4A

rad53 rad53 radZ4A

Onol 1 I O.M)Ol,,

0 1 2 3 9 5

Hours in MMS

0.m1 I 0 1 2 3 4 5

Hours in MMS

S Phase Regulation in S. cmeuisiue 55

nine DNA repair methyltransferase, which reverses the damage by transferring the methyl group to a cysteine residue of the protein, thereby permanently inactivat- ing its methyltransferase activity (reviewed in FRIEDBERG et al. 1995). To determine whether this activity was necessary for S phase regulation, we disrupted the MGTl gene, which encodes the yeast 06-methylguanine methyltransferase (XLAO et al. 1991). During the course of our experiments, we noticed that the mgtlA mutant failed to grow at 36" but was viable at 30". The temperature-sensitivity cosegregated with mgtlA in over 100 tetrads examined from several independent crosses (A. G. PAULOVICH and L. H. WWLL, unpublished observations). [Upon shifting to the nonpermissive temperature for 5 hr, a log phase starting culture of mgtlA cells became uniformly arrested with a G1 DNA content but remained viable, and no induction of mutation oc- curred (A. G. PAULOVICH, R. U. MARGULIES and L. H. HARTWELL, data not shown) .] At the permissive temperature (30"), the mgtlA mutant showed an S phase response comparable to the wild type (Figure 5). We conclude that MGTl is essential for the Gl-S transition at 36", but is not essential for S phase regulation at 30" in response to MMS.

The most abundant lesion induced by MMS is N7- methylguanine (SINGER and GRUNBERGER 1983). An- other N-alkylpurine, 3-methyladenine, is also induced by MMS (SINGER and GRUNBERGER 1983). Although this is a minor lesion quantitatively (SINGER and GRUNB ERGER 1983), it is believed to be biologically important because it blocks the passage of a DNA polymerase in vitro (BOITEUX et al. 1984). These lesions are removed by a base excision repair pathway (BER) in which a DNA glycosylase removes the alkylated base, thereby forming an abasic site (reviewed in FRIEDBERG et al. 1995). The abasic site is recognized by an apurinic/ apyrimidinic (A€')-endonuclease, which nicks the DNA backbone 5' to the abasic site and leads to its removal (reviewed in FRIEDBERG et al. 1995). In S. cermisiae, the glycosylase activity is encoded by the MAGl gene (CHEN et al. 1989, 1990), and the A€'-endonuclease is encoded

by the APNl gene (POPOFF et al. 1990; RAMOTAR et al. 1991). To determine whether this pathway of base excision repair was necessary for S phase regulation in response to MMS, we constructed maglA and a p n l A strains and examined their responses to MMS. Neither mutant replicated rapidly in the presence of MMS, and in fact, both seemed to progress more slowly than the wild type (Figure 5; data not shown). We conclude that MAGl and APNl are not necessary for S phase regulation in response to MMS.

The slower progression of these mutants is likely ex- plained by the fact that they are removing lesions at a slower rate than wild type and therefore experience more lesions. However, we know that the mere presence of lesions is not sufficient to slow S phase progression; mecl-1 and rad53 mutants replicate rapidly in the presence of MMS. Therefore, other functions (possibly repair machinery) must be able to interact with lesions to slow down S phase progression in the absence of MAGI- and APNldependent base excision repair. The maglA and a p n l A mutants have intermediate sensitivity to MMS (Figure 5), consistent with the existence of other pathways for dealing with these lesions.

Therefore, despite our observation that BER-deficient mutants defective in removing MMSinduced lesions are nonetheless proficient at S phase regulation, it is still possible that lesion removal is responsible for the slowing of S phase progression in response to MMS. This is because it is probable that several pathways are responsible for removing lesions, such that a significant amount of repair might be occurring in any given single repair mutant. In fact, there is precedent for alternative modes of repair of alkylation damage in E. coli (SAMSON et al. 1988; VOIGT et al. 1989). We constructed a radlA maglA mgt lA triple mutant, defective in both nucleotide and base excision repair as well as the direct rever- sal of 06-methylguanine, and determined its S phase response to MMS. The triple mutant exhibited S phase regulation; in fact, it showed an even greater slowing of cell cycle progression than the wild type (data not shown), similar to the maglA single mutant. We con-

