Post on 03-Sep-2021
Enterotoxin gene profiles of Staphylococcus aureus isolated from
clinical and sub-clinical isolates in Pakistan
Sadia Liaquat*, Ammara Khalid
Department of Bioinformatics and Biotechnology, Government College University
Faisalabad (GCUF), Faisalabad-38000, Pakistan
*Corresponding Author
ABSTRACT
Staphylococcus aureus is a common pathogen that colonizes and produces sickness in people
and domestic animals. It is the second leading cause of bacteremia and carries a mortality rate of
20 to 40%. S. aureus produces many toxins including enterotoxins which are critical in the
development of disease due to their super-antigenicity. Staphylococcal enterotoxins is the main
cause of staphylococcal food poisoning (SFP) resulting from ingestion of contaminated food
with preformed enterotoxins. The enterotoxins genes showed diversity among S. aureus strains
circulating around the world. To date, no comprehensive report is available related to the
prevalence of the enterotoxins in S. aureus isolates from Pakistan. Therefore, this study was
planned to investigate the distribution of enterotoxin genes among local isolates of S. aureus.
The present studies emphasized on 11 staphylococcal enterotoxins encoding genes (sea, seb, sec,
sed, see, seg, seh, sei, selJ, selP, ser). Different samples including sub-clinical (milk, dairy
products, juices and ready to eat foods) and clinical (nasal, urine, blood, stool and pus) were
collected for the isolation of S. aureus. After biochemical and molecular identification of S.
aureus isolates, the selected enterotoxins encoding genes were detected by PCR. More than
enterotoxins genes were detected in one or more local isolates of S. aureus. Overall 21 different
enterotoxin gene profiles were observed in our local isolates of S. aureus. The most prevalent
enterotoxin gene was sei (30.1%) followed by seb (15.5%), sec (13.5%), sea (12.6%), seg
(5.8%), selP (4.85%) and sed (3.88%). This study provided basic knowledge about the virulence
potential and super-antigenicity of our clinical and subclinical S. aureus isolates.
Key words: Staphylococcus aureus, enterotoxins, staphylococcal food poisoning, clinical, sub clinical
Introduction
Staphylococcus aureus is one of the common pathogen associated with severe diseases and
considered as a major public health threat around the world (Pesavento et al., 2007). Due to its
virulence potential S. aureus produces many heat stable toxins including staphylococcal
enterotoxins, exfoliative toxins and toxic shock syndrome toxins (Ferry & Etienne, 2009).
Amongst all protein toxins the most virulent toxin is Staphylococcal enterotoxins.
Staphylococcal enterotoxins have been divided into classical enterotoxins and enterotoxins like
proteins according to their serological natures (Argudín et al., 2010). Many studies have been
revealed that classical enterotoxins started from sea to see are the main cause of staphylococcal
food poisoning throughout the world (Balaban & Rasooly, 2000; Cha et al., 2006; Kérouanton et
al., 2007; Schmid et al., 2009; Veras et al., 2008; Wieneke et al., 1993). After oral administration
in primate model enterotoxins like proteins seg, seh, sei, ser, ses and set also showed the emetic
activity (Chiang et al., 2008; Omoe et al., 2005). Staphylococcal food poisoning is an
intoxication that occurs in the results of feeding contaminated foods (Jan Kluytmans et al.,
1997). Signs of the disease is vomiting, nausea, abdominal pain and diarrhea within 2-6 hours
(Balaban & Rasooly, 2000; Tranter, 1990) . Twenty two Staphylococcal enterotoxins have been
reported which cause food borne diseases in human due to the ingestion of contaminated foods
such as septicemia, food poisoning and toxic shock syndrome (Archer & Young, 1988;
Garthright et al., 1988; Olsen et al., 2000; Ortega et al., 2010; Yang et al., 2009). Staphylococcal
enterotoxins are resistant to extreme environmental condition like high temperature, high salt
concentration and high pH and proteolytic enzymes such as pepsin or trypsin (Kadariya et al.,
2014). Natural habitats of S. aureus are hands and nose, which is the major reason to spread the
food poisoning in humans through respiratory tract and improper handling (Fratamico et al.,
2005; JAJW Kluytmans & Wertheim, 2005). Uniplex PCR has been used for the detection of 11 staphylococcal enterotoxins encoding genes (sea, seb, sec, sed, see, seg, seh, sei, selJ, selP, ser)
(Blaiotta et al., 2004). The enterotoxins genes showed great diversity among S. aureus strains
circulating around the world. To date, no comprehensive report is available related to the
prevalence of the enterotoxins in S. aureus isolates from Pakistan. Therefore, this study was
planned to investigate the distribution of enterotoxin genes among local isolates of S. aureus.
