Nonalcoholic Fatty Liver Disease (NAFLD): Where are we today?
© 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial...
Transcript of © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial...
![Page 1: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/1.jpg)
MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER DISEASE (NAFLD)
By
KAITLYN ABDO
A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
UNIVERSITY OF FLORIDA
2017
![Page 2: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/2.jpg)
© 2017 Kaitlyn Abdo
![Page 3: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/3.jpg)
To my mother, for always standing by me through the good times and the bad, and to my brother, for rolling with the punches
![Page 4: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/4.jpg)
4
ACKNOWLEDGMENTS
I thank my family for their support, and my amazing coworkers and mentor. For
without them, I would not have accomplished this great feat. My father was my greatest
inspiration, and my mother my strongest level of support. Support for this work was
provided by Dr. Cusi’s ongoing Endocrine, Diabetes and Metabolism research program.
I would like to thank Dr. Sunny for experimental design and implementation of the
jugular catheters. Srilaxmi Kalavalapalli was instrumental in conducting and analyzing
the insulin assay. Furthermore, I would like to acknowledge Gabriel Fernandez from Dr.
Clayton Matthew’s lab for his expertise in mitochondrial respiration and ROS assays,
and Dr. Matthew Merritt for utilization of the Oroboros O2K system. I would also like to
acknowledge the University of Florida Molecular Pathology Core for work done on
histology.
![Page 5: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/5.jpg)
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF FIGURES .......................................................................................................... 8
LIST OF ABBREVIATIONS ........................................................................................... 10
ABSTRACT ................................................................................................................... 12
CHAPTER
1 GENERAL OVERVIEW OF NONALCOHOLIC FATTY LIVER DISEASE ............... 14
Why Study NAFLD: Biological and Clinical Relevance of Studying NAFLD............ 14 Progression of NAFLD to NASH ............................................................................. 15
The Pathophysiology of NAFLD .............................................................................. 15 Hepatic Insulin Resistance in NAFLD ..................................................................... 16 Mitochondrial Dysfunction and Inflexibility .............................................................. 18
Overall Hypothesis .................................................................................................. 19
2 ESTABLISHMENT OF AN IN VITRO MODEL SYSTEM TO PROBE MITOCHONDRIAL ALTERATIONS IN EARLY STAGES OF NAFLD..................... 24
Materials and Methods............................................................................................ 24
Chemicals ......................................................................................................... 24 Animal Studies ................................................................................................. 24
Primary Hepatocyte Isolation ............................................................................ 24 Mitochondrial Respiration ................................................................................. 25 Mitochondrial ROS Production ......................................................................... 26
Histology ........................................................................................................... 26 Western Blotting for Protein Expression ........................................................... 27 Gene Expression Analysis ................................................................................ 27
Biochemical Measurements ............................................................................. 27 Targeted Metabolomics .................................................................................... 28 Statistics ........................................................................................................... 28
Results .................................................................................................................... 28 Hepatocytes of Mice Fed a High Fructose Diet Develop NAFLD at 4 Weeks .. 28
Protein and Gene Expression Show Insulin Resistance and Increased Mitochondrial Function at 4 Weeks of Feeding ............................................. 29
Mitochondrial Respiration and ROS Production is Elevated in TFD Mice at 4 Weeks ........................................................................................................... 31
3 INTRALIPID CHALLENGE SHOWS COMPLETE MITOCHONDRIAL DYSFUNCTION IN MOUSE MODEL OF NASH ..................................................... 39
![Page 6: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/6.jpg)
6
Materials and Methods............................................................................................ 39
Chemicals ......................................................................................................... 39
Animal Studies ................................................................................................. 39 Histology ........................................................................................................... 39 Jugular Vein Catherization ............................................................................... 40 Intralipid Infusion .............................................................................................. 40 Preliminary Data for Intralipid Infusion Rate ..................................................... 41
Intralipid Infusion Analysis ................................................................................ 41 Western Blotting for Protein Expression ........................................................... 41 Gene Expression Analysis ................................................................................ 41 Biochemical Measurements ............................................................................. 42 Targeted Metabolomics .................................................................................... 42
Statistics ........................................................................................................... 42
Results .................................................................................................................... 43 C57BL/6J Mice Develop NASH at 24 Weeks of High Fructose High trans-
Fat Feeding ................................................................................................... 43
Mitochondria are Dysfunctional in Mouse Model of NASH ............................... 43 NASH Mice Exhibit Severe Insulin Resistance ................................................. 44
4 DISCUSSION ......................................................................................................... 53
APPENDIX: SUPPLEMENTARY FIGURES .................................................................. 58
LIST OF REFERENCES ............................................................................................... 64
BIOGRAPHICAL SKETCH ............................................................................................ 69
![Page 7: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/7.jpg)
7
LIST OF TABLES
Table page 2-1 Expression of genes related to mitochondrial metabolism and inflammation
markers in primary isolated hepatocytes of C57BL/6J mice fed on a control diet or a high fructose high trans-fat diet (TFD) for 4 weeks.. ............................. 35
3-1 Clinical and metabolic parameters from biological samples of C57BL/6J control and TFD fed mice when challenged with a five-hour glycerol or Intralipid infusion.. ............................................................................................... 47
3-2 Expression of genes related to mitochondrial metabolism and inflammation markers in liver homogenates of C57BL/6J mice fed on a control diet or a high fructose, high trans-fat diet (TFD) for 24 weeks.. ........................................ 50
A-1 Primer sequences for genes analyzed with qPCR for isolated hepatocytes and liver homogenates. ...................................................................................... 59
![Page 8: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/8.jpg)
8
LIST OF FIGURES
Figure page 1-1 Fatty liver disease progresses to steatohepatitis.. .............................................. 21
1-2 Fat accumulation occurs in insulin resistant liver with NAFLD. ........................... 22
1-3 Hepatic insulin resistance and dyslipidemia in NAFLD. ...................................... 23
2-1 Histology of C57BL/6J mice fed on a control or TFD diet for 4 weeks.. .............. 32
2-2 Metabolic changes in C57BL/6J primary hepatocytes following a custom media incubation.. .............................................................................................. 33
2-3 Insulin signaling was blunted in NAFLD-modeled hepatocytes.. ........................ 34
2-4 Genes involved in fat oxidation and ketogenesis were upregulated in TFD mice at 4 weeks.. ................................................................................................ 36
2-5 Hepatocytes isolated at 4 weeks of TFD exhibited elevated fibrotic and inflammatory markers.. ....................................................................................... 37
2-6 Primary hepatocytes from 4-wk TFD mice showed elevated oxygen consumption rate (OCR) and ROS production with NAFLD.. ............................. 38
3-1 Histology of C57BL/6J mice fed a control or TFD diet for 24 weeks.. ................. 46
3-2 Basal parameters of control and TFD fed mice.. ................................................ 48
3-3 TFD raises fasting plasma insulin and Intralipid increases insulin and glucose levels.. ................................................................................................................ 48
3-4 C57BL/6J mice following a 5-hr Intralipid infusion exhibited mitochondrial dysfunction and inflexibility.. ............................................................................... 49
3-5 Basal insulin signaling is upregulated in insulin resistant C57BL/6J TFD mice.. .................................................................................................................. 49
3-6 Gene expression of C57BL/6J mice at 24 weeks of feeding.. ............................ 51
3-7 Inflammation and fibrosis is present in NASH mouse models.. .......................... 52
A-1 Concentration of FFAs (mmol/L) over a period of 5 hours, including baseline (0 hours).. ........................................................................................................... 58
A-2 Quantification of western blot from hepatocytes on 4-week diet.. ....................... 60
A-3 Plasma blood glucose levels in 24-week fed mice.. ............................................ 61
![Page 9: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/9.jpg)
9
A-4 Plasma urea concentrations in mice on 24-weeks of control or TFD diet.. ......... 62
A-5 Quantification of western blot from liver homogenates on 24-week diet.. ........... 63
![Page 10: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/10.jpg)
10
LIST OF ABBREVIATIONS
Acc1 Acetyl-coA carboxylase 1
ADP Adenosine diphosphate
ATP Adenosine triphosphate
BGL Blood glucose levels measured in mg/dL
BSA Bovine serum albumin
Chrebp Carbohydrate-responsive element-binding protein
Cpt1a Carnitine palmitoyltransferase 1a
CytC Cytochrome C
DMF Dimethylformamide
DPBS Dulbecco’s phosphate buffered saline
Fas Fatty acid synthase
FBS Fetal bovine serum
FFA Free fatty acids
Fgf21 Fibroblast growth factor 21
Hmgcs2 3-Hydroxy-3-methylglutaryl-coA synthase 2
Il6 Interleukin 6
IR Insulin resistance
Lcad Long chain acyl-coA dehydrogenase
Mmp13 Matrix metallopeptidase 13
MTBSTFA N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide
NAFLD Nonalcoholic fatty liver disease is defined by the accumulation of fat in the liver
NASH Nonalcoholic steatohepatitis is characterized as the end-stages of NAFLD, with hepatocyte injury and inflammation
OCR Oxygen consumption rate
![Page 11: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/11.jpg)
11
Ppara Peroxisome proliferator-activated nuclear receptor alpha variant
Pc1 Pro-collagenase 1
ROS Reactive oxygen species
T2DM Type II diabetes mellitus
TCA cycle Tricarboxylic acid cycle
TG Triglycerides
Ucp2 Uncoupling protein 2
![Page 12: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/12.jpg)
12
Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science
MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER
DISEASE (NAFLD)
By
Kaitlyn Abdo
August 2017
Chair: Kenneth Cusi Major: Medical Sciences
Dysfunctional mitochondrial energetics and hepatic insulin resistance are central
features of nonalcoholic fatty liver disease (NAFLD). Mitochondrial pathways
(tricarboxylic acid (TCA) cycle, ketogenesis, respiration and ATP synthesis) remodel
with progressed severity of hepatic insulin resistance and fatty liver disease. While the
activity of several of these pathways are induced during early stages of insulin
resistance, mitochondrial respiration and ATP synthesis have been shown to be
impaired during more severe states, including nonalcoholic steatohepatitis (NASH) and
type 2 diabetes mellitus (T2DM). Understanding the metabolic events during the
remodeling of oxidative metabolism and its interaction with reactive oxygen species
generation through the electron transport chain is of significant interest for developing
therapeutic strategies. We hypothesize that chronic free fatty acid (FFA) overload will
result in hepatic insulin resistance and further disturb the mitochondria’s flexibility to
compensate and adapt to nutrient and hormonal stimuli. In in vitro studies, primary
hepatocytes isolated from mice (C57BL/6J) challenged with a high fructose, high trans-
fat (TFD) diet or a control diet for 4-wks, were treated with low (0.2 mM) vs. high (0.8
mM) FFA. In vivo studies were conducted on mice with NASH, following 24-wks of TFD
![Page 13: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/13.jpg)
13
feeding. These mice were infused with Intralipid for 5-hrs to elevate FFA levels by 2-3
fold. Measures of ketone production, insulin signaling by western blot analysis, gene
expression patterns, and analysis of circulating biomarkers were conducted to test our
hypothesis. Primary hepatocytes isolated from 4-wk TFD fed mice had impaired insulin
signaling and higher hepatocyte triglyceride content (Control: 0.25±0.12 vs. TFD:
1.15±0.03 mg/mL; p < 0.05). In spite of insulin resistance, ketogenesis (Control:
766±115 vs. TFD: 1242±105 µM; p < 0.05) was upregulated in extracted primary
hepatocytes. However, when mice with NASH were challenged by Intralipid infusion, the
mice clearly illustrated an inability to induce ketogenesis (C-Glycerol: 213±35.2, C-
Intralipid: 513±169, TFD-Glycerol: 654±213, TFD-Intralipid: 615±99.9 µM) indicating
blunted compensatory mechanisms to FFA overload. Early induction of ketogenesis
despite hepatic insulin resistance in primary hepatocytes and the blunted response of
ketogenesis to Intralipid challenge in mice with NASH, demonstrates mitochondrial
inflexibility. Blunted compensatory mechanisms within hepatic mitochondria during
hepatic insulin resistance can result in sustained induction of oxidative flux, hastening
oxidative stress and inflammation.