FIGURE 4.-MMS kill curves of checkpoint single and double mutants. Exponentially growing populations of yeast cells were subjected to continuous exposure to 0.03% MMS. At the indicated times after exposure, samples were removed, diluted, and plated for determination of viability. All kill curves are the mean of at least two or three independent experiments, mostly performed on independent segregants (as indicated below), and the range or the SD (see MATERIALS AND METHODS) is shown for each data point. Note that all strains in graphs containing mecl-1 carry the smll suppressor. (A) Wild type [yMP10860 (4X); yMP10863(4X)], rud9A [yMP10887(1X); yMPl0889(1X)], mecl-l [yMP10844(2X); yMP10847(2X)], mecl-1 rud9A [yMP10882(1X); yMP10884(1X); yMP10886(1X)]. (B) Wild type [yMP10860 (4X); yMP10863(4X)], rud l7A [yMP10852(1X); yMP10845(1X)], mecl-1 [yMP10844(2X); yMP10847(2X)], mecl-1 rud l7A [yMP10850(1X); yMP10853(1X)]. (C) Wild type [yMP10860 (4X); yMP10863(4X)], rud24A [yMPl0932(1X); yMP10934(1X)], mecl-1 [yMP10844(2X); yMPlO847(2X)], mecl-1 rud24A [yMP10931(1X); yMP10936(1X); yMP10942(1X)]. (D) Wild type [yMP10860(4X); yMP10863(4X)], mecl-1 [yMP10844(2X); yMP10847(2X)], rad53 [yMPl1069(1X); yMP11070(2X); yMP11071(1X); yMP11072(1X); yMP11073(1X); yMPl1074(1X)], mecl-1 rud53 [yMP10903(1X); yMP10904(1X)]. (E) Wild type [7830-2-4a(4X)], rud9A [yMP10177(5X)], rad53 [yMP10944(1X); yMP10949(1X); yMP10951(1X); yMP10955(1X)], rad53 rud9A [yMP10943(1X); yMP10947(1X); yMP10952(1X); yMP10953(1X); yMP10954(1X); yMP10956(1X)]. (F) Wild type [7830-2-4a(4X)], rudl7A [yMPl0365(4X)], rud53 [yMP10944(1X); yMP10949(1X); yMP10951(1X); yMP10955(1X)], rad53 rudl7A [yMP10796(2X); yMP10798(1X)]. (G) Wild type [7830-24a(4X)], rud24A [yMP10366(4X)], rad53 [yMP10944(1X); yMP10949(1X); yMP10951(1X); yMP10955(1X)], rad53 rud24A [yMP10801(2X); yMP10961(1X); yMP10964(1X)].

56 A. G. Paulovich PI crl.

A364A Controls:

A364A Mutants Surveyed: Other Backgrounds:

rad24A (4 Yo) rad784 (<0.01%) mgtld (43%) Sad$-7 (6'10) 2 Hr. 4 Hr.

mad3 (59%) m/h7(55%)

2 Hr. 4 Hr. 2 Hr. 4 Hr.

FIGURE 5.--General survey of mutants for defects in S phase regulation. Exponentially growing populations of wild-type or mutant cells were subjected to continuous exposure to 0.03% MMS. Following 2 and 4 hr of continuous exposure, samples were removed and analyzed by flow cytometry. Each panel contains two histograms. Shaded histograms represent the cell cycle distribution of the asynchronous culture, before addition of MMS. Overlaid histograms represent the cell cycle distribution at various times after addition of MMS. For comparison, profiles of wild type (7830-24a and yMP10381), m w l - I (vMPI0848), and md24A (yMP10366) are reproduced in column one. The viability of each strain at the 2-hr timepoint is shown in parentheses. All strains in columns 1-3 were constructed in this laboratory and are in the A364a background. All strains in columns 4 and 5 were obtained from other laboratories (as indicated in Table l ) , and the appropriate parental wild-type controls are shown above each mutant. Strains used were as follows: wild type (7830-24 and vMPl0381), mPrl-I (yMP10848), md24A (vMPlO366), m d l A (yMP10261), ~ n d 1 4 A (yMP10519), ~ n d l 6 A (yMP10447), yndl8A (vMP10425), md26A (vMP10507), md51A (yMP10428), md52-I (yMP10247), mnd3A (yM11058), md54A (yMP10910), n p l A (yMP10590), mnglA (vMP10464), mgtlA (yMPl0333), m h 2 A (yMP10521), PmslA (yMP11082), ym3A (vMP10382). mlhlA (yMP10983). DUN1 (Y202), dunl-AI00 (Y286), SAD4 (Y80), snd4-I (sad4-l), TELI (TELl), 1d1A (tell), POL30 (W38+pRLP1 l ) , po130-46 (W38+p230-46), po13O-52 (PY38+p230-42).

S Phase Regulation in S. cerevisiae 57

clude that it is neither the presence of RAD1-dependent nucleotide excision repair nor the presence of 06 methylguanine DNA methyltransferase that slows S phase progression in maglA mutants.

It was possible that the residual S phase slowing in the repairdefective mutants was not a result of regulation. For example, these mutants may experience the accumulation of DNA lesions that are capable of physically blocking DNA polymerase, thereby resulting in slowing of S phase progression. To determine whether the slowing of S phase in these mutants was checkpoint- dependent, we constructed mecl-1 mgtlA, rad53 apnlA, and rad53 rad5lA double mutants and determined their responses to MMS. All three representative double mutants behaved like the mecl-1 and rad53 single mutants, showing no significant accumulation of cells within the S phase (data not shown). We conclude that the slowing of S phase in these repair mutants is the result of a MECI- and RADSMependent control.

REV3 encodes a putative DNA polymerase in S. cermisiae (MORRISON et al. 1989). Although rm3A mutants are viable, they do not give rise to mutations following UV- irradiation, leading to the hypothesis that Rev3p is a DNA polymerase that allows cells to replicate using mutagenic trans-lesion synthesis in the presence of DNA damage (MORRISON et al. 1989; NELSON et al. 1996). We con- sidered the possibility that Rev3p may replace the normal replicative polymerase when replication is occurring in the presence of MMS damage, and therefore that REV3 might become essential for DNA replication in the presence of MMS or may even be a target for mechanisms slowing down S phase progression in response to MMS. However, we constructed a rm3A mutant in the A364a background and found its S phase response to MMS to be similar to that of the wild type (Figure 5). We conclude that REV3 is neither required for replication in the presence of MMS, nor required for regulation of S phase progression in response to MMS.