Materials and Methods:
Sample collectionIn the period from September 2016 to June 2017, a total 200 samples including clinical
specimens (nasal, sputum, fluid, urine, blood, pus, semen, ear swab) and Subclinical samples
(milk, juices and ready to eat foods) were collected aseptically from various clinical laboratories
and zones of Faisalabad. Sterile release safe vessels were utilized for accumulation and
transportation of specimens and protected into 0.6 % nutrient agar in tryptic soya broth (TSB).
Isolation of S. aureusHemolysis on blood agar
All the isolates were tested for hemolysis on blood agar plate for overnight incubation at 37°C
(Ahmady & Kazemi, 2013). Blood agar plate prepared as 28 g of nutrient blood agar and 15 ml
of 5% of asceptic blood in 1 L distilled water. The results of hemolysis are recorded as α
hemolysis, β hemolysis, both α + β hemolysis and γ- hemolysis.
Mannitol salt agar plate
For confirmation of S. aureus picked up the colonies which produce β hemolysis and grow on
another media mannitol salt agar plate for overnight incubation at 37°C (Ahmady & Kazemi,
2013). Mannitol salt agar prepared as 111.1 g of mannitol salt agar powder in 1 L of distilled
water. Results of mannitol salt agar plates recorded as yellowish colonies. Then Isolates sub
cultured in tryptic soya broth (TSB).
Biochemical Identification S. aureusCatalase test
For identification of S. aureus catalase test was performed. Picked the S. aureus colonies and
dipped into the 3 % of hydrogen per oxide. If the bubbles are formed than it indicates the S.
aureus (Ahmady & Kazemi, 2013).
Coagulase test
For more identification of S. aureus coagulase test was performed. Pick up the colony of S.
aureus and mix with kit of coagulase (OXOID, UK) (Kateete et al., 2010).
DNA extraction
After isolation and identification genomic DNA was extracted using standard phenol chloroform
extraction method (Sambrook et al., 1989).
Molecular Assay
PCR amplification of 16sRNA and nuc was used as a conformational test of S. aureus (Brakstad
et al., 1992; Kateete et al., 2010). 25 ul of reaction mixture was prepared. The reaction mixture
contained 1 ul each of the nuc forward and reverse primer(5’-
GCGATTGATGGTGATACGGTT-3’and 3’AGCCAAGCCTTGACGAACTAAAGC – 5’
respectively), 16sRNA forward and reverse primer (5’- F-
AACTCTGTTATTAGGGAAGAACA-3’ and
3’- CCACCTTCCTCCGGTGATACGGTT- 5’respectively) see the Table 1 and Table 3.
Table 1: List of PCR ingredients
PCR amplification of both primers is done using Thermo cycler (BIO-RAD, Singapore) under
the optimized conditions initial denaturation at 94 °C for 5 min followed by 30 cycles and each
cycle has denaturation at 94 °C for 30 sec, annealing at 50 °C for 30 sec, extension at 72 °C at 30
Sr No PCR Reaction Ingredients Quantity per Reaction
1 10X Taq Buffer +KCl –MgCl2 2.5 µl
2 25Mm MgCl2 1.5 µl
3 2mM dNTPs 1 µl
4 Forward Primer 1 µl
5 Reverse Primer 1 µl
6 Taq Polymerase 0.2 µl
7 10 mM Tris Buffer 13µl
8 Genomic DNA as a template (diluted) 5µl
sec and final extension at 72 °C for 5 min. After amplification PCR amplicons were mixed with
2 ul of loading dye and electrophoresed in 2 % of agarose gel in TBE (Tris- Borate- EDTA)
buffer.
Polymerase chain reaction (PCR) technique was used to detect the 11 enterotoxin gene (sea, seb,
sec, sed, see, seg, seh, selJ, ser, sei, selP) see the Table 1 and Table 2 below.