![Page 14: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/14.jpg)
14
CHAPTER 1 GENERAL OVERVIEW OF NONALCOHOLIC FATTY LIVER DISEASE
Nonalcoholic fatty liver disease (NAFLD) is a prevalent metabolic disorder that is
due to the accumulation of fat in the liver and is associated with metabolic dysfunction
and insulin resistance [1], [2], [3]. Excess adiposity and insulin resistance are two major
risk factors of NAFLD [4]. Fatty liver disease is a common comorbidity of type 2
diabetes mellitus (T2DM) as well as obesity [5]. NAFLD can progress further to
nonalcoholic steatohepatitis (NASH), with inflammation and fibrosis [6].
Why Study NAFLD: Biological and Clinical Relevance of Studying NAFLD
NAFLD is defined as the accumulation of fat in the liver more than 5% by
histology and absence of other liver conditions and alcohol consumption [5].
Consequence of chronic fatty liver disease include cirrhosis, hepatocellular carcinoma,
and also increased risk of cardiovascular disease [6]. Approximately 34% of the people
in the United States have been diagnosed with NAFLD, and this disease stands to be
the leading cause of liver transplants in the near future [7], [8]. Furthermore, NAFLD has
become common in pediatrics, with up to 50% of obese children [9]. Despite the
prevalence of this disease, patients with NAFLD are underdiagnosed and undertreated
in the clinical setting. Many of the limitations in clinical practice are secondary to our
poor understanding of the pathogenesis of the disease. It is currently unclear the factors
involved in the development and progression of the disease [7]. Currently there are no
exclusive therapeutic options that specifically target the disease, and the current
diagnosis requires a liver biopsy, due to lack of good plasma biomarkers [5], [10]. A
better understanding of the underlying mechanisms involved in the development and
![Page 15: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/15.jpg)
15
progression of NAFLD is essential, if we want to overcome the current clinical
limitations.
Progression of NAFLD to NASH
It has been suggested that this “two-hit” hypothesis is outdated and that multiple
parallel hits simultaneously lead to the progression of NAFLD [11]. The first “hit” in the
progression of NAFLD is associated with accumulation of fat in the liver and the second
characterized by signs of fibrosis and inflammation [12], [11]. Large clinical studies have
identified an excessive FFA supply, hyperinsulinemia, and hyperglycemia as key factors
in the progression of NAFLD to NASH [13], [14], [15]. Seventy percent of T2DM patients
have isolated steatosis [5], [16]. Isolated steatosis (IS) gradually transitions to NASH,
with inflammation and fibrosis [17] (Figure 1-1).
The mitochondria in the liver attempt to adapt to the chronic influx of free fatty
acids (FFA), and once maximal capacity is met, inflammatory and apoptotic pathways
are initiated [13]. The maladaptation of the hepatic mitochondria is associated with the
progression to nonalcoholic steatohepatitis (NASH) [6]. NASH can progress to cirrhosis
of the liver and hepatocellular carcinoma [18], [19]. NASH is projected to be the leading
cause of liver transplants [20], [21], [22]. Thus, studying NAFLD and the mechanisms by
which the build-up of fat in the liver transitions to inflammatory responses is of
biomedical and clinical importance [23].
The Pathophysiology of NAFLD
Obesity leads to increased adiposity, and eventually, insulin resistance in the
adipose tissue [4]. Insulin resistance in adipose tissue in conjunction with elevated free
fatty acids from a chronic supply of nutrients leads to the continual accumulation of
triglycerides (TGs) in the liver [7], [13]. In obese and T2DM patients, approximately 70%
![Page 16: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/16.jpg)
16
of the lipolysis of adipose tissue into free fatty acids is used for fat synthesis in the liver
[13], [24]. Fatty liver disease is characterized by peripheral insulin resistance and
accumulation of lipid droplets in the liver (Figure 1-2).
NAFLD is a multifactorial metabolic disorder that is strongly associated with the
onset of hepatic insulin resistance (IR) from a chronic overload of metabolic substrates
(free fatty acids) [1]. Hepatic IR is present from the liver’s insensitivity to raised blood
glucose levels (BGLs) and increased gluconeogenic pathways (either due to T2DM or
obesity) [1]. A mouse model is necessary to target the mechanism by which NAFLD
progresses to end-stage nonalcoholic steatohepatitis (NASH).
Dysfunctional mitochondrial fat oxidation precedes lipotoxic byproducts (i.e.
DAGs and ceramides) that further progress the disease due to inflammatory and
cytokine responses [1]. Fat accumulation, resulting in hepatocellular injury, is commonly
accompanied by inflammation [18]. Excessive accumulation in the hepatocytes of an
insulin resistant liver ultimately leads to mitochondrial stress and increased cytokine and
overproduction of reactive oxidative species (ROS) [26]. The continual fueling of these
inflammatory and fibrotic pathways leads to hepatocyte apoptosis and cirrhosis of the
liver [27]. The accumulation of lipids in the muscle has been previously studied, and
now our lab is studying the same effect in the liver of mice due to the prevalence of
NAFLD and the clinical relevance to studying the disease [7].
Hepatic Insulin Resistance in NAFLD
Insulin is a hormone produced by the pancreas that partakes in many signaling
transduction pathways, with the main role being the maintenance of physiologic blood
glucose levels. Glucose transport is the primary defect in insulin-mediated glucose
metabolism in patients with T2DM [5]. Adiposity is elevated in obese and T2DM
![Page 17: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/17.jpg)
17
patients, which leads to further lipolysis of fat entering the hepatic mitochondria [23].
The hepatic mitochondria is involved in the storing or oxidizing of fat (from diet or
adipose tissue) and this remains in homeostatic balance, unless insulin resistance
occurs [23].
In NAFLD, there is mitochondrial dysfunction from fat overload that results in
hepatic insulin resistance and lipotoxic byproducts [25]. Free fatty acids are the most
abundant energy source circulating in the body under fasting conditions [28]. During
hepatic insulin resistance, fatty acids are taken up by the liver for immediate energy,
stored in the liver as triglycerides if energy demand is low, or excreted into the plasma
as very low-density lipoproteins (VLDLs). Carnitine palmitoyltransferase I (CPT1)
transports long-chain free fatty acids into the mitochondria to either be broken down
through beta oxidation (β-oxidation) or to enter the tricarboxylic acid (TCA) cycle for
immediate energy [23]. Upregulated fat oxidation results in the esterification of
triglycerides and increased gluconeogenic pathways [23]. The liver, which is the location
of the main source of glucose production, continues producing glucose, consequently
causing hyperglycemia and hyperinsulemia [1].
In an insulin-resistant state, gluconeogenesis remains high and thus, more fats
brought into the liver are stored and esterified as triglycerides. Mitochondrial activity is
impaired to compensate for increased fat in IR patients. The TCA cycle is thus
upregulated with IR from increased FFA, leading to further progression of the disease.
The metabolic effects that occur in NAFLD from insulin resistance and unregulated
uptake of FFA is shown in Figure 1-3 [29].
![Page 18: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/18.jpg)
18
Mitochondrial Dysfunction and Inflexibility
The liver plays a major role in lipid metabolism [28]. TCA cycle flux increases in
diet-induced mice with NASH [25]. Diacylglycerides (DAGs) and ceramides increase
concurrently, regardless of increased TCA cycle activity to compensate for the influx of
fat into the mitochondria [25]. This suggests incomplete fat oxidation and storage due to
mitochondrial dysfunction [25]. Studies in mice fed on a trans-fat high fat diet (TFD)
have shown the inability of the hepatic mitochondria to regulate ketone turnover. The
mitochondria were unable to adapt to severe insulin resistance [30]. Chronic
mitochondrial dysfunction triggers inflammatory pathways, with hepatocellular death,
ballooning, and fibrosis.
As a compensatory mechanism, mitochondrial respiration initially increases in
response to an excessive FFA supply, but progression of the disease leads to
diminished mitochondrial function [31]. Uncoupled mitochondrial respiration and
elevated oxidative metabolism through the TCA cycle may increase reactive oxygen
species (ROS) in patients with a fatty liver [32]. ROS production is recognized as the
main contributor to hepatocellular death in the progression of NAFLD to NASH [33].
High concentrations of ROS have been attributed to the development of NASH [28],
[34]. Reactive oxygen species is a natural product of mitochondrial metabolism;
however, dysfunction from severe insulin resistance and chronic nutrient supply cause
an overproduction of ROS, activating proinflammatory responses [28]. For example, it
has been well studied that long-chain fatty acids activate toll-like receptor 4 (TLR4), and
that diet-induced mice have shown to have increased hepatic inflammation through the
TLR4 pathway [35, 36].
![Page 19: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/19.jpg)
19
Overall Hypothesis
Previous investigators have set the groundwork for the emerging field in
metabolic disorders. A study conducted in 2012 showed severely insulin resistant mice
had impaired ketogenesis [30]. The inflexibility of ketone turnover supported the idea of
mitochondrial metabolism remodeling during hepatic insulin resistance. Furthermore,
researchers have suggested rates of hepatic mitochondrial oxidation, or flux through the
TCA cycle, may play a key role in the progression of NAFLD. A prominent investigator
in the field, Gary Shulman, showed that TCA cycle flux is not altered in NAFLD [38],
which brings to attention the need to further study this disease. The Shulman lab
measured hepatic fluxes in humans using an experimental method with labeled acetate
and lactate. The data from Shulman’s lab suggested flux through the TCA cycle is not a
key player in the pathogenesis of NAFLD. Contrary to Shulman, our lab published last
year that flux through the TCA cycle increases in diet-induced mice with NASH [25].