Methyldirected mismatch repair is an established example of coupling between DNA replication and DNA repair (reviewed in FRIEDBERG et al. 1995). We wished to test the possibility that the yeast mismatch repair system played a role in S phase regulation. We constructed msh2A, PmslA, and mlhlA mutants and determined their cell cycle response to MMS exposure. All three of these mutants show significant accumulation within the S phase in response to MMS (Figure 5). We conclude that MSH2, PMSI, and MLHl are not required for S phase regulation in response to MMS.

Finally, we tested four mutants obtained from other labs for S phase regulation defects: Dunlp is a protein kinase that is phosphorylated in response to DNA damage (ZHOU and ELLEDGE 1993). Its phosphorylation is dependent on RAD53 and results in the transcriptional induction of a variety of genes in response to DNA damage (ALLEN et al. 1994). However, this mutant has no known checkpoint defect. The sad4 mutant is sensi-

tive to HU, and its checkpoint status has not been well characterized (ALLEN et al. 1994; STEVE ELLEDGE, personal communication). T a l has functions that are par- tially redundant with MECl (MORROW et al. 1995); although tellA single mutants have no known checkpoint defect, tell shows several genetic interactions with mecl (MORROW et al. 1995; SANCHEZ et al. 1996). POL30 encodes the s. cerevisiae proliferating cell nuclear antigen (PCNA) (BAUER and BURGERS 1990), a processivity factor for Pol6 and Pole that has also been shown in mammalian cells to function in excision repair (NICHOLS and SANCAR 1992; SHIVJI et al. 1992). Mutant alleles of POL30 that confer sensitivity to MMS have been isolated (AWAGARI et al. 1995). We show that Po130-46, Po130-52, sad4-1, and tellA are not required for S phase regulation in response to MMS (Figure 5). Interestingly, the p0130-52 mutant, which is 200 times more sensitive to MMS than the wild type (Figure 5, 2-hr timepoint), shows slower cell cycle progression than the wild type. This phenotype is reminiscent of the maglA and apnlA mutants, and is consistent with all of these genes playing a role in the removal of MMSinduced lesions. While dunl-A100 clearly does not show a mecl-like complete defect in S phase regulation, it may replicate slightly faster than its wild-type control. This observation may be worth following up on, especially since DUN1 is believed to be a downstream effector of RAD53 (ALLEN et al. 1994).

Yeast cells encountering DNA damage during the S phase experience the induction of replication-dependent sister chromatid exchange (KADYK and HARTWELL 1993) as well as the induction of mutations (OSTROFF and SCLAFANI 1995). Mutations are thought to occur when DNA polymerase replicates across a DNA lesion capable of mispairing with a noncognate base (reviewed in NAEGLI 1994). This so-called trans-lesion synthesis is believed to be dependent on REV3 in S. cermisiae (MORRISON et al. 1989; NELSON et al. 1996). Replication- dependent sister chromatid exchange is believed to occur when DNA polymerase encounters a lesion that is either capable of blocking the polymerase or of induc- ing it to switch DNA templates (reviewed in NAEGLI 1994). These sister chromatid exchange events, at least in response to W-irradiation, are dependent on the S. cermisiae RALI52 gene ( KADYK and HARTWELL 1993). We hypothesized that these two potentially special modes of replication, and therefore that at least one of the RAD52 and REV3 genes, might be necessary for replication in the presence of MMS. However, we constructed a rev3A rad52-1 double mutant and determined that it had an S phase response to MMS that was comparable to the wild type (data not shown).

Not all mutations conferring checkpoint defects result in loss of S phase regulation: MAD3 is necessary for the spindle assembly checkpoint that monitors chromosome alignment and the structure of the mitotic spindle (LI and MURRAY 1991). mad3A mutant cells are


no more sensitive to MMS than the wild type and show wild-type S phase regulation in the presence of MMS (Figure 5 ) . We conclude that MAD3 is not necessary for S phase regulation in response to MMS.

PDSl/ESP2 was identified as a Ts- mutant that is sensitive to transient exposure to microtubule inhibi- tors as a result of precocious separation of sister chro- matids and the formation of aploid cells (YAMAMOTO et al. 1996a,b). PDSl is also necessary to block anaphase at the restrictive temperature in cdclb, cdc20, cdc23, and cdcl3, and this is the first gene shown to play a role in the control of mitosis in response to both spindle and DNA defects (YAMAMOTO et al. 1996a,b). The pdslA mutant is inviable at 37", but viable at 23" (YAMAMOTO

et al. 1996a,b; A. G. PAULOVICH, E. JENSEN, S. FRIEND and L. H. HARTWELL, data not shown). We constructed a pdslA mutant in the A364a background and found its S phase response to be comparable to the wild type during continuous exposure to 0.01% MMS at 23" (A. G. PAULOVICH, R. U. MARGULIES and L. H. HARTWELL, unpublished observations). We conclude that PDSl is not necessary for S phase regulation in response to MMS. Hence, PDSl is the first example of a gene necessary for the regulation of mitosis in response to DNA damage that is not necessary for the control of S phase in response to DNA damage.

DISCUSSION

The basis of S phase regulation: We recently demonstrated that in wild-type s. cerevisiae the rate of ongoing S phase is slowed, although not blocked, when the DNA is subjected to alkylation damage by exposure to MMS (PAULOVICH and HARTWFLLL 1995). In contrast, m c l - 1 or rad53 mutants replicate damaged and undamaged DNA at comparable rates, ruling out a model in which lesions alone are able to slow replication and demonstrating that the slowing of S phase is an active process. In this report, we extend these findings by demonstrating that other genes involved in the DNA damage checkpoint (RAD9, RADl 7, and RAD24) also play a role in regulating the S phase rate, although to a lesser extent than MECl and RAD53.