Table 2 : List of enterotoxin gene primers with their product size and PCR profile
Gene Primer sequence 5’ to 3’
Annealing
Temperatur
e(C)
Pcr product
size (bps)
References
SeaF-GCAGGGAACAGCTTTAGGCR-
GTTCTGTAGAAGTATGAAACACG50 520
(Monday &
Bohach, 1999a)
Seb
F-GTATGATGATAATCATGTATCAGCAAR-
CGTAAGATAAACTTCAATCTTCAC
AT
50 625
(Salgado-Pabón
et al., 2014)
Sec F-AGATGAAGTAGTTGATGTGTATGG
R-CACACTTTTAGAATCAACCG50 or 57 451
(Mehrotra et al.,
2000)
Sed F- CCAATAATAGGAGAAAATAAAAG
R-ATTGGTATTTTTTTTCGTTC50 or 57 278
(Mehrotra et al.,
2000)
See F-TGTATGTATGGAGGTGTAAC
R-GCCAAAGCTGTCTGAG50 213
(Sharma et al.,
2000)
Ser (Chiang et al.,
F-AGATGAGTTTGGAATACCCTAT
R-CTATCAGCTGTGGAGTGCAT50 123 2008)
Seg F-GTTAGAGGAGGTTTTATG
R-TTCCTTCAACAGCTGGAGA57 198
(Bania et al.,
2006)
Seh F-CAACTGCTGATTTAGCTCAG
R-CCCAAACATTAGCACCA52 173
(Bania et al.,
2006)
Sei F-GGCCACTTTATCAGGACA
R-AACTTACAGGCAGTCCA52 328
(Bania et al.,
2006)
selJ F-GTTCTGGTGGTAAACCA
R-GCGGAACAACAGTTCTGA50 131
(Bania et al.,
2006)
selP F-TCAAAAGACACCGCCAA
R-ATTGTCCTTGAGCACCA52 396
(Bania et al.,
2006)
Nuc
F-GCGATTGATGGTGATACGGTT
R-
AGCCAAGCCTTGACGAACTAAAG
C
50 or 57 280
(Kilic et al.,
2010)
16sRNA
F-
AACTCTGTTATTAGGGAAGAACA
R-
CCACCTTCCTCCGGTGATACGGTT
50 228
(Monday &
Bohach, 1999b)
Results
Detection of Staphylococcus aureus with different phenotypic test
Blood agar and mannitol salt agar are the most common methods for isolation of S. aureus. On
blood agar plate creamy white or light yellow zones that showed beta-hemolysis and on mannitol
salt agar plate gold yellow colonies are formed. Out of 200 total isolates of S. aureus 152
samples were positive for blood agar and MSA test (76%). Catalase and Coagulase tests are
very reliable methods for identifying the S. aureus. S. aureus produces an enzyme catalase which
converts hydrogen peroxide into water and air bubbles. All MSA positive samples showed
positive results for catalase test and 69.9% showed positive results for coagulase test. Coagulase
production is identified using coagulase kit (OXIOD, UK). S. aureus secret an enzyme coagulase
which has the ability to change the soluble fibrinogen into insoluble fibrin in the plasma and clot
is formed. On molecular level 103 (67.7%) of the 152 MSA-positive Staphylococcus
aureus showed positive for nuc.
PCR based identification of Enterotoxins encoding genes
11 enterotoxins genes (sea, seb, sec, sed, see, seg, seh, selJ, ser, sei, selP) were
detected by PCR using T100TM thermal cycler (BIO-RAD, Singapore) see figure 1. Enterotoxins
genes was mostly detected in Pus samples followed by urine, milk, sputum, juices, ready to eat
foods, ear swab and stool see Table 3.