Concurrently, we also showed lipotoxicity in steatohepatitis occurs despite an increase
in TCA activity. An increase in DAGs and ceramides suggest incomplete fat oxidation
and storage mechanisms. Furthermore, an increase in TCA cycle was shown in rats
when given an acute lipid load, or Intralipid challenge [37]. Likewise, oxidative stress
and inflammation occurred in response to higher flux through the TCA cycle. Together,
the idea that mitochondrial metabolism mediates oxidative stress and inflammation in
fatty liver is new novel observation, and our lab is currently working on this emerging
idea in more detail.
Our main hypothesis is that hepatic mitochondria are unable to adapt to the influx
of fat in mice with hepatic insulin resistance and fatty liver. Both in vivo and in vitro
experiments will be conducted to support the stated hypothesis. In this study, we
![Page 20: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/20.jpg)
20
present two studies, which together, capture the beginning and end-stages of fatty liver
disease. Our first aim will be to develop a cell system to model NAFLD. In vitro studies
will be used to see changes early on in an in vitro model of NAFLD, using low and high
concentrations of palmitate. In our second aim, in vivo studies will be used to assess the
acute and chronic adaptations of liver mitochondria during FFA overflow. These effects
will support the idea of mitochondrial dysfunction and impartial fat oxidation.
Mitochondrial oxidative flux is upregulated in NASH, and the current study is
meant to tease out the mechanisms by which NAFLD is associated with fat oxidation.
Intralipid infusion will be used to perturb mitochondrial oxidative function and detect
metabolic alterations. Mitochondria are mechanistically dysfunctional during hepatic
insulin resistance. Observing the effects of mitochondrial oxidative metabolism will
reveal the alterations involved in NAFLD and aid in the discovery for drug therapeutics
for the disease.
![Page 21: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/21.jpg)
21
Figure 1-1. Fatty liver disease progresses to steatohepatitis. NAFLD is characterized by
an infiltration of fat in the liver. This disease is extremely prevalent in patients with diabetes as well as obesity. Approximately 70% of T2DM patients will have a fatty liver and 30-40% of those patients will progress to NASH with fibrosis and inflammation within the liver, defined as NASH. Progression of NASH involves chronic inflammation and continual hepatocellular injury, leading to cirrhosis of the liver and high risk of cardiovascular disease [12].
![Page 22: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/22.jpg)
22
Figure 1-2. Fat accumulation occurs in insulin resistant liver with NAFLD. This human
model demonstrates fat build-up in the liver compared to a healthy liver [7]. Chronic fat accumulation is associated with an insulin resistant state of the liver, connected with obesity and insulin resistant adipose tissue [25].
![Page 23: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/23.jpg)
23
Figure 1-3. Hepatic insulin resistance and dyslipidemia in NAFLD. Fat oxidation resulting from increased adiposity in combination with nutrient overload, leads to raised triglyceride levels and gluconeogenic pathways, along with increased ketone bodies and TCA cycle flux.
![Page 24: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/24.jpg)
24
CHAPTER 2 ESTABLISHMENT OF AN IN VITRO MODEL SYSTEM TO PROBE MITOCHONDRIAL
ALTERATIONS IN EARLY STAGES OF NAFLD
In the current application, we developed an in vitro model system to study fatty
liver disease. We created a cell system that exhibited similar physiological changes
observed in a clinical setting in NAFLD. We designed the experiment to observe
alterations in mitochondrial function early-on in the disease. The rationale behind this
study was that teasing out mechanisms in isolated hepatocytes would provide further
insight into the metabolic feature of NAFLD.
Materials and Methods
Chemicals
Sodium D-3-hydroxybutyrate-2,4-13C2 was purchased from Sigma Aldrich. Urea
(13C, 99%; 15N2, 98%) was purchased from Cambridge Isotope Laboratories, Inc. All
other chemicals came from Fisher Scientific.
Animal Studies
Animal studies were approved by the Institutional Animal Care and Use
Committee (IACUC) at the University of Florida (UF) using protocol number 201507337.
Male mice (C57BL/6J) were ordered from Jackson Laboratory at 10 to 12 weeks of age
for animal diet feeding studies. C57BL/6J mice were fed a synthetic control diet (C; 10%
fat calories, no. D09100304; Research Diets) by Animal Care Services (ACS) or a high
trans-fat diet (TFD; 40% fat calories, no. D09100301) for 4-5 weeks for in vitro studies.
Primary Hepatocyte Isolation
Primary hepatocytes were isolated by collagenase perfusion from C57BL/6J mice
fed on either a control or TFD diet for 4 weeks. After several centrifugation steps, 1
million hepatocytes were seeded onto collagen-coated plates in customized Waymouth
![Page 25: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/25.jpg)
25
media. Custom Waymouth media contained 10% of FBS, insulin (100nM),
dexamethasone (100 nM), and penicillin-streptomycin. Following a 4 hour incubation
period, primary hepatocytes were incubated overnight in low or high fat custom-made
media- 0.2 mM FFA or 0.8 mM FFA. Custom-made media contained L-carnitine (1 mM),
BCAA (0.2 mM), insulin (1 nM), glucose (5 mM), and glycerol (0.3 mM) in a solution
containing 2% BSA in DPBS. Media was collected in hourly increments for ketone
production measurements. For protein expression of insulin resistance, media was
given an insulin bolus (50 nM) for 15 minutes and then the hepatocytes were collected.
Cells were collected the next day for triglyceride content, as well as protein and gene
expression analysis.
Mitochondrial Respiration
Intact mitochondria were isolated from fresh liver tissue using differential
centrifugation. Mitochondrial oxygen consumption was measured using the Oroboros
O2K system in mice fed four weeks on control or TFD diet. The chamber volume was 2
mL for each measurement. A total of 0.4 mg of mitochondrial protein was added to
respiration incubation media at 37°C containing Complex I respiratory substrates,
glutamate (2 M) and malate (0.8 M) to assess State 3 and 4 respiration. State 4, or non-
phosphorylating oxygen consumption, was obtained as endogenous ATP is depleted
from the addition of mitochondria. State 3, also known as ADP stimulated respiration,
was induced with the addition of adenosine diphosphate in excess (ADP, 1 mM). All
rates were recorded for at least 2 minutes. The assay was repeated in duplicate, with
the rate of change between State 3 and 4 calculated for comparison.
![Page 26: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/26.jpg)
26
Mitochondrial ROS Production
Liver mitochondrial reactive oxygen species (ROS) production was done with
constant stirring at 37 °C using 150 μg of mitochondrial protein in 500 μL of incubation
media. ROS production was assessed in the presence of Complex I substrates,
glutamate/malate, and in the presence of Complex I and Complex III electron transport
chain inhibitors to determine sources of ROS. This was done using an AmplexRed (AR)
and horseradish peroxidase reaction, which measures the amount of hydrogen peroxide
(H2O2) produced on a spectrofluorometer (Shimadzu RF5301PC). To determine the
optimal inhibitor concentration, titration curves were performed for each inhibitor at
concentrations of 0, 0.1, 1, 5, 10, and 20 μM in liver mitochondria utilizing either
glutamate and malate or succinate to support ROS production, with the final
concentration used as 10 μM for each inhibitor. Basal ROS production was assessed
first for two minutes, Antimycin A added after the initial two minutes, and Rotenone
added subsequently two minutes later. Each sample was analyzed for ROS production
twice, with average concentrations of H2O2 reported.
Histology
Tissue (liver) from mice fed on diet for four weeks was placed in formalin for
histology. Liver from mice fed on diet for 4 weeks were fixed in 10% neutral buffered
formalin for 20–24 hours, washed and stored in 70% ethanol before embedding in
paraffin at the Molecular Pathology Core at University of Florida. The liver sections from
the control mice and mice with NAFLD were then stained with Masson’s Trichrome to
visualize collagen fibers. The liver slides were blinded and scored by a veterinary
pathologist using a previously published and validated scoring system of liver biopsies
[39].
![Page 27: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/27.jpg)
27
Western Blotting for Protein Expression
Primary hepatocytes were lysed in buffer containing protease and phosphatase
inhibitors (Sigma-Aldrich, St. Louis, MO). Following SDS-PAGE, proteins were
transferred to a nitrocellulose membrane (Protran; Whatman/GE Healthcare,
Piscataway, NJ) and incubated overnight with the desired primary antibody (Cell
Signaling Technology, Danvers, MA). Membranes were incubated in the IgG rabbit
secondary antibody the next morning and developed using BioRad ChemiDoc System
with ECL or lumigen imaging. Protein expression was quantified using Image J
Software.
Gene Expression Analysis
Primary hepatocytes mRNA were extracted by using Trizol. The extracted mRNA
was converted into cDNA using the iScript cDNA Synthesis Kit from (BioRad, Inc.).
Quantitative real-time polymerase chain reaction (qPCR) was performed on the desired
genes. The qPCR mix contained 25 ng cDNA, 150 nmol/L of each primer and 5 µl
SYBR Green PCR master mix (BioRad Inc.). Samples were run in triplicate on a CFX
Real Time system (Bio Rad, C1000 Touch Thermal Cycler). The comparative threshold
method was used to determine relative mRNA levels with cyclophilin as the internal
control. Primers used for qPCR are listed in Table A-1.
Biochemical Measurements
Hepatocyte triglycerides were resuspended in 2:1 chloroform: methanol and the
supernatant was taken for measurement. Concentrations were determined using Serum
Triglyceride Determination kit from Sigma Aldrich.
![Page 28: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/28.jpg)
28
Targeted Metabolomics
Analysis of plasma urea and ketones was done by gas chromatography-mass
spectrometry (GC-MS). To 50 µL media, a known concentration of their respective
internal standards was added. The samples were deproteinized with 500 µL acetone
and supernatant was dried under nitrogen. Dried sample was converted to a derivative
by 50% MTBSTFA + 50% DMF before separation on a HP-5MS column (30m x 0.25
mm x 0.25 μm; Agilent) under electron impact ionization (HP 5973N Mass Selective
Detector, Agilent).
Statistics
All continuous variables were represented as means ± SEM. A Student’s t-test
was used for comparison among two groups, with significance determined as p<0.05.
Results
Hepatocytes of Mice Fed a High Fructose Diet Develop NAFLD at 4 Weeks
An in vitro model system was created to perturb the mechanisms involved in the
progression of NAFLD. Hepatocytes were isolated from the liver of mice fed either a
semisynthetic control diet or a high fructose, high trans-fat diet.
Histology at 4 weeks further validates this model with presence of lipid droplets in
mice fed a high fructose high trans-fat diet. Hematoxylin and eosin (H&E) staining
showed increased lipid droplets in TFD mice versus control (Figure 2-1A and 2-1B).
Trichrome staining showed no fibrosis among both groups (Figure 2-1C and 2-1D).