These results raise three related issues: (1) What is the purpose of the slowed S phase? (2) What is the molecular basis of the slowed S phase? (3) What is the basis of the difference between the dramatic defect seen in mecl-1 and rad53 and the partial defect seen in rad9A, radl 7 4 , and rad24A? Since mutations that par- tially or completely eliminate S phase regulation confer sensitivity to MMS and since the degree to which a mutant is sensitive correlates with the severity of the S phase defect (Figures 2 and 4), we suggest that the slowing down of S phase progression allows cells to better survive DNA damage. Since we presume that it is the DNA lesions that are causing the lethality, we propose that S phase regulation allows cells either to

remove DNA damage more efficiently or to tolerate DNA damage more efficiently than would be possible during an unrestrained S phase.

The molecular basis of the difference between the complete and the partial defect in S phase regulation: In this report, we demonstrate that rad9A, radl 7A, and rad24A all are defective in S phase regulation, although to a lesser extent than mcl-1 or rad53. The difference between these two phenotypes could be quantitative or qualitative. One example of a quantitative difference is that rad9A, radl 7 4 , and rad24A could be capable of responding to all of the signals that induce slowing of S phase in the wild type, but that the efficiency of the response is attenuated. For example, the rad9A, radl 7 0 , and rad24A mutants may be less efficient at detecting lesions than the wild type, whereas mecl-1 and rad53 could be completely defective in detecting lesions. Alternatively, the replication fork might be de- layed every time it encounters a lesion. If m c l - l and rad53 mutants did not pause at all, whereas both the wild type and the rad9A, radl 7A, and rad24A mutants are able to pause, but the length of time over which the delay can be maintained is longer in the wild type than in the mutants, this quantitative difference might manifest itself as a partial defect in S phase regulation.

Alternatively, the different phenotypic classes might be due to qualitative differences in the ability of the mutants to respond to DNA damage, as illustrated in the following four models.

First, different genes might be necessary for detecting different types of DNA lesions. Exposure to MMS induces a variety of DNA lesions, both directly (N7"methylguanine, OGmethylguanine, %methyladenine) and as a result of lesion processing (abasic sites, nicks, gaps, double- strand breaks). Each of these lesions may be recognized by a distinct repair complex that, once bound to the lesion, activates a signal transduction pathway and results in the slowing of S phase progression. If MECl and RAD53 were necessary for recognizing all types of lesions and if RAD9, RADl 7, and RAD24 were only necessary for detecting a subset of lesions, one would predict the two phenotypic classes that we observe. There is a precedent for lesion specificity in activating a RADPdependent checkpoint; wild-type cells delay in the G1 phase in response to UV-irradiation. This delay is RADPdependent in an excision repair-proficient background, but RAD9 independent in an excision repairdefective background, leading to the hypothesis that excision tracts but not un- excised dimers activate the RADPdependent checkpoint pathway (SIEDE et al. 1994).

Second, different genes might be necessary for detecting lesions in different topographical regions of chromosomes. For example, MECl and RAD53 might be necessary to recognize lesions anywhere along the length of the chromosome to activate a signal to slow S phase. In contrast, if RAD9 were only required to recognize lesions in telomeric regions, the mecl-1 or

S Phase Regulation in S. cmevisiae 59

rad53 mutants would send no signal to the replication apparatus in response to global DNA damage, whereas rud9A would send an attenuated signal, potentially resulting in the two observed phenotypic classes.

Third, different genes might be necessary for detecting lesions in different functional regions of chromosomes. For example, transcribed and untranscribed strands of DNA have been shown in many organisms, including yeast (SMERDON and THOMA 1990; SWEDER and HANAWALT 1992), to be differentially repaired following some types of DNA damage. Transcribed strands are repaired more rapidly than untranscribed strands, and this more rapid repair, called transcription-repair coupling, is dependent in yeast on RNA polymerase I1 activity as well as other NER genes (SWEDER and HANA-

WALT 1992, 1994; VAN GOOL et ul. 1994). If checkpoint genes were differentially necessary for processing lesions in different functional regions of chromosomes, such as transcribed us. nontranscribed regions, two phenotypic classes might be predicted.

Fourth, different genes might be necessary for controlling initiation and elongation during the S phase. It is possible that regulation of replication rate in response to damage is the result of a delay of late replication origin firing within S phase, a decrease in the number of origins used, a decrease in the rate of elongation of nascent DNA strands, or some combination of the above. Technical limitations make it difficult to distinguish among these possibilities. If the regulated S phase progression that we have described is due to both inhibition of origin firing and inhibition of elongation, and if these two processes have differential requirements for checkpoint genes, two phenotypic classes might be predicted. Another related possibility is that the mutants showing the subtle defect might be deficient in the G1 DNA damage checkpoint, whereas m c l - 1 and rud53might be defective in both the G1 and the S phase controls.

Relationship between S phase regulation and G1 and C2 checkpoints: DNA damage-induced delays at the G I 5 and the G2-M boundaries are also dependent on these same checkpoint genes, raising the issue of how these genes function at so many intervals in the cell cycle. One possibility was that the G1 and G2 checkpoints are actually the extreme beginning and the extreme end of S phase, and that all delays actually occur during the S phase. This hypothesis is apparently ruled out by experiments that have mapped the G1 checkpoint upstream of the cdc7arrest (SIEDE et al. 1994) and the G2 checkpoint downstream of nocodazole arrest (ALLEN et al. 1994). However, chromosome I11 sequences have been found to replicate in cells arrested at cdc7 (REYNOLDS et al. 1989), and, while it is true that nocodazole-arrested cells have a G2 DNA content as assayed by flow cytometry, it is formally possible that a small amount of replication has not been completed.

