Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot...

Veterinary Diagnostic LaboratoryIowa State University

Update on viruses affecting swine production systems

Porcine Epidemic Diarrhea Virus (PEDv)Porcine Reproductive and respiratory syndrome virus (PRRSv)

Seneca Virus A (SVA)

Pablo Pineyro, DVM, MVSc, DVSc, PhDAssistant professor, Veterinary Diagnostic and Production Animal Medicine

Iowa State University, Ames, IA

Iowa Swine DayIowa State University

June 29th, 2017

Swine Disease Topics of Interest

• Porcine Epidemic Diarrhea Virus (PEDv)

• Porcine Reproductive and respiratory syndrome virus

(PRRSv)

• Seneca Virus A (SVA)

Coronavirus

• Positive sense RNA virus

• 7 open Reading frames 4 structural proteins

• Spike protein (S gene )• Membrane (M)• Envelope (E)• Nucleoprotein (N)

http://wwwuser.cnb.csic.es/~webcoron/research.html

CoVs detectados en murciélagos son el origen de los géneros Alphacoronavirus y Betacoronavirus, y los CoVs detectados en aves son el origen de los géneros Gammacoronavirus y Deltacoronavirus (Woo et al. 2012)

Porcine epidemic diarrhea (PEDv)Porcine transmissible gastroenteritis (TGEv)Porcine respiratory coronavirus (PRCv)

Porcine Deltacoronavirus (PDCoV)

Porcine Hemagglutinating Encephalomyelitis (PHEV)

Enteric • Porcine epidemic diarrhea (PEDv)• Porcine transmissible gastroenteritis (TGEv)• Porcine Deltacoronavirus (PDCoV)

• Porcine epidemic diarrhea (