Mice fed on a high fructose, high trans-fat diet experienced adaptive
mitochondrial oxidative metabolism and increased storage mechanisms (Figure 2-2).
Challenging isolated hepatocytes from a four-week control-fed mouse with high FFA
![Page 29: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/29.jpg)
29
(0.8 mM) led to increased triglyceride (TG) storage (Figure 2-2A). In media with
physiological FFA, hepatocytes isolated from mice on a TFD diet had significantly
higher TG content than their control counterparts. Furthermore, ketone production was
elevated at each time interval in TFD-fed mice versus control-fed mice (Figure 2-2B).
Protein and Gene Expression Show Insulin Resistance and Increased Mitochondrial Function at 4 Weeks of Feeding
Insulin signaling was initially upregulated with elevated concentrations of free
fatty acids in primary isolated hepatocytes. Antibodies involved in the downstream
signaling of insulin (Akt Ser473) were probed to test insulin sensitivity. Protein
expression was high due to increased nutrient supply at 4 weeks of feeding. Insulin
sensitivity was tested by administering a bolus of insulin for 15 minutes (Figure 2-3).
Control-fed mice had increased expression of Akt-P(Ser473) when stimulated
with insulin. The phosphorylated form of Akt, downstream from the insulin receptor (Irs-
2), was used as a measure of insulin sensitivity. Western blots conducted using isolated
hepatocytes showed increased expression in control-fed mice when given an insulin
bolus. The expression of Akt-P(Ser473) was more prevalent when challenged with 0.8
mM FFA. Protein expression by western blotting showed elevated basal insulin
signaling in TFD mice. The TFD mice at 4 weeks experienced a blunted response to an
insulin stimuli, which is clearly shown with isolated hepatocytes in high FFA media.
Protein expression was lower in TFD mice when challenged with high FFA, and did not
increase significantly when stimulated by insulin. Fatty acid synthase (Fas) displayed
higher expression in TFD mouse, but did not vary when challenged with insulin or high
FFA.
![Page 30: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/30.jpg)
30
Isolated hepatocytes fed for four weeks displayed alterations shown by qPCR.
Genes involved in fat oxidation and ketogenic pathways were upregulated. Upregulation
of FAO and ketogenesis were diet-induced. Pgc1a is a coactivator of Ppara, which is
involved in fat oxidation as well as mitochondrial biogenesis and gluconeogenesis [31],
[40], [41]. Cpt1a is the key enzyme in carnitine-dependent transport across the
mitochondrial inner membrane [42]. We also analyzed the gene responsible for the
uncoupling protein within the mitochondria, Ucp2, which separates oxidative
phosphorylation from ATP synthesis and is used to control ROS production [43]. Genes
involved in lipogenesis were also regulated differently in mice fed a TFD diet. The gene
involved with fatty acid metabolism and is the rate-limiting step in fatty acid synthesis
Acc1 [44], trended higher in mice on a TFD diet. Fatty acid synthase, Fas, involved with
the synthesis of palmitate [45] trended lower with mice fed a high fructose, high trans-fat
diet. Fibrotic and inflammatory markers were also upregulated in TFD mice (Table 2-1).
Hepatic mitochondrial function was elevated at four weeks of high trans-fat
feeding. A precursor for fat oxidation and involved in mitochondria biogenesis, Pgc1a,
was upregulated in TFD mice compared to control (Figure 2-4A). The gene involved in
bringing FFA into the mitochondria for oxidative metabolism, Cpt1a, was also
upregulated in TFD mice. Higher nutrient supply (0.8 mM FFA) increased expression of
Cpt1a (Figure 2-4B). Long chain acyl-coA dehydrogenase, Lcad, is the first enzyme
involved in free fatty acid metabolism, and was upregulated in TFD mice (Figure 2-4C).
3-Hydroxy-3-methylglutaryl-coA synthase 2, Hmgcs2, the first enzyme involved in
ketogenesis [46], exhibited increased expression in TFD hepatocytes compared to their
control counterparts (Figure 2-4D).
![Page 31: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/31.jpg)
31
Genes involved with collagen synthesis and breakdown, Pc1 and Mmp13, were
upregulated in the hepatocytes of mice on a TFD diet [47]. Also involved in fibrosis, Pc1
and Mmp13, were upregulated in mice fed on a high fructose, high trans-fat diet for 4
weeks (Figure 2-5A and 2-5B). Interleukin 6, Il6, is a pro-inflammatory cytokine that acts
to increase the breakdown of fats and to improve insulin resistance [48]. Il6 was
significantly increased in TFD mice, and high FFA in the media of TFD hepatocytes
further upregulated expression of Il6 (Figure 2-5C).
Mitochondrial Respiration and ROS Production is Elevated in TFD Mice at 4 Weeks
Oxygen consumption rates were higher in mice fed a TFD using glutamate and
malate as substrates (Figure 2-6A). Isolated mitochondria at 4 weeks on a TFD
displayed increased mitochondrial respiration at State 4 and State 3 respiration.
Furthermore, ROS production was also increased at 4 weeks in TFD mice (Figure 2-
6B).
![Page 32: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/32.jpg)
32
Figure 2-1. Histology of C57BL/6J mice fed on a control or TFD diet for 4 weeks. A)
Hematoxylin and eosin staining showed no lipid droplets in control mice. B) H&E staining showed drastically increased lipid droplets in mice fed a high fructose, high trans-fat diet for 4 weeks. Trichrome staining showed no fibrosis in C) control or D) TFD hepatocytes.
![Page 33: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/33.jpg)
33
All data are represented as mean ± SEM; n=3-4. (
#p<0.05 among 0.2 mM FFA vs. 0.8 mM FFA;
**p<0.05
versus respective control group)
Figure 2-2. Metabolic changes in C57BL/6J primary hepatocytes following a custom media incubation. A) Primary hepatocytes isolated from 4-wk TFD fed mice had a higher triglyceride content versus control-fed mice. B) Ketone production was elevated for each time increment in mice fed a high trans-fat diet for 4 weeks compared to a control diet in 0.2 mM FFA custom media.
![Page 34: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/34.jpg)
34
Figure 2-3. Insulin signaling was blunted in NAFLD-modeled hepatocytes. Akt-
P(Ser473) insulin signaling expression was highly expressed from an insulin bolus in control-fed mice. In TFD hepatocytes with an acute insulin bolus, a blunted insulin signaling response was present. Quantification of the western blot is shown in Figure A-2.
Akt-P (Ser473)
Gapdh
Akt-T
Fas
0.2 mM Palmitate
0.8 mM Palmitate
+ins -ins +ins -ins +ins -ins +ins -ins
TFD diet Control TFD diet Control
![Page 35: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/35.jpg)
35
Table 2-1. Expression of genes related to mitochondrial metabolism and inflammation markers in primary isolated hepatocytes of C57BL/6J mice fed on a control diet or a high fructose high trans-fat diet (TFD) for 4 weeks. Mice fed on a TFD for 4 weeks had elevated fat oxidation and ketogenic pathways. Mitochondrial respiration was also upregulated, in conjunction with lipogenesis. Mice fed at TFD had an upregulation in fibrosis and inflammatory genes.
Control diet TFD diet
0.2 mM FFA 0.8 mM FFA 0.2 mM FFA 0.8 mM FFA
Fat oxidation and Ketogenesis
Pgc1a/Ppargc1a 1.00 ± 0.29 1.39 ± 0.42 2.20 ± 0.33* 1.78 ± 0.28
Ppara 1.00 ± 0.31 0.91 ± 0.18 1.07 ± 0.12 1.18 ± 0.14
Cpt1a 1.00 ± 0.14 1.45 ± 0.12 2.64 ± 0.27* 3.45 ± 0.74*
Lcad/Acadl 1.00 ± 0.21 0.66 ± 0.07 1.43 ± 0.19 1.48 ± 0.17*
Hmgcs2 1.00 ± 0.14 1.01 ± 0.21 2.82 ± 0.50* 2.78 ± 0.48*
Mitochondrial Respiration
Ucp2 1.00 ± 0.45 1.35 ± 0.46 2.17 ± 0.82 2.19 ± 0.38
Lipogenesis
Acc1 1.00 ± 0.14 1.07 ± 0.15 1.57 ± 0.36 1.45 ± 0.11
Fas 1.00 ± 0.11 0.86 ± 0.09 0.78 ± 0.05 0.64 ± 0.06
Fibrosis and Inflammation
Pc1 1.00 ± 0.12 1.27 ± 0.28 2.67 ± 0.29* 2.46 ± 0.74
Mmp13 1.00 ± 0.17 0.92 ± 0.16 4.58 ± 1.01 3.26 ± 0.62
Il6 1.00 ± 0.22 0.86 ± 0.28 9.68 ± 0.53* 29.08 ±3.78*#
Values are mean ± SEM; n=3-5 per group. (*p ≤ 0.05 versus respective control groups; #p ≤ 0.05 between 0.2 mM and 0.8 mM FFA groups).
![Page 36: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/36.jpg)
36
All data are represented as mean ± SEM; n=3-4. (
#p<0.05 among 0.2 mM FFA vs. 0.8 mM FFA;
*p<0.05
versus respective control group)
Figure 2-4. Genes involved in fat oxidation and ketogenesis were upregulated in TFD mice at 4 weeks. A) Pgc1a, an activator of Ppara, was significantly upregulated in a diet-induced model of NAFLD. B) The gene involved in bringing fat into the mitochondria for oxidation, Cpt1a, was also increased, and further increased with a high FFA challenge. C)The first step in the fatty acid oxidation, Lcad, was upregulated in TFD versus control. D) The first step in ketogenesis, Hmgcs2, was also elevated in TFD mice compared to the controls.
![Page 37: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/37.jpg)
37
All data are represented as mean ± SEM; n=3-4. (
#p<0.05 among 0.2 mM FFA vs. 0.8 mM FFA;
*p<0.05
versus respective control group)
Figure 2-5. Hepatocytes isolated at 4 weeks of TFD exhibited elevated fibrotic and
inflammatory markers. A) A promoter of collagen synthesis, Pc1, was significantly higher in mice fed a high fructose, high trans-fat diet. B) Another gene involved with fibrosis, Mmp13, showed an increasing trend in TFD compared to controls. C) A proinflammatory cytokine, Il6, was also higher due to diet, as well as a high FFA challenge.
![Page 38: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/38.jpg)
38
Figure 2-6. Primary hepatocytes from 4-wk TFD mice showed elevated oxygen
consumption rate (OCR) and ROS production with NAFLD. A) TFD isolated hepatocytes showed an increased OCR compared to control when given Complex I substrates during State 4 and State 3 respiration. B) At each mitochondrial complex inhibitor (Antimycin A for Complex III and Rotenone for Complex I), TFD isolated hepatocytes demonstrated increased ROS production compared to control-fed mice.