Another possibility for why checkpoint delays at the

G1-S and the G2-M boundaries are dependent on the same genes that regulate S phase progression is that these genes may be DNA repair proteins involved in generating the signal for cell cycle arrest (LMALL and WEINERT 1995). The demonstration that the accumulation of single-stranded DNA at telomeric regions in a cdcl? mutant incubated at the nonpermissive temperature is dependent on RAD24 provides support for this hypothesis ( LYDALL and WEINERT 1995).

Relationship between regulation of S phase rate and the HU-responsive S-M checkpoint: In addition to the checkpoint that slows the rate of S phase progression in response to DNA lesions, yeast cells have a second checkpoint control within the S phase. When wild-type cells are treated with HU, replication ceases, cells arrest within S phase, the mitotic spindle does not elongate, and cells remain arrested and viable over many hours. In contrast, when mecl-1 or rad53 cells are treated with HU, replication ceases, cells arrest in mid-S phase, but the mitotic spindle does elongate, resulting in a mitotic catastrophy and cell death (ALLEN et al. 1994; WEINERT et al. 1994). Therefore, in HU, Meclp and Rad53p must target the mitotic apparatus to inhibit spindle elongation. In contrast, when wild-type cells are treated with sublethal doses of MMS, the replication rate is slowed by a MECI- and RALl53dependent control, indicating that in MMS, Meclp and Rad53p must target the replication machinery either directly or indirectly to slow S phase progression. DNA polymerase (Pole) senses stalled replication in HU and sends a signal, potentially via MECl and RALl53, to inhibit anaphase (NAVAS et al. 1995). In response to MMS, a polymerase may or may not be a sensor of damage, yet it is almost certainly, either directly or indirectly, a target of MECI and RAD5Mependent mechanisms that slow S phase progression.

The dependence of both of these seemingly different controls on MECl and RAD53 raises the possibility that both targets, the mitotic apparatus and the replication machinery are inhibited in a h4EC1- and RAD53depen- dent manner whenever wild-type cells are treated either with HU or with MMS (ie., that Meclp and Rad53p target the replication machinery in addition to the mitotic apparatus in cells treated with HU, and that Meclp and Rad53p target the mitotic apparatus in addition to the replication machinery in cells treated with MMS). It is possible that we may only appreciate one or the other of the targets in HU or MMS because of the nature of the experiments and the drugs being used. For example, it may be impossible to detect differences in S phase rates in HU-treated cells and impossible to detect differences in the timing of anaphase relative to DNA replication in MMStreated cells. This is because HU inhibits ribonucleotide reductase, resulting in a depletion of deoxyribonucleotides (YARBRO 1992) that may cause replication to cease altogether due to a lack of nucleotides. This effect would make it impossible to


assay effects of mcl-1 or rad53mutations on the S phase rate in HU. Similarly, mecl-1 and rad53 mutants replicate so rapidly in MMS that it is impossible to determine the relative timing of completion of replication and spindle elongation. Hence, the HU and the MMS experiments may be complementary in that each may assay an aspect of the control that cannot be detected using the other.

Consistent with the idea that MECI and RAD53 play a role within the S phase in HU (in addition to the inhibition of mitosis), the fission yeast husl mutation, which confers HU-sensitivity and a defect in S M control, causes lethality in HU before the onset of mitosis, leading to the suggestion that this gene might also have a function within S phase (ENOCH et al. 1992). It would be interesting to determine whether lower doses of HU that slow, yet do not halt, DNA replication in the wild type would also slow DNA replication in mcl-1 and rad53.

Our findings that RAD9, RADl 7, and RAD24 play a role in regulating S phase progression in response to MMS provide another distinction between the checkpoint controlling S phase progression in response to damage and the checkpoint that inhibits anaphase when DNA replication is inhibited by HU or by Cdc8p limitation. rad9A, radl 7A, and rad24A mutants have no known defect in the S M checkpoint in response to HU (WEINERT et al. 1994); however, they all have partial defects in regulating S phase progression in response to MMS. Hence, mutants that are completely defective in S phase regulation in response to MMS (mecl-I and rad53) are also defective at inhibiting mitosis when r e p lication is stalled with HU, whereas mutants that confer only partial defects in S phase regulation in response to MMS (rad9A, radl 7A, and rad24A) are proficient at inhibiting anaphase in response to HU (although the possibility that some unrecognized aspects of the cell cycle continue in HU-treated rad9, radl 7, or rad24 mutants cannot be excluded). This correlation may be due to differential requirements for processing of HU- and MMSinduced lesions.