Figure 1: PCR detection of 11 enterotoxins genes
Table 3: Detection of enterotoxin gene from local isolates with respect to their source of
isolation
SampleSource
Sea seb sec sed see Ser seg seh sei selJ selP
Pus 4 7 6 1 0 0 2 0 16 0 2
Urine 6 5 5 3 0 0 0 0 8 0 2
Ear swabs
0 0 0 0 0 0 1 0 1 0 0
Sputum 2 0 0 0 0 0 0 0 3 0 0
Fluid 0 1 1 0 0 0 0 0 0 0 0
Stool 0 1 1 0 0 0 0 0 1 0 0
Milk 1 1 1 0 0 0 1 0 2 0 1
Jiuces 0 1 0 0 0 0 2 0 0 0 0
Ready toeat foods
0 0 0 0 0 0 0 0 0 0 0
DiscussionStaphylococcus aureus (S. aureus) is gram positive cocci presents in the form of grapes
like bunches and causes wide range of disease in humans (Jan Kluytmans et al., 1997). S. aureus
produces many toxins including enterotoxins which is responsible for Staphylococcal food
poisoning (Fraser & Proft, 2008). Staphylococcal enterotoxins (SEs) are the toxin which is also
known as gastrointestinal exotoxins produced by S. aureus. Staphylococcal enterotoxins (SEs)
show great resistance against high temperature, high pH and high salt concentration (Larkin et
al., 2009). This study was focused on determination of enterotoxin gene profiles of S. aureus
isolates from Faisalabad region. Total 200 samples including clinical and sub clinical samples
were collected from the different areas and clinical laboratories of Faisalabad and test for
identification of S. aureus (blood agar test, mannitol salt agar test, catalase test and coagulase
test). For molecular level S. aureus identification is done by PCR using two primers 16sRNA
and Nuclease (nuc) gene. S. aureus detected in 152 samples of 200 samples (76%) and 103
samples of 152 samples (67.7 %) gave positive results against S. aureus. The highest prevelance
in enterotoxin genes showed by the staphylococcal enterotoxins I sei (30.1%) followed by seb
(15.5%), sea (12.6%), sec (13.5%), seg (5.8%), and selP (4.85%) then sed (3.88%). Four
enterotoxins encoding genes (see, ser, seh and selJ) were not found in our local isolates of S.
aureus. The sei and seb showed the highest prevelance in different studies around the world. In
current study sei (30.1%) gene also showed the highest prevelance among all enterotoxin genes
followed by seb (15.5%). In previous studies sei gene also showed high prevelance in different
countries (Ahmady & Kazemi, 2013; Becker et al., 2003; Blaiotta et al., 2004; Chiang et al.,
2008; Jarraud et al., 1999; Jarraud et al., 2001; McLauchlin et al., 2000; Roetzer et al., 2016;
Zschöck et al., 2005). In current study according to the Table 3 sei showed highest prevelance in
pus samples followed by urine, sputum, milk, ear swab and stool. In current study other
enterotoxins genes seb, sea, sec, seg, selP and sed also detected in S. aureus isolates. Where as in
previous studies these gene also showed the prevelance in different countries (Argudín et al.,
2010; Becker et al., 2003; Chiang et al., 2008; da Silva et al., 2015; Dauwalder et al., 2006; De
Buyser et al., 2001; Jones et al., 2002; Kitamoto et al., 2009; Rall et al., 2010; Rosec & Gigaud,
2002; Wongboot et al., 2013). Out of total isolates only 23 samples of pus, 20 samples of urine,
4 samples, 3 samples of juices, 2 samples of fluids, 3 samples of stool and 3 samples of milk
give positive results to one or more enterotoxin genes. In current study see, ser seh and selJ were
not detected in our S. aureus isolates. But these genes were reported in S. aureus strains from
other countries (Argudín et al., 2010; Bianchi et al., 2014; Chiang et al., 2008; Rall et al., 2010).
Based on these detected enterotoxin encoding genes 21 virulence profiles were identified in all
studied S. aureus isolates. Enterotoxin gene was mostly detected in clinical samples as compared
to sub clinical samples. The presence of sea, seb, sec, seg, sei and selP genes in clinical and
subclinical sample is due to food handlers. As hand is the natural habitat of the S. aureus. In
many previous studies researcher find that food poisoning may be due to food handlers
(Fratamico et al., 2005; JAJW Kluytmans & Wertheim, 2005). Comparison between current
studies and previous studies focusing enterotoxins gene is that isolates of S. aureus collected
form the Faisalabad, Pakistan are less virulent than the isolates of S. aureus collected in different
countries. As see, ser, seh, selJ have no prevelance in isolates of S. aureus but these genes had a
highest prevelance in other countries rather than Pakistan. These all genes have the ability to
cause the severe staphylococcal food poisoning in humans.
Conclusion
S. aureus produces many toxins including enterotoxins which cause the food poisoning. We used
Blood agar and MSA test for the isolation of S. aureus and catalase and coagulase test used for
the identification of S. aureus in different isolates of Pakistan. This study was planned to detect
the 11 staphylococcal enterotoxins genes in local isolates of S. aureus. The conclusion of this
study is that many enterotoxins genes were detected in more than 1 staphylococcal isolates of
Pakistan. Enterotoxin genes were mostly detected in clinical isolates as compared to sub-clinical
isolates. Enterotoxins genes detected in isolates of Pakistan are less virulent than the isolates of
other countries.