![Page 39: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/39.jpg)
39
CHAPTER 3 INTRALIPID CHALLENGE SHOWS COMPLETE MITOCHONDRIAL DYSFUNCTION
IN MOUSE MODEL OF NASH
Our second aim of the study was to demonstrate mitochondrial dysfunction in a
mouse model of NASH. This was done by feeding mice with a high fructose, high trans-
fat diet for 24 weeks to induce steatohepatitis [49, 50]. To assess steatohepatitis, we
used a nutrient-induced insulin resistant mouse model and administered an acute
Intralipid infusion challenge.
Materials and Methods
Chemicals
Intralipid (20% fat emulsion) was purchased from Fresenius Kabi. Heparin (1,000
units/mL) was purchased from Sagent Pharmaceuticals. All other chemicals came from
Fisher Scientific.
Animal Studies
Animal studies were approved by the Institutional Animal Care and Use
Committee (IACUC) at the University of Florida (UF) under protocol number 201507337.
Male mice (C57BL/6J) were ordered from Jackson Laboratory at 10 to 12 weeks of age
for animal diet feeding studies. C57BL/6J mice were fed a synthetic control diet (C; 10%
fat calories, no. D09100304; Research Diets) by Animal Care Services (ACS) or a high
trans-fat diet (TFD; 40% fat calories, no. D09100301) for 24 weeks for in vivo studies.
Histology
Tissue (liver) from mice fed on diet for twenty-four weeks was placed in formalin
for histology. Liver from mice fed on diet for 24 weeks were fixed in 10% neutral
buffered formalin for 20–24 hours, washed and stored in 70% ethanol before
embedding in paraffin at the Molecular Pathology Core at University of Florida. The liver
![Page 40: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/40.jpg)
40
sections from the control mice and mice with NAFLD were then stained with Masson’s
Trichrome to visualize collagen fibers. The liver slides were blinded and scored by a
veterinary pathologist using a previously published and validated scoring system of liver
biopsies [39].
Jugular Vein Catherization
Jugular vein catheters were implanted in mice fed with control and TFD diet (n=5-
9) for stable isotope infusions. Mice were given 100 µL buprenex under anesthesia the
day of surgery and the day after surgery. Weight was monitored for 5 days to ensure
viable mice.
Intralipid Infusion
Body weight (g) and fasting blood glucose levels (mg/dL) were recorded from
each mouse before start of infusion. Mice were fasted one hour prior to the start of
infusions. Control and TFD mice were randomized to receive either an Intralipid or a
glycerol infusion over a 5 hour period. There were four treatment groups: control
animals infused with glycerol (C + glycerol), control animals infused with Intralipid (C +
Intralipid), TFD animals infused with glycerol (TFD + glycerol), and TFD animals infused
with Intralipid (TFD + Intralipid). A group of control mice (n=11) were infused with only
glycerol (n=5) or Intralipid (n=6). A group of TFD mice (n=17) were infused with only
glycerol (n=8) or Intralipid (n=9). The Intralipid solution (20% fat emulsion) contained
2.25% glycerol, and thus the infusion of glycerol alone was 2.25%. Emulsion of 20%
Intralipid was introduced through the mouse jugular vein catheter at a rate of 0.075
mL/hour. Heparin was added (20 µL/ 1 mL Intralipid) to the infusion mixture to facilitate
the lipolysis of Intralipid in vivo.
![Page 41: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/41.jpg)
41
Preliminary Data for Intralipid Infusion Rate
Two test animals were used to validate the dose of Intralipid infused. Mice were
fasted an hour before infusion, and their blood (50 µL) were collected from the mouse
tail vein in every hour interval for a total of five hours. Plasma was collected by spinning
down the blood for 10 min, at 9000 rpm 4oC. This was to test if desired level of free fatty
acids (FFA, mmol/L) increased at least two-fold than normal to represent an elevated
physiological level of free fatty acids (Figure A-1).
Intralipid Infusion Analysis
Following 5-hour infusion of either Intralipid or glycerol, mice were anesthetized
and whole blood was collected from the descending aorta. Livers were flash frozen in
liquid nitrogen and later stored at -80°C until further analysis.
Western Blotting for Protein Expression
Approximately 30 mg aliquots of frozen livers were used to analyze protein
expression. Liver proteins were lysed in buffer containing protease and phosphatase
inhibitors (Sigma-Aldrich, St. Louis, MO). Following SDS-PAGE, proteins were
transferred to a nitrocellulose membrane (Protran; Whatman/GE Healthcare,
Piscataway, NJ) and incubated overnight with the desired primary antibody (Cell
Signaling Technology, Danvers, MA). Membranes were incubated in the IgG rabbit
secondary antibody the next morning and developed using BioRad ChemiDoc System
with ECL or lumigen imaging. Protein expression was quantified using Image J
Software.
Gene Expression Analysis
Liver mRNA was extracted by using Trizol. The extracted mRNA was converted
into cDNA using the iScript cDNA Synthesis Kit from (BioRad, Inc.). Quantitative real-
![Page 42: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/42.jpg)
42
time polymerase chain reaction (qPCR) was performed on the desired genes. The
qPCR mix contained 25 ng cDNA, 150 nmol/L of each primer and 5 µl SYBR Green
PCR master mix (BioRad Inc.). Samples were run in triplicate on a CFX Real Time
system (Bio Rad, C1000 Touch Thermal Cycler). The comparative threshold method
was used to determine relative mRNA levels with cyclophilin as the internal control.
Biochemical Measurements
Plasma free fatty acid concentrations were determined using the HR Series
NEFA kit, purchased from Wako Pure Chemical Industries, Ltd. Plasma and liver
triglyceride concentrations were determined using Serum Triglyceride Determination kit
from Sigma Aldrich. Triglyceride processing followed the method as described in the
methods of Chapter 2. Plasma insulin was measured by a mouse insulin ELISA kit from
Crystal Chem, Inc.
Targeted Metabolomics
Fasting plasma urea and ketones concentrations were analyzed by stable
isotope dilution with GC-MS. To 10 µL plasma, a known concentration of their
respective internal standards was added. Processing followed the method as described
in the methods of Chapter 2.
Statistics
All continuous variables were represented as means ± SEM. A Student’s t-test
was used for comparison among two groups, with significance determined as p<0.05.
![Page 43: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/43.jpg)
43
Results
C57BL/6J Mice Develop NASH at 24 Weeks of High Fructose High trans-Fat Feeding
At 24 weeks of a high fructose high trans-fat diet, C57BL/6J mice develop
nonalcoholic steatohepatitis. In a previous NASH study our lab conducted, liver
histology with H&E staining showed large amounts of lipid droplets and fibrosis in mice
fed a TFD diet versus a control diet (Figure 3-1A and 3-1B) [25]. Furthermore, fibrosis
and inflammation was even more prevalent in mice on a TFD for 24 weeks than the
controls (Figure 3-1C and 3-1D).
Mitochondria are Dysfunctional in Mouse Model of NASH
Mice with NASH at 24 weeks exhibited many metabolic alterations. Hepatic
mitochondria were deemed dysfunctional from a high fructose high trans-fat diet based
on measured metabolic parameters. This is further supported by an administered
Intralipid challenge. Clinical and metabolic parameters of both control and TFD mice fed
for 24 weeks are shown in Table 3-1.
A high fructose high trans-fat diet generated weight gain compared to mice on a
control diet (Figure 3-2A). An acute infusion of Intralipid gradually increased the overall
weight of the mice. Liver weight was significantly different in TFD mice compared to
their respective controls (Figure 3-2B). Liver triglyceride content also amounted to more
in the presence of high nutrient supply, with an Intralipid challenge aiding in triglyceride
storage (Figure 3-2C).
An acute 5-hour infusion with Intralipid showed an increasing trend in raising
plasma blood glucose levels (Figure A-3). A high fructose high trans-fat diet had no
![Page 44: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/44.jpg)
44
significant effect on blood glucose. Insulin levels after a 1 hour fast were also raised in
accordance to an Intralipid challenge and high nutrient supply (Figure 3-3).
Triglycerides in the plasma were elevated when mice were given a 5-hour
Intralipid infusion (Figure 3-4A). An acute Intralipid infusion for 5 hours elevated FFA
levels two-fold (Figure A-1). Free fatty acids were elevated significantly when
challenged with an acute Intralipid infusion in both control and TFD mice (Figure 3-4B).
TFD mice initially had a higher level of FFAs compared to that of control. Ketogenesis
was also elevated in TFD mice compared to the controls (Figure 3-4C). Ketone
production in control mice increased significantly when supplemented with Intralipid, but
this response was blunted in the TFD mice. There were no significant changes in urea
production among all four groups (Figure 3-4D).
NASH Mice Exhibit Severe Insulin Resistance
Western blots conducted on liver homogenates show with Irs-2 severe insulin
resistance in TFD mice at 24 weeks of feeding (Figure 3-5). Downstream signaling with
Akt-P(Ser473) and Akt-P(T hr308) further demonstrate the inability of NASH mice to
effectively respond to an influx of fat. Basal insulin signaling is upregulated in NASH
mice infused with glycerol, and this response is blunted when challenged with Intralipid.
Gene expression showed that oxidative metabolism, mitochondrial respiration,
and lipogenesis in NASH mice were upregulated. Cytochrome C, CytC, which binds to
cardiolipin and may result in ROS production remained unchanged [51]. Chrebp, a
central regulator of de novo lipogenesis also remained unchanged in the TFD mice
compared to the control-fed mice [52]. Inflammation and fibrosis were also higher in
mice with steatohepatitis. Fgf21, involved in fatty acid oxidation and glucose uptake in
fat was upregulated in control-fed mice from an acute Intralipid infusion [53]. Expression
![Page 45: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/45.jpg)
45
of Fgf21 was slightly higher in TFD-fed mice versus the control, with no significant
change in expression when challenged with Intralipid. All genes observed for NASH
mice are displayed in Table 3-2.
Hepatic mitochondrial signaling is upregulated in TFD mice compared to controls,
but exhibit an inability to respond when given Intralipid. Fat oxidation was upregulated in
control-fed mice with an Intralipid challenge, but TFD mice experienced a blunted
response to increase fat oxidation when given Intralipid (Figure 3-6A). Mitochondrial
respiration was significantly altered in TFD mice (Figure 3-6B). Srebp1c is a major
regulator of fatty acid synthesis [54]. Lipogenesis, shown by Srebp1c, was also
increased in TFD mice compared to the controls (Figure 3-6C).
Fibrosis and inflammatory signaling, Mmp13, Tnfa, and Tlr4, were upregulated in
TFD mice versus controls (Figure 3-7). Mmp13, a gene that encodes for collagenase 3
and is involved in fibrosis [47], was significantly high in TFD mice (Figure 3-7A).
Involved in systemic inflammation and cell death, Tnfa, an inducer of cell death and
systemic inflammation [55], was also higher due to TFD (Figure 3-7B). Tlr4, an activator
of the innate immune system [56], was upregulated in TFD mice compared to respective
controls (Figure 3-7C).