RAD9 and RAD24 have been shown to affect the processing at least one type of DNA lesion (LYDALL and WEINERT 1995). The temperature-sensitive cdcl3 mutant undergoes a RADP, R A D l 7-, RAD24, MECI-, RAD53, PDSl- and MECMependent G2 arrest at the restrictive temperature (WEINERT and HARTWELL 1993; WEINERT et al. 1994). Arrested cells undergo a strand- specific accumulation of single-stranded DNA (ssDNA) at telomeres ( GARVIK et al. 1995), leading to the hypothesis that ssDNA constitutes a signal for activation of the checkpoint (GARVIK et al. 1995). Whereas cdc13 rad9A mutants accumulate ssDNA earlier than the wild type, cdcl3 rad24A mutants do not accumulate measurable ssDNA at all (LYDALL and WEINERT 1995). These results have led to a model in which cdcl3induced DNA damage results in lesions that are processed into large

single-stranded regions by the action of a putative R A D 1 7-, RAD24-, and “dependen t exonuclease, the activity of which is antagonized by RAD9 (LYDALL and WEINERT 1995). The role of these genes in processing DNA lesions could explain why they function in regulating S phase in response to MMS but are not necessary for cell cycle arrest in response to HU. It is possible that MMS, but not HU (LYDALL and WEINERT 1995), induces lesions that must be processed in a RAD9-, R A D l 7-, and RADBMependent manner to generate an activating signal for MECI- and RAD53depen- dent S phase regulation.

In contrast to the budding yeast, the majority of fission yeast checkpoint genes are required for both the S” and the G2-M checkpoints, and there are even dis- crepancies between homologues from the two species in their roles in the checkpoints. For example, radl 7A from S. cereuisiae is not defective in the S” checkpoint in response to HU (WEINERT et al. 1994), whereas its Schizosaccharomyces pornbe homologue, radl+, is required for the S” checkpoint (AL-KHODAIRY and CARR 1992; ENOCH et al. 1992; ROWLEY et al. 1992). Our finding that RAD9, R A D l 7, and RAD24 do play a role in regulating S phase progression was unexpected since these genes had not previously been shown to play a role in checkpoint control within the S phase in s. cereuisiae. Whether the newfound requirements for RAD9, R A D l 7, and RAD24 for control within the S phase in S. cereuisiae may help address this apparent incongruence between budding and fission yeast checkpoints (LYDALL and WEINERT 1995) remains to be seen.

We thank TED WEINERT and DAVID LYDALL for providing strains and for discussions, STEVE BELL and BRUCE STILLMAN for the flow cytometty protocol, members of the L. HARTWELL lab for comments on the manuscript, and especially DAVE T o c ~ r j ~ l for providing the mad3A mutant and for many formative discussions and ERIC FOSS for helpful comments on this manuscript and for allowing us to cite unpublished results. We also thank STEVE FRIEND, ELIZABETH JENSEN

and BRIAN THORNTON of the Seattle Project for providing the mlhlA, pmslA, and pdslA mutants, STEVE ELLEDGE for providing dun1 and sad4 mutants, PETER BURGERS for providing pot30mutants, TOM FETES for providing the tellA mutant, RODNEY ROTHSTEIN for suggesting the sml acronym, KINGSHUK CHOUDHURY and JOE FEISENSTEIN for help with statistical analysis, and MAIJA MEEKS for tetrad dissection. This workwas supported by the National Institutes of Health, General Medical Sciences grant GM-17709 and the American Cancer Society (to L.H.H.) and a Merck Distinguished Fellow Award and an M.S.T.P. Award (to A.G.P.).

LITERATURE CITED

AL-KHODAIRY, F., and A. M. CARR, 1992 DNA repair mutants defin- ing G2 checkpoint pathways in Schimsaccharomyces pornbe. EMBO J. 11: 1343-1350.

ALLEN, J. B., 2. ZHOU, W. SIEDE, E. C. FRIEDBERC and S. J. ELLEDGE, 1994 The SADl/RAD53protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8: 2416-2428.

AWAGARI, R., K. J. IMPELLIZZERI, B. L. YODER, S. L. GARY and P. M. J. BURGERS, 1995 A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair. Mol. Cell. Biol. 15: 4420-4429.

S Phase Regulation in S. cerevisiae 61

BAUDIN, A., 0. OZIER-KALOGEROPOULOS, A. DENOUEL, F. LACROUTE and C. CULLIN, 1993 A simple and efficient method for direct gene deletion in Saccharomyces c m . i a e . Nucleic Acids Res. 21:

BAUER, G. A,, and P. M. J. BURGERS, 1990 Molecular cloning, structure and expression of the yeast proliferating cell nuclear antigen gene. Nucleic Acids Res. 18: 261-265.

BOITEUX, S., 0. HUISMAN and J. LAVAL, 1984 3"ethyladenine resi- dues in DNA induce the SOS function s$A in Escherichia coli.

WRNES, J., and C. I. DAVERN, 1966 Effect of 32P decay upon DNA synthesis by a radiation-sensitive strain of Escherichia coli. J. Mol. Biol. 17: 418-427.

CARR, A. M., 1995 DNA structure checkpoints in fission yeast. Semin. Cell Biol. 6: 65-72.

CHEN, J., B. DERFLER, A. MASKATI and L. SAMSON, 1989 Cloning a eukaryotic DNA glycosylase repair gene by the suppression of a DNA repair defect in Escherichia coli. Proc. Natl. Acad. Sci. USA

CHEN, J., B. DERFLER and L. SAMSON, 1990 Saccharomyces cereuisiae 3- methyladenine DNA glycosylase has homology to the AlkA glycosylase of E. coli and is induced in response to DNA alkylation damage. EMBO J. 9: 4569-4575.

ENOCH, T., A. M. CARR and P. NURSE, 1992 Fission yeast genes involved in coupling mitosis to completion of DNA replication. Genes Dev. 6: 2035-2046.

FRIEDBERG, E. C., G. C. WALKER and W. SIEDE, 1995 DNA Rgbair and Mutagenesis. ASM Press, Washington, DC.