Conflict of Interest
All the authors have provided consent for publications
Author’s contribution
The manuscript and all experiments were done by Ammara Khalid while Sadia Liaquat
designed the all experiments.
Acknowledgments
All the authors are gratefully acknowledge for the contribution
ReferencesAhmady, M., & Kazemi, S. (2013). Detection of the enterotoxigenic genes (sei, sej) in
Staphylococcus aureus isolates from bovine mastitis milk in the West Azerbaijan of Iran.
Comparative clinical pathology, 22(4), 649-654.
Archer, D. L., & Young, F. E. (1988). Contemporary issues: diseases with a food vector. Clinical
microbiology reviews, 1(4), 377-398.
Argudín, M. Á., Mendoza, M. C., & Rodicio, M. R. (2010). Food poisoning and Staphylococcus
aureus enterotoxins. Toxins, 2(7), 1751-1773.
Balaban, N., & Rasooly, A. (2000). Staphylococcal enterotoxins. International journal of food
microbiology, 61(1), 1-10.
Bania, J., Dabrowska, A., Bystron, J., Korzekwa, K., Chrzanowska, J., & Molenda, J. (2006).
Distribution of newly described enterotoxin-like genes in Staphylococcus aureus from
food. International journal of food microbiology, 108(1), 36-41.
Becker, K., Friedrich, A. W., Lubritz, G., Weilert, M., Peters, G., & von Eiff, C. (2003).
Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins
among strains of Staphylococcus aureus isolated from blood and nasal specimens.
Journal of clinical microbiology, 41(4), 1434-1439.
Bianchi, D., Gallina, S., Bellio, A., Chiesa, F., Civera, T., & Decastelli, L. (2014). Enterotoxin
gene profiles of Staphylococcus aureus isolated from milk and dairy products in Italy.
Letters in applied microbiology, 58(2), 190-196.
Blaiotta, G., Ercolini, D., Pennacchia, C., Fusco, V., Casaburi, A., Pepe, O., & Villani, F. (2004).
PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains
isolated from meat and dairy products. Evidence for new variants of seG and seI in S.
aureus AB‐8802. Journal of applied microbiology, 97(4), 719-730.
Brakstad, O. G., Aasbakk, K., & Maeland, J. A. (1992). Detection of Staphylococcus aureus by
polymerase chain reaction amplification of the nuc gene. Journal of clinical
microbiology, 30(7), 1654-1660.
Cha, J., Lee, J., Jung, Y., Yoo, J., Park, Y., Kim, B., & Lee, Y. (2006). Molecular analysis of
Staphylococcus aureus isolates associated with staphylococcal food poisoning in South
Korea. Journal of applied microbiology, 101(4), 864-871.
Chiang, Y.-C., Liao, W.-W., Fan, C.-M., Pai, W.-Y., Chiou, C.-S., & Tsen, H.-Y. (2008). PCR
detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types
in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. International
journal of food microbiology, 121(1), 66-73.
da Silva, S. d. S. P., Cidral, T. A., Soares, M. J. d. S., & de Melo, M. C. N. (2015). Enterotoxin-
encoding genes in Staphylococcus spp. from food handlers in a university restaurant.
Foodborne pathogens and disease, 12(11), 921-925.
Dauwalder, O., Thomas, D., Ferry, T., Debard, A.-L., Badiou, C., Vandenesch, F., . . . Monneret,
G. (2006). Comparative inflammatory properties of staphylococcal superantigenic
enterotoxins SEA and SEG: implications for septic shock. Journal of leukocyte biology,
80(4), 753-758.
De Buyser, M.-L., Dufour, B., Maire, M., & Lafarge, V. (2001). Implication of milk and milk
products in food-borne diseases in France and in different industrialised countries.
International journal of food microbiology, 67(1), 1-17.
Ferry, T., & Etienne, J. (2009). Toxin-mediated syndromes. Staphylococci in Human Disease,
1(12), 484.
Fraser, J. D., & Proft, T. (2008). The bacterial superantigen and superantigen‐like proteins.