![Page 46: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/46.jpg)
46
Figure 3-1. Histology of C57BL/6J mice fed a control or TFD diet for 24 weeks. A) H&E
staining for control mice showed no lipid droplets whereas B) TFD mice exhibited accumulation of lipids. C) Trichrome staining in control-fed mice showed no fibrosis. D) Trichrome staining showed severe fibrosis and hepatocyte cellular death in TFD-fed mice with NASH.
Control diet TFD diet
![Page 47: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/47.jpg)
47
Table 3-1. Clinical and metabolic parameters from biological samples of C57BL/6J control and TFD fed mice when challenged with a five-hour glycerol or Intralipid infusion. NASH mice had higher body and liver weight than the controls. Intralipid further emphasized this effect. Ketogenesis and triglyceride storage mechanisms were higher in TFD mice compared to the controls.
All data are represented as mean ± SEM; n=4-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups).
Control diet TFD diet
Glycerol Intralipid Glycerol Intralipid
Body Weight (g) 32.50 ± 0.99 31.25 ± 0.84 36.22 ± 1.53* 38.22 ± 0.83*
Liver Weight (g) 1.21 ± 0.06 1.11 ± 0.04 3.08 ± 0.24* 3.47 ± 0.23*
Plasma Glucose (mg/dL)
150.00±8.42 172.71 ± 8.97 153.56±13.03 169.56±12.28
Plasma Insulin (ng/mL) 0.43 ± 0.08 0.33 ± 0.02 0.42 ± 0.06 0.45 ± 0.03*
Plasma Ketones (µmoles/L)
235.4 ± 36.6 840.0 ± 95.1# 708.1 ±138.9* 902.5 ± 257.4
Plasma Urea (µmoles/L)
4886 ± 451 5229 ± 269 4745 ± 397 4762 ± 323
NEFA (mmoles/L) 0.24 ± 0.04 0.83 ± 0.03# 0.35 ± 0.04* 0.62 ± 0.07*#
Plasma Triglycerides (mmoles/L)
0.85 ± 0.03 1.38 ± 0.05# 0.83 ± 0.04 1.12 ± 0.06*#
Liver Triglycerides (mg/g liver)
9.76 ± 2.12 15.68 ± 2.01 92.49±10.94* 99.27 ± 5.77*
![Page 48: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/48.jpg)
48
2 0
3 0
4 0
5 0
Bo
dy
We
igh
t
(g)
*
C o n tro l T F D
*
0
1
2
3
4
Liv
er W
eig
ht
(g)
*
C o n tro l T F D
*
0
5 0
1 0 0
Liv
er T
rig
lyc
erid
es
(mg
g l
ive
r-1
)
* *
C o n tro l T F D
A ) B ) C )
All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 bet ween glycerol and Intralipid infusion groups)
Figure 3-2. Basal parameters of control and TFD fed mice. A) Mice weighed more when fed on a high trans-fat diet. B) Liver weight was significantly higher on a TFD diet, even more so in TFD mice challenged with Intralipid. C) Liver triglycerides were higher in TFD mice compared to their respective controls.
All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups)
Figure 3-3. TFD raises fasting plasma insulin and Intralipid increases insulin and
glucose levels. A) An acute infusion with Intralipid raised glucose levels in both control and TFD mice. B) Intralipid raised insulin levels in control and TFD mice. A high fructose high trans-fat diet also elevated insulin levels.
![Page 49: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/49.jpg)
49
All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups)
Figure 3-4. C57BL/6J mice following a 5-hr Intralipid infusion exhibited mitochondrial
dysfunction and inflexibility. A) High influx of FFA lead to elevated TGs in the plasma in TFD-fed mice infused with Intralipid. B) A 5-hr Intralipid infusion showed significant increase in FFA production in TFD-fed mice and a further elevated response when challenged with Intralipid. C) Ketone production was increased in TFD-fed mice at 24 weeks of feeding, and remained similar when challenged with Intralipid. Urea production is shown in Figure A-4.
Figure 3-5. Basal insulin signaling is upregulated in insulin resistant C57BL/6J TFD
mice. TFD mice had upregulated insulin signaling when infused with glycerol. Further challenge of Intralipid demonstrates the severe insulin resistance in mouse models of NASH. Quantification of the western blot is shown in Figure A-5.
![Page 50: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/50.jpg)
50
Table 3-2. Expression of genes related to mitochondrial metabolism and inflammation markers in liver homogenates of C57BL/6J mice fed on a control diet or a high fructose, high trans-fat diet (TFD) for 24 weeks. Genes related to fat oxidation and ketogenic pathways were upregulated in TFD mice. Mitochondrial respiration was also increased due to diet. Fibrosis and inflammation was significantly increased in NASH mice.
Control diet TFD diet Glycerol Intralipid Glycerol Intralipid
Fat oxidation and Ketogenesis
Pgc1a/Ppargc1a 1.00 ± 0.27 0.82 ± 0.23 0.39 ± 0.04 0.44 ± 0.06
Ppara 1.00 ± 0.09 1.63 ± 0.21# 2.21 ± 0.25* 1.98 ± 0.57
Cpt1a 1.00 ± 0.26 0.95 ± 0.06 0.66 ± 0.10 0.69 ± 0.14
Lcad/Acadl 1.00 ± 0.06 1.26 ± 0.10 1.34 ± 0.09* 1.43 ± 0.04
Hmgcs2 1.00 ± 0.10 1.40 ± 0.04# 1.36 ± 0.12 1.44 ± 0.13
Mitochondrial Respiration
Ucp2 1.00 ± 0.16 0.91 ± 0.14 2.54 ± 0.15* 2.09 ± 0.53
Cytc 1.00 ± 0.04 1.17 ± 0.16 0.93 ± 0.04 1.01 ± 0.05
Lipogenesis
Acc1 1.00 ± 0.42 0.61 ± 0.08 0.83 ± 0.11 0.91 ± 0.14
Fas 1.00 ± 0.67 0.51 ± 0.10 0.81 ± 0.16 1.05 ± 0.19
Srebp1c 1.00 ± 0.10 0.83 ± 0.25 1.77 ± 0.24* 1.74 ± 0.22*
Chrebp 1.00 ± 0.13 0.93 ± 0.09 1.00 ± 0.06 1.11 ± 0.09
Fibrosis and Inflammation
Pc1 1.00 ± 0.19 1.00 ± 0.16 44.05 ±11.87 30.67 ±12.17
Fgf21 1.00 ± 0.29 2.76 ± 0.52# 1.51 ± 0.13 1.83 ± 0.15
Tnfa 1.00 ± 0.11 1.44 ± 0.47 2.83 ± 0.60* 2.71 ± 0.22
Mmp13 1.00 ± 0.38 0.94 ± 0.29 25.87 ± 2.02* 16.73 ± 5.55
Il6 1.00 ± 0.43 1.87 ± 0.59 0.48 ± 0.14 0.68 ± 0.26
Tlr4 1.00 ± 0.16 1.03 ± 0.25 2.54 ± 0.30* 2.71 ± 0.45*
Values are mean ± SEM; n=3-4 per group. (*p ≤ 0.05 versus respective control groups; #p ≤ 0.05 between glycerol and Intralipid infusion groups).
![Page 51: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/51.jpg)
51
All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05
between glycerol and Intralipid infusion groups)
Figure 3-6. Gene expression of C57BL/6J mice at 24 weeks of feeding. NASH mice exhibited elevated A) fat oxidation, B) mitochondrial respiration, and C) lipogenic signaling pathways. The gene involved in mitochondrial fat oxidation, Ppara, was upregulated in TFD mice versus control. Intralipid increased oxidation in control mice, but this response was blunted in TFD mice. Mitochondrial respiration, observed with Ucp2, was increased due to high nutrient supply. Lipogenesis (Srebp1c) was increased in TFD mice compared to their respective controls.
![Page 52: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/52.jpg)
52
All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups)
Figure 3-7. Inflammation and fibrosis is present in NASH mouse models. Gene expression at 24 weeks of high trans-fat feeding showed elevated inflammatory signaling. A) Mmp13, a gene involved in fibrosis, was upregulated due to TFD. B) Proinflammatory genes, Tnfa and Tlr4, were upregulated in mice on a TFD versus control. C) TFD mice infused with Intralipid had a significantly higher expression than their respective controls.
Mm
p13
0
10
20
30
Rela
tive m
RN
A e
xp
ressio
n
*
*
CICG TG TI
Mmp13
Tnfa
0
1
2
3
4
Rela
tive m
RN
A e
xp
ressio
n
*
*
CICG TG TI
Tnfa
Tlr4
0
1
2
3
4
Rela
tive m
RN
A e
xp
ressio
n *
*
Tlr4
CICG TG TI
*
A) B) C)
![Page 53: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/53.jpg)
53
CHAPTER 4 DISCUSSION
It is well established that NAFLD is a chronic metabolic disorder [1]. Our study
explored mitochondrial oxidative metabolism within the liver in insulin resistant mice.
Mitochondrial metabolism was altered due to high nutrient supply with a TFD, as well
with a further insult of FFA (0.8 mM FFA or Intralipid). We showed mitochondrial
dysfunction despite insulin resistance, in both an in vitro cell model of NAFLD and an in
vivo mouse model of NASH.
Developing an in vitro model system to study NAFLD was a necessary
innovation. The cell system model was validated through a variety of assays, allowing
us to conduct experiments studying the mechanisms and progression of the disease.
Histology further validate the cell system model, showing high accumulation of lipid
droplets without fibrosis in TFD mice at 4 weeks of feeding. The accumulation of
triglycerides from the influx of fat caused a switching of storage mechanisms to
oxidation of fat. An overnight incubation with excess FFA (0.8 mM) demonstrated the
ability of the mitochondria to adapt to external stimuli in the hepatocytes of control-fed
mice. The ability for the mitochondria to compensate for a high supply of FFA was
blunted in mice fed a TFD diet. Ketogenesis was elevated in TFD mice at each time
interval, validating the in vitro model system. Isolated hepatocytes were shown to have
upregulated basal insulin signaling, but displayed insulin resistance when TFD
hepatocytes were challenged with a bolus of insulin. Isolated hepatocytes were showing
elevated fat oxidation and ketogenesis in early stages of NAFLD. A promoter of fat
oxidation, Pgc1a, was elevated in diet-induced mice. The gene involved in bringing fat
into the mitochondria for oxidation, Cpt1a, also showed an increased trend with a high
![Page 54: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/54.jpg)
54
FFA challenge as well as high nutrient supply from the diet. This is further supported
with the first step in fatty acid oxidation, Lcad, which was upregulated in TFD mice.
Ketogenesis was also upregulated in mice on a 4-week TFD, which supports previous
data (Figure 2-4). Furthermore, fibrotic (Pc1 and Mmp13) and inflammatory (Il6) genes
were upregulated in the isolated hepatocytes of TFD mice. Interleukin 6 has been
associated with pro-inflammatory cytokines, which acts to increase fat metabolism to
improve insulin resistance [48]. The 4-week in vitro study also showed elevated
mitochondrial respiration and ROS production in the TFD mice. Together, this model
system demonstrated the beginning stages of NAFLD with insulin resistance and
mitochondrial dysfunction fueling inflammatory pathways.
Our secondary aim probed the effect of a further insult to an already insulin
resistant mouse model of NASH. A previous study by our lab showed mice fed on a
TFD for 24 weeks develop steatohepatitis [25]. Body weight and liver weight increased
as expected given a high nutrient supply. Weight of the liver as well as triglyceride
content within the liver were affected only by diet and not by an acute infusion of
Intralipid. Glucose levels were elevated by a high lipid load. After a one hour fast,
plasma insulin levels showed an increasing trend in raised insulin due to Intralipid and
TFD. Elevated insulin levels were not significant enough to suppress and oxidative
metabolism within the liver. Hyperinsulinemia in NASH mice lowered glucose to the
same levels as seen in the control-fed mice. An acute Intralipid challenge caused higher
hepatocyte triglyceride secretion. The basal concentration of free fatty acids available
for energy consumption was higher in TFD versus controls. This trend was even more
apparent when the mice were given an insult of Intralipid. As the hepatocyte’s storage
![Page 55: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/55.jpg)
55
mechanisms in the form of esterified triglycerides meet a threshold, metabolism turns to
fat oxidation and secretion of triglycerides from the liver in the form of very low-density
lipoproteins. Ketogenesis was elevated in the control-fed mice due to Intralipid. At
baseline, basal ketone production is raised in TFD mice due to the high fructose high
trans-fat diet. The mitochondria were unable to adapt to a further influx of fat when
challenged with Intralipid. The inability to respond to a high FFA stimuli demonstrates
the severe insulin resistance and mitochondrial inflexibility in these NASH mice. Urea
production was not altered from diet nor lipid load. Protein expression further supported
mitochondrial dysfunction in NASH mice. Probing downstream pathways involved in
insulin signaling showed the mitochondria’s inability to upregulate insulin signaling when
challenged with an insult such as Intralipid. Gene analysis supported a new steady state
by showing upregulated genes involved in fatty acid oxidation, mitochondrial respiration,
and lipogenesis. Fat oxidation was higher in control mice when infused with Intralipid,
showing the hepatic mitochondria’s ability to adapt to a high influx of fat. NASH mice
displayed upregulated fat oxidation, but this response was blunted when challenged
with Intralipid. This is explained by the elevated increase in plasma triglycerides, as both
storage and oxidative machinery thresholds were met in these severely insulin resistant
mice. Impaired mitochondrial respiration was shown with the uncoupling protein gene
(Ucp2), where the NASH mice are unable to efficiently oxidize the high supply of FFA
from the diet. Mitochondrial stress leads to the uncoupling of oxidative phosphorylation
from energy synthesis to control ROS production [43, 57], a main contributor to the
progression of NAFLD to steatohepatitis. Lipogenesis correlation was also increased in
NASH mice, as shown by Srebp1c. In conjunction with upregulated and dysfunctional
![Page 56: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/56.jpg)
56
mitochondrial machinery, hepatocellular injury occurred in NASH mice likely from
lipotoxicity. Gene promoters of fibrosis, such as Mmp13, were upregulated from a 24-
week high fructose high trans-fat diet. Pro-inflammatory cytokines, like Tnfa and Tlr4,
were also upregulated in NASH mice. It is important to note Intralipid had an effect only
on fat oxidation (Ppara) compared to its respective control. These metabolic infusion
studies showed NASH mice had blunted compensatory mechanisms to FFA overload
and this lead to elevated inflammatory signaling.
An in vitro model system of NAFLD displayed early onset of insulin resistance
and inflammation. The design of a cellular system to study the disease will allow our lab
to tease out metabolic alterations that occur early-on in fatty liver disease. From our first
aim, we were able to show how mice on a high fructose high trans-fat diet already
showed signs of mitochondrial inflexibility. An acute 5-hour Intralipid infusion
demonstrated severe insulin resistance and mitochondrial dysfunction in a mouse
model of NASH. In spite of insulin resistance, ketogenesis managed to be upregulated
in response to greater nutrient supply, but mice with NASH had an inability to further
increase ketogenesis when challenged by an Intralipid infusion, clearly indicating a
blunted and maladaptive compensatory response to lipid overload.
Early induction of ketogenesis, despite hepatic insulin resistance in primary
hepatocytes and the blunted response of ketogenesis to Intralipid challenge in mice with
NASH, demonstrates mitochondrial inflexibility. Future studies will include measuring
flux through the TCA cycle in mice with fatty liver as well as steatohepatitis. We aim to
show an increase in TCA flux in NASH mice, contrary to Shulman’s hypothesis, along
with lipotoxic byproducts. Based on the in vitro data focusing on the electron transport
![Page 57: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/57.jpg)
57
chain, we aim to take a closer look at respiration and ROS production in mice with end-
stage liver disease. We speculate that this mitochondrial inflexibility may be an early key
defect that fosters oxidative stress, chronic inflammation, and hepatocyte injury in
NASH.
![Page 58: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/58.jpg)
58
APPENDIX SUPPLEMENTARY FIGURES
Figure A-1. Concentration of FFAs (mmol/L) over a period of 5 hours, including baseline
(0 hours). Free fatty acid levels increased by two-fold by end of infusion experiment, or to a normal physiological response to Intralipid.
![Page 59: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/59.jpg)
59
Table A-1. Primer sequences for genes analyzed with qPCR for isolated hepatocytes and liver homogenates.
Gene Name Primer Sequence (forward) Primer Sequence (reverse)
Ppib/Cyclophilin b GGAGATGGCACAGGAGGAA
GCCCGTAGTGCTTCAGCTT
Pgc1a AGACAAATGTGCTTCCAAAAAGAA GAAGAGATAAAGTTGTTGGTTTGGC
Ppara ACAAGGCCTCAGGGTACCA
GCCGAAAGAAGCCCTTACAG
Cpt1a CAAAGATCAATCGGACCCTAGAC
CGCCACTCACGATGTTCTTC
Lcad TCAATGGAAGCAAGGTGTTCA
GCCACGACGATCACGAGAT
Hmgcs2 GACTTCCTGTCATCCAGC
GGTGTAGGTTTCTTCCAGC
Ucp2 GCTTCTGCACCACCGTCAT
GCCCAAGGCAGAGTTCATGT
Cytc GAAAAGGGAGGCAAGCATAAG
TGTCTTCCGCCCGAACA
Acc1 GGACAGACTGATCGCAGAGAAAG
TGGAGAGCCCCACACACA
Fas GCTGCGGAAACTTCAGGAAAT
AGAGACGTGTCACTCCTGGACTT
Srebp1c GGAGCCATGGATTGCACATT
GGCCCGGGAAGTCACTGT
Chrebp GAAACCTGAGGCTGTCATCCT
CGTGGTATTCGCGCATCA
Pc1 ACCTGTGTGTTCCCTACTCA
GACTGTTGCCTTCGCCTCTG
Fgf21 CCTCTAGGTTTCTTTGCCAACAG
AAGCTGCAGGCCTCAGGAT
Tnfa CTGAGGTCAATCTGCCCAAGTAC
CTTCACAGAGCAATGACTCCAAAG
Mmp13 CCTTCTGGTCTTCTGGCACAC
GGCTGGGTCACACTTCTCTGG
Il6 TCGTGGAAATGAGAAAAGAGTTG
AGTGCATCATCGTTGTTCATACA
Tlr4 CACTGTTCTTCTCCTGCCTGAC CCTGGGGAAAAACTCTGGATAG
![Page 60: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/60.jpg)
60
Figure A-2. Quantification of western blot from hepatocytes on 4-week diet. Isolated
hepatocytes (N=1) were incubated overnight with low (0.2 mM) or high (0.8 mM) FFA in media. A 50 nM insulin bolus was given for 15 minutes. Insulin sensitivity was measured (p-Akt) and showed insulin resistance in mice on a TFD diet.
![Page 61: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/61.jpg)
61
Figure A-3. Plasma blood glucose levels in 24-week fed mice. Mice maintained same
glucose levels regardless of increased nutrients. An Intralipid challenge slightly raised glucose levels in the the plasma in both control and NASH mice.
![Page 62: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/62.jpg)
62
Figure A-4. Plasma urea concentrations in mice on 24-weeks of control or TFD diet. Urea production was not changed by diet nor Intralipid challenge.
![Page 63: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/63.jpg)
63
Figure A-5. Quantification of western blot from liver homogenates on 24-week diet. Insulin sensitivity was measured by probing Irs-2 and p-Akt in NASH mice when challenged with Intralipid. Mice with NASH showed severe insulin resistance when given an acute lipid load.
![Page 64: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/64.jpg)
64
LIST OF REFERENCES
1. Cusi, K., Role of obesity and lipotoxicity in the development of nonalcoholic steatohepatitis: pathophysiology and clinical implications. Gastroenterology, 2012. 142(4): p. 711-725.e6.
2. Adams, L.A., et al., The natural history of nonalcoholic fatty liver disease: a
population-based cohort study. Gastroenterology, 2005. 129(1): p. 113-21. 3. Lee, J., et al., Epigenetics in non-alcoholic fatty liver disease. Mol Aspects Med,
2017. 54: p. 78-88. 4. Poggiogalle, E., et al., Non-alcoholic fatty liver disease connections with fat-free
tissues: A focus on bone and skeletal muscle. World J Gastroenterol, 2017. 23(10): p. 1747-1757.
5. Bril, F. and K. Cusi, Management of Nonalcoholic Fatty Liver Disease in Patients
With Type 2 Diabetes: A Call to Action. Diabetes Care, 2017. 40(3): p. 419-430.9 6. Sunny, N.E., F. Bril, and K. Cusi, Mitochondrial Adaptation in Nonalcoholic Fatty
Liver Disease: Novel Mechanisms and Treatment Strategies. Trends Endocrinol Metab, 2017. 28(4): p. 250-260.
7. Galgani, J.E., C. Moro, and E. Ravussin, Metabolic flexibility and insulin
resistance. Am J Physiol Endocrinol Metab, 2008. 295(5): p. E1009-17. 8. Browning, J.D., Statins and hepatic steatosis: perspectives from the Dallas Heart
Study. Hepatology, 2006. 44(2): p. 466-71. 9. Papandreou, D., I. Rousso, and I. Mavromichalis, Update on non-alcoholic fatty
liver disease in children. Clin Nutr, 2007. 26(4): p. 409-15. 10. European Association for the Study of the Liver European Association for the
Study of Diabetes European Association for the Study of, O. 11. Podrini, C., et al., Redox homeostasis and epigenetics in non-alcoholic fatty liver
disease (NAFLD). Curr Pharm Des, 2013. 19(15): p. 2737-46. 12. Day, C.P. and O.F. James, Steatohepatitis: a tale of two "hits"?