GARVIK, B., M. CARSON and L. HARTWELL, 1995 Single-stranded DNA arising at telomeres in cdcl3 mutants may constitute a specific signal for the RAD9 checkpoint. Mol. Cell. Blol. 15: 6128- 6138.

GREENWELL, P. W., S. L. KRONMAL, S. E. PORTER, J. GASSENHUBER, B. OBERMAIER et aZ., 1995 TELI, a gene involved in controlling telomere length in S. cereuisiae, is homologous to the human ataxia telangiectasia gene. Cell 8 2 823-829.

HARTWELL, L. H., 1967 Macromolecule synthesis in temperature- sensitive mutants of yeast. J. Bacteriol. 93 1662-1670.

HARTWELL, L. H., and T. A. WEINERT, 1989 Checkpoints: controls that ensure the order of cell cycle events. Science 246: 629-634.

JONES, J. S., and L. PRAKASH, 1990 Yeast Saccharomyces cereuisiae se- lectable markers in pUCl8 polylinkers. Yeast 6: 363-366.

KADYK, L. C., and L. H. HARTWELL, 1993 Replicationdependent sister chromatid recombination in radl mutants of Saccharomyces cereuisiae. Genetics 133: 469-487.

LARNER, J. M., H. LEE and J. L. HAMLIN, 1994 Radiation effects on DNA synthesis in a defined chromosomal replicon. Mol. Cell. Biol. 14: 1901-1908.

LI, R., and A. W. MURRAY, 1991 Feedback control of mitosis in budding yeast. Cell 66: 519-531.

LYDALL, D., and T. WEINERT, 1995 Yeast checkpoint genes in DNA damage processing: implications for repair and arrest. Science

LYDALL, D., and T. WEINERT, 1996 From DNA damage to cell cycle arrest and suicide: a budding yeast perspective. Curr. Opin. Genet. Dev. 6 4-11.

MORRISON, A., R. B. CHRISTENSEN, J. ALLEY, A. K BECK, E. G. BERNS TINE et al., 1989 m v 3 , a Saccharomyces cereuisiae gene whose function is required for induced mutagenesis, is predicted to encode a nonessential DNA polymerase. J. Bacteriol. 171: 5659-5667.

MORRISON, A,, A. L. JOHNSON, L. H. JOHNSTON and A. SUGINO, 1993 Pathway correcting DNA replication errors in Saccharomyces cereuisiae. EMBO J. 1 2 1467-1473.

MORROW, D. M., D. A. TAGLE, Y. SHILOH, F. S. COLLINS and P. HIETER, 1995 TELI, an S. cereuisiae homologue of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MECl. Cell 8 2 831-840.

MURRAY, A. W., 1995 The genetics of cell cycle checkpoints. Curr. Opin. Genet. Dev. 5: 5-11.

NAEGELI, H., 1994 Roadblocks and detours during DNA replication: mechanisms of mutagenesis in mammalian cells. Bioessays 16: 557-564.

NAVAS, T. A,, Z. ZHOU and S. J. ELLEDGE, 1995 DNA Polymerase e links the DNA replication machinery to the S phase checkpoint. Cell 80: 29-39.

NELSON, J. R., C. W. LAWRENCE and D. C. HINKLE, 1996 Thymine-

3329-3330.

EMBO J. 3 2569-2573.

86: 7961-7965.

270 1488-1491.

thymine dimer bypass by yeast DNA polymerase z. Science 272:

NICHOLS, A. F., and A. SANCAR, 1992 Purification of PCNA as a nucleotide excision repair protein. Nucleic Acids Res. 2 0 2441- 2446.

OSTROFF, R. M., and R. A. SCLAFANI, 1995 Cell cycle regulation of induced mutagenesis in yeast. Mutat. Res. 329 143-152.

PAINTER, R. B., and B. R. YOUNG, 1980 Radiosensitivity in ataxia- telangiectasia: a new explanation. Proc. Natl. Acad. Sci. USA 77:

PAULOVICH, A. G., and L. H. HARTWELL, 1995 A checkpoint regu- lates the rate of progression through S phase in S. cereuisiae in response to DNA damage. Cell 82: 841-847.

POPOFF, S. C., A. I. SPIRA, A. W. JOHNSON and B. DEMPLE, 1990 Yeast structural gene (APNI) for the major apurinic endonuclease: homology to Escherichia coli endonuclease lV. Proc. Natl. Acad. Sci. USA 87: 4193-4197.

RAMOTAR, D., S. C. POPOFF, E. B. G u u a n d B . DEMPLE, 1991 Cellu- lar role of yeast Apnl apurinic endonuclease/3'diesterase: repair of oxidative and alkylation DNA damage and control of spontaneous mutation. Mol. Cell. Biol. 11: 4537-4544.

REYNOLDS, A. E., R. M. MCCARROLL, C. S. NEWLON and W. L. FANG MAN, 1989 Time of replication of ARS elements along yeast chromosome 111. Mol. Cell. Biol. 9: 4488-4494.

ROTHSTEIN, R. J., 1983 One-step gene disruption in yeast. Methods Enzymol. 101: 202-211.

ROWLEY, R., S. SUBRAMANI and P. G. YOUNG, 1992 Checkpoint controls in Schizosaccharomycespombe: radl. EMBO J. 11: 1335-1342.

SMSON, L., J. THOMALE and M. F. RAJEWSKY, 1988 Alternative pathways for the in vivo repair of OGaIkylguanine and 04alkylthym- ine in Escherichia coli: the adaptive response and nucleotide excision repair. EMBO J. 7: 2261-2267.