Immunological reviews, 225(1), 226-243.
Fratamico, P., Bayles, D., Bhunia, A., & Smith, J. (2005). Molecular approaches for detection,
identification, and analysis of foodborne pathogens. Foodborne pathogens microbiology
and molecular biology, 1-13.
Garthright, W. E., Archer, D. L., & Kvenberg, J. E. (1988). Estimates of incidence and costs of
intestinal infectious diseases in the United States. Public health reports, 103(2), 107.
Jarraud, S., Cozon, G., Vandenesch, F., Bes, M., Etienne, J., & Lina, G. (1999). Involvement of
enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet
fever. Journal of clinical microbiology, 37(8), 2446-2449.
Jarraud, S., Peyrat, M. A., Lim, A., Tristan, A., Bes, M., Mougel, C., . . . Lina, G. (2001). egc, a
highly prevalent operon of enterotoxin gene, forms a putative nursery of superantigens in
Staphylococcus aureus. The Journal of Immunology, 166(1), 669-677.
Jones, T. F., Kellum, M. E., Porter, S. S., Bell, M., & Schaffner, W. (2002). An outbreak of
community-acquired foodborne illness caused by methicillin-resistant Staphylococcus
aureus. Emerging infectious diseases, 8(1), 82.
Kadariya, J., Smith, T. C., & Thapaliya, D. (2014). Staphylococcus aureus and staphylococcal
food-borne disease: an ongoing challenge in public health. BioMed research
international, 2014.
Kateete, D. P., Kimani, C. N., Katabazi, F. A., Okeng, A., Okee, M. S., Nanteza, A., . . . Najjuka,
F. C. (2010). Identification of Staphylococcus aureus: DNase and Mannitol salt agar
improve the efficiency of the tube coagulase test. Annals of clinical microbiology and
antimicrobials, 9(1), 23.
Kérouanton, A., Hennekinne, J., Letertre, C., Petit, L., Chesneau, O., Brisabois, A., & De
Buyser, M. (2007). Characterization of Staphylococcus aureus strains associated with
food poisoning outbreaks in France. International journal of food microbiology, 115(3),
369-375.
Kilic, A., Muldrew, K. L., Tang, Y.-W., & Basustaoglu, A. C. (2010). Triplex real-time
polymerase chain reaction assay for simultaneous detection of Staphylococcus aureus and
coagulase-negative staphylococci and determination of methicillin resistance directly
from positive blood culture bottles. Diagnostic microbiology and infectious disease,
66(4), 349-355.
Kitamoto, M., Kito, K., Niimi, Y., Shoda, S., Takamura, A., Hiramatsu, T., . . . Hosokawa, M.
(2009). Food poisoning by Staphylococcus aureus at a university festival. Jpn J Infect
Dis, 62(3), 242-243.
Kluytmans, J., Van Belkum, A., & Verbrugh, H. (1997). Nasal carriage of Staphylococcus
aureus: epidemiology, underlying mechanisms, and associated risks. Clinical
microbiology reviews, 10(3), 505-520.
Kluytmans, J., & Wertheim, H. (2005). Nasal carriage of Staphylococcus aureus and prevention
of nosocomial infections. Infection, 33(1), 3-8.
Larkin, E., Carman, R., Krakauer, T., & Stiles, B. (2009). Staphylococcus aureus: the toxic
presence of a pathogen extraordinaire. Current medicinal chemistry, 16(30), 4003-4019.
McLauchlin, J., Narayanan, G., Mithani, V., & O'neill, G. (2000). The detection of enterotoxins
and toxic shock syndrome toxin genes in Staphylococcus aureus by polymerase chain
reaction. Journal of food protection, 63(4), 479-488.
Mehrotra, M., Wang, G., & Johnson, W. M. (2000). Multiplex PCR for detection of genes
forStaphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1,
and methicillin resistance. Journal of clinical microbiology, 38(3), 1032-1035.
Monday, S., & Bohach, G. (1999a). Properties of Staphylococcus aureus enterotoxins and toxic
shock syndrome toxin-1. The comprehensive sourcebook of bacterial protein toxins, 2nd
ed. Academic Press, London, England, 589-610.
Monday, S., & Bohach, G. (1999b). Properties of Staphylococcus aureus enterotoxins and toxic
shock syndrome toxin-1. The Comprehensive Sourcebook of Bacterial Protein Toxins,
589-610.