Gastroenterology, 1998. 114(4): p. 842-5. 13. Ali, R. and K. Cusi, New diagnostic and treatment approaches in non-alcoholic
fatty liver disease (NAFLD). Ann Med, 2009. 41(4): p. 265-78. 14. Marceau, P., et al., Liver pathology and the metabolic syndrome X in severe
obesity. J Clin Endocrinol Metab, 1999. 84(5): p. 1513-7.
![Page 65: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/65.jpg)
65
15. Luyckx, F.H., et al., Liver abnormalities in severely obese subjects: effect of drastic weight loss after gastroplasty. Int J Obes Relat Metab Disord, 1998. 22(3): p. 222-6.
16. Harada, S., et al., Influence of hyperglycemia on liver inflammatory conditions in
the early phase of non-alcoholic fatty liver disease in mice. J Pharm Pharmacol, 2017.
17. Pais, R., et al., A systematic review of follow-up biopsies reveals disease
progression in patients with non-alcoholic fatty liver. J Hepatol, 2013. 59(3): p. 550-6.
18. Sun, C., J.G. Fan, and L. Qiao, Potential epigenetic mechanism in non-alcoholic
Fatty liver disease. Int J Mol Sci, 2015. 16(3): p. 5161-79. 19. Reeves, H.L., M.Y. Zaki, and C.P. Day, Hepatocellular Carcinoma in Obesity,
Type 2 Diabetes, and NAFLD. Dig Dis Sci, 2016. 61(5): p. 1234-45. 20. Charlton, M.R., et al., Frequency and outcomes of liver transplantation for
nonalcoholic steatohepatitis in the United States. Gastroenterology, 2011. 141(4): p. 1249-53.
21. Anstee, Q.M., G. Targher, and C.P. Day, Progression of NAFLD to diabetes
mellitus, cardiovascular disease or cirrhosis. Nat Rev Gastroenterol Hepatol, 2013. 10(6): p. 330-44.
22. Wong, R.J., et al., Nonalcoholic steatohepatitis is the second leading etiology of
liver disease among adults awaiting liver transplantation in the United States. Gastroenterology, 2015. 148(3): p. 547-55.
23. Sunny, N.E., et al., Excessive hepatic mitochondrial TCA cycle and
gluconeogenesis in humans with nonalcoholic fatty liver disease. Cell Metab, 2011. 14(6): p. 804-10.
24. Donnelly, K.L., et al., Sources of fatty acids stored in liver and secreted via
lipoproteins in patients with nonalcoholic fatty liver disease. J Clin Invest, 2005. 115(5): p. 1343-51.
25. Patterson, R.E., et al., Lipotoxicity in steatohepatitis occurs despite an increase
in tricarboxylic acid cycle activity. Am J Physiol Endocrinol Metab, 2016. 310(7): p. E484-94.
26. Gallego-Durán, R. and M. Romero-Gómez, Epigenetic mechanisms in non-
alcoholic fatty liver disease: An emerging field. World J Hepatol, 2015. 7(24): p. 2497-502.
![Page 66: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/66.jpg)
66
27. Wei, Y., et al., Nonalcoholic fatty liver disease and mitochondrial dysfunction. World J Gastroenterol, 2008. 14(2): p. 193-9.
28. Bellanti, F., et al., Lipid oxidation products in the pathogenesis of non-alcoholic
steatohepatitis. Free Radic Biol Med, 2017. 29. Gaggini, M., et al., Non-alcoholic fatty liver disease (NAFLD) and its connection
with insulin resistance, dyslipidemia, atherosclerosis and coronary heart disease. Nutrients, 2013. 5(5): p. 1544-60.
30. Satapati, S., et al., Elevated TCA cycle function in the pathology of diet-induced
hepatic insulin resistance and fatty liver. J Lipid Res, 2012. 53(6): p. 1080-92. 31. Finck, B.N. and D.P. Kelly, PGC-1 coactivators: inducible regulators of energy
metabolism in health and disease. J Clin Invest, 2006. 116(3): p. 615-22. 32. Satapati, S., et al., Mitochondrial metabolism mediates oxidative stress and
inflammation in fatty liver. J Clin Invest, 2016. 126(4): p. 1605. 33. Roskams, T., et al., Oxidative stress and oval cell accumulation in mice and
humans with alcoholic and nonalcoholic fatty liver disease. Am J Pathol, 2003. 163(4): p. 1301-11.
34. Baskol, G., M. Baskol, and D. Kocer, Oxidative stress and antioxidant defenses
in serum of patients with non-alcoholic steatohepatitis. Clin Biochem, 2007. 40(11): p. 776-80.
35. Krakauer, T., Inflammasome, mTORC1 activation, and metabolic derangement
contribute to the susceptibility of diabetics to infections. Med Hypotheses, 2015. 85(6): p. 997-1001.
36. Sutter, A.G., et al., Dietary Saturated Fat Promotes Development of Hepatic
Inflammation Through Toll-Like Receptor 4 in Mice. J Cell Biochem, 2016. 117(7): p. 1613-21.
37. Satapati, S., et al., Mitochondrial metabolism mediates oxidative stress and
inflammation in fatty liver. J Clin Invest, 2015. 125(12): p. 4447-62. 38. Petersen, K.F., et al., Assessment of Hepatic Mitochondrial Oxidation and
Pyruvate Cycling in NAFLD by (13)C Magnetic Resonance Spectroscopy. Cell Metab, 2016. 24(1): p. 167-71.
39. Kleiner, D.E., et al., Design and validation of a histological scoring system for
nonalcoholic fatty liver disease. Hepatology, 2005. 41(6): p. 1313-21.
![Page 67: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/67.jpg)
67
40. Puigserver, P. and B.M. Spiegelman, Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator. Endocr Rev, 2003. 24(1): p. 78-90.
41. Sajan, M.P., R.A. Ivey, and R.V. Farese, BMI-related progression of atypical
PKC-dependent aberrations in insulin signaling through IRS-1, Akt, FoxO1 and PGC-1α in livers of obese and type 2 diabetic humans. Metabolism, 2015. 64(11): p. 1454-65.
42. Prip-Buus, C., et al., Molecular and enzymatic characterization of a unique
carnitine palmitoyltransferase 1A mutation in the Hutterite community. Mol Genet Metab, 2001. 73(1): p. 46-54.
43. Macaluso, F.S., M. Maida, and S. Petta, Genetic background in nonalcoholic fatty
liver disease: A comprehensive review. World J Gastroenterol, 2015. 21(39): p. 11088-111.
44. Kawano, Y. and D.E. Cohen, Mechanisms of hepatic triglyceride accumulation in
non-alcoholic fatty liver disease. J Gastroenterol, 2013. 48(4): p. 434-41. 45. Hernandez-Rodas, M.C., R. Valenzuela, and L.A. Videla, Relevant Aspects of
Nutritional and Dietary Interventions in Non-Alcoholic Fatty Liver Disease. Int J Mol Sci, 2015. 16(10): p. 25168-98.
46. El Aidy, S., et al., Gut bacteria-host metabolic interplay during
conventionalisation of the mouse germfree colon. ISME J, 2013. 7(4): p. 743-55. 47. Palladini, G., et al., Role of matrix metalloproteinases in cholestasis and hepatic
ischemia/reperfusion injury: A review. World J Gastroenterol, 2015. 21(42): p. 12114-24.
48. Berlanga, A., et al., Molecular pathways in non-alcoholic fatty liver disease. Clin
Exp Gastroenterol, 2014. 7: p. 221-39. 49. Clapper, J.R., et al., Diet-induced mouse model of fatty liver disease and
nonalcoholic steatohepatitis reflecting clinical disease progression and methods of assessment. Am J Physiol Gastrointest Liver Physiol, 2013. 305(7): p. G483-95.
50. Trevaskis, J.L., et al., Glucagon-like peptide-1 receptor agonism improves
metabolic, biochemical, and histopathological indices of nonalcoholic steatohepatitis in mice. Am J Physiol Gastrointest Liver Physiol, 2012. 302(8): p. G762-72.
![Page 68: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/68.jpg)
68
51. Akie, T.E., et al., OXPHOS-Mediated Induction of NAD+ Promotes Complete Oxidation of Fatty Acids and Interdicts Non-Alcoholic Fatty Liver Disease. PLoS One, 2015. 10(5): p. e0125617.
52. Filhoulaud, G., et al., Novel insights into ChREBP regulation and function. Trends
Endocrinol Metab, 2013. 24(5): p. 257-68. 53. Dushay, J., et al., Increased fibroblast growth factor 21 in obesity and
nonalcoholic fatty liver disease. Gastroenterology, 2010. 139(2): p. 456-63. 54. Kohjima, M., et al., SREBP-1c, regulated by the insulin and AMPK signaling
pathways, plays a role in nonalcoholic fatty liver disease. Int J Mol Med, 2008. 21(4): p. 507-11.
55. Temple, J.L., et al., A Guide to Non-Alcoholic Fatty Liver Disease in Childhood
and Adolescence. Int J Mol Sci, 2016. 17(6). 56. Soares, J.B., et al., The role of lipopolysaccharide/toll-like receptor 4 signaling in
chronic liver diseases. Hepatol Int, 2010. 4(4): p. 659-72. 57. Fares, R., et al., The UCP2 -866 G>A promoter region polymorphism is
associated with nonalcoholic steatohepatitis. Liver Int, 2015. 35(5): p. 1574-80.
![Page 69: © 2017 Kaitlyn Abdoufdcimages.uflib.ufl.edu/UF/E0/05/12/38/00001/ABDO_K.pdf · mitochondrial oxidative metabolism in nonalcoholic fatty liver disease (nafld) by kaitlyn abdo a thesis](https://reader031.fdocuments.in/reader031/viewer/2022022718/5c5e209909d3f2dd6a8b6afd/html5/thumbnails/69.jpg)
69
BIOGRAPHICAL SKETCH
Kaitlyn Abdo was born in Coral Springs, Florida but raised in Charlotte, North
Carolina. She obtained bachelor’s degrees in biology as well as chemistry from the
University of North Carolina Wilmington, with honors in chemistry. Her undergraduate
research interests were in observing the helical structures of cytolytic and cell-
penetrating peptides. Her observations on the physical properties of these peptides
were published in Biophysical Journal on October 18, 2016. In the fall of 2015, she
started graduate research at the University of Florida under Dr. Kenneth Cusi studying
the effects of fat metabolism in NAFLD mouse models. Kaitlyn finished her master’s in
medical sciences with a minor in entrepreneurship in August 2017. She completed her
biotechnology internship in Israel the summer of 2017. Kaitlyn plans to gain more
experience in basic and clinical research before applying to medical school.