SANCHEZ, Y., B. A. DESANY, W. J. JONES, Q. LIU, B. WANG et al., 1996 Regulation of RAD53 by the ATMlike kinases h4ECl and TELl in yeast cell cycle checkpoint pathways. Science 271: 357-360.

SAVITSKY, R, A. BAR-SHIM, S. GIIAD, G. ROTMAN, Y. ZIV et al., 1995a A single ataxia telangiectasia gene with a product similar to PI- 3 kinase. Science 268 1749-1753.

SAVITSKY, R, S. SFEZ, D. A. TAGLE, Y. ZN, A. SARTIEL et al., 1995b The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species. Hum. Mol. Genet. 4: 2025-2032.

SCHILD, D., B. J. GLASSNER, R. K. MORTIMER, M. CARLSON and B. C. LAURENT, 1992 Identification of R A D I G , a yeast excision repair gene homologous to the recombinational repair gene RAD54 and to the SW.2 gene involved in transcriptional activation. Yeast

SHERMAN, F., G. R. FINK and J. B. HICKS, 1981 Methods in Yeast Genet- ics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

SHWI, R K., M. R KENNY and R. D. WOOD, 1992 Proliferating cell nuclear antigen is required for DNA excision repair. Cell 69:

SIEDE, W., A. S. FRIEDBERG and E. C. FRIEDBERG, 1993 RADPdepen- dent G1 arrest defines a second checkpoint for damaged DNA in the cell cycle of Saccharomyces cereuisiae. Proc. Natl. Acad. Sci.

SIEDE, W., A. S. FRIEDBERG, I. DIANOVA and E. C. FRIEDBERG, 1994 Characterization of G1 checkpoint control in the yeast Saccharo- myces cereuisiae following exposure to DNAdamaging agents. Ge- netics 138: 271-281.

SIKORSKI, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cereuisiae. Genetics 122: 19-27.

SINGER, B., and D. GRUNBERGER, 1983 Molecular Biology ofMutagens and Carcinogens. Plenum Press, New York.

SMERDON, M. J., and F. THOMA, 1990 Site-specific DNA repair at the nucleosome level in a yeast minichromosome. Cell 61: 675-684.

SWEDER, K. S., and P. C. HANAWALT, 1992 Preferential repair of cyclobutane dimers in the transcribed strand of a gene in yeast chromosomes and plasmids is dependent on transcription. Proc. Natl. Acad. Sci. USA 89: 10696-10700.

SWEDER, K. S., and P. C. HANAWALT, 1994 The COOH terminus of suppressor of stem loop (SSL2/RAD25) in yeast is essential for overall genomic excision repair and transcription-coupled repair. J. Biol. Chem. 269: 1852-1857.

VAN GOOL, A. J., R. VERHAGE, S. M. A. SWAGEMAKERS, P. VAN DE PUTTE,

1646-1649.

7315-7317.

8: 385-395.

367-374.

USA 90: 7985-7989.


J. BROUWER et al., 1994 RAD26, the functional S. cerevisiaehomo- logue of the Cockayne syndrome B gene ERCC6. EMBO J. 13:

VOIGT, J. M., B. VAN HOUTEN and M. D. TOPAL, 1989 Repair of 06 methylguanine by ABC exinuclease of Escherichia coli in vitro. J. Biol. Chem. 264 5172-5176.

WEINERT, T. A,, and L. H. HARTWELL, 1988 The RAD9gene controls the cell cycle response to DNA damage in Saccharomyces cereuisiae. Science 241: 317-322.

WEINERT, T. A., and L. H. HARTWELL, 1990 Characterization of RAD9 of Saccharomyces cereuisiae and evidence that its function acts posttranslationally in cell cycle arrest after DNA damage. Mol. Cell. Biol. 1 0 6554-6564.

WEINERT, T. A,, and L. H. HARTWELI., 1993 Cell cycle arrest of cdc mutants and specificity of the RAD9 checkpoint. Genetics 134:

WEINERT, T. A,, G. L. USER and L. H. HARTWELL, 1994 Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8: 652-665.

5361-5369.

63-80.

XMO, W., B. DERFLER, J. CHEN and L. SAMSON, 1991 Primary sequence and biological functions of a Saccharomyces cerevisiae 06 methylguanine/O4methylthymine DNA repair methyltransferase gene. EMBO J. 10: 2179-2186.

YAMAMOTO, A,, V. GUACCI and D. KOSHLAND, 1996a Pdslp is required for faithful execution of anaphase in the yeast, Saccharo- myces cermisiae. J. Cell Biol. 133: 85-97.

YAMAMOTO, A., V. GUACCI and D. KOSHLAND, 1996b Pdslp, an inhib itor of anaphase in budding yeast, plays a critical role in the APC and checkpoint pathways. J. Cell Biol. 133: 99-110.

YARBRO, J. W., 1992 Mechanism of action of hydroxyurea. Semin. Oncol. 19 (Suppl. 9): 1-10.

YOUNG, B. R., and R. B. PAINTER, 1989 Radioresistant DNA synthesis and human genetic diseases. Hum. Genet. 8 2 113-1 17.

ZHOU, Z., and S. J. ELLEDGE, 1993 DUN1 encodes a protein kinase that controls the DNA damage response in yeast. Cell 75: 1119- 1127.

Communicating editor: D. BOTSTEIN

-9, RADl 7, and RAD24 Are Required for S Phase Regulation in

Documents

Transcript of -9, RADl 7, and RAD24 Are Required for S Phase Regulation in