Olsen, S. J., MacKinnon, L. C., Goulding, J. S., Bean, N. H., & Slutsker, L. (2000). Surveillance
for foodborne-disease outbreaks—United States, 1993–1997. MMwR CDC Surveill
Summ, 49(1), 1-62.
Omoe, K., Imanishi, K. i., Hu, D.-L., Kato, H., Fugane, Y., Abe, Y., . . . Uchiyama, T. (2005).
Characterization of novel staphylococcal enterotoxin-like toxin type P. Infection and
immunity, 73(9), 5540-5546.
Ortega, E., Abriouel, H., Lucas, R., & Gálvez, A. (2010). Multiple roles of Staphylococcus
aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic
resistance. Toxins, 2(8), 2117-2131.
Pesavento, G., Ducci, B., Comodo, N., & Nostro, A. L. (2007). Antimicrobial resistance profile
of Staphylococcus aureus isolated from raw meat: A research for methicillin resistant
Staphylococcus aureus (MRSA). Food Control, 18(3), 196-200.
Rall, V., Sforcin, J., Augustini, V., Watanabe, M., Fernandes Jr, A., Rall, R., . . . Araújo Jr, J.
(2010). Detection of enterotoxin genes of Staphylococcus sp isolated from nasal cavities
and hands of food handlers. Brazilian Journal of Microbiology, 41(1), 59-65.
Roetzer, A., Gruener, C. S., Haller, G., Beyerly, J., Model, N., & Eibl, M. M. (2016).
Enterotoxin Gene Cluster-Encoded SEI and SElN from Staphylococcus aureus Isolates
are Crucial for the Induction of Human Blood Cell Proliferation and Pathogenicity in
Rabbits. Toxins, 8(11), 314.
Rosec, J., & Gigaud, O. (2002). Staphylococcal enterotoxin genes of classical and new types
detected by PCR in France. International journal of food microbiology, 77(1), 61-70.
Salgado-Pabón, W., Case-Cook, L. C., & Schlievert, P. M. (2014). Molecular analysis of
staphylococcal superantigens. Methicillin-Resistant Staphylococcus Aureus (MRSA)
Protocols, 169-185.
Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: a laboratory manual:
Cold spring harbor laboratory press.
Schmid, D., Fretz, R., Winter, P., Mann, M., Höger, G., Stöger, A., . . . de Martin, A. (2009).
Outbreak of staphylococcal food intoxication after consumption of pasteurized milk
products, June 2007, Austria. Wiener klinische Wochenschrift, 121(3), 125-131.
Sharma, N. K., Rees, C. E., & Dodd, C. E. (2000). Development of a single-reaction multiplex
PCR toxin typing assay for Staphylococcus aureusstrains. Applied and Environmental
Microbiology, 66(4), 1347-1353.
Tranter, H. S. (1990). Foodborne staphylococcal illness. The Lancet, 336(8722), 1044-1046.
Veras, J. F., do Carmo, L. S., Tong, L. C., Shupp, J. W., Cummings, C., dos Santos, D. A., . . .
Jett, M. (2008). A study of the enterotoxigenicity of coagulase-negative and coagulase-
positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil.
International Journal of Infectious Diseases, 12(4), 410-415.
Wieneke, A., Roberts, D., & Gilbert, R. (1993). Staphylococcal food poisoning in the United
Kingdom, 1969–90. Epidemiology & Infection, 110(3), 519-531.
Wongboot, W., Chomvarin, C., Engchanil, C., & Chaimanee, P. (2013). Multiplex PCR for
detection of superantigenic toxin genes in methicillin-sensitive and methicillin-resistant
Staphylococcus aureus isolated from patients and carriers of a hospital in northeast
Thailand. Southeast Asian J Trop Med Public Health, 44, 660-671.
Yang, M., Kostov, Y., Bruck, H. A., & Rasooly, A. (2009). Gold nanoparticle-based enhanced
chemiluminescence immunosensor for detection of Staphylococcal Enterotoxin B (SEB)
in food. International journal of food microbiology, 133(3), 265-271.
Zschöck, M., Kloppert, B., Wolter, W., Hamann, H., & Lämmler, C. (2005). Pattern of
enterotoxin genes seg, seh, sei and sej positive Staphylococcus aureus isolated from
bovine mastitis. Veterinary microbiology, 108(3), 243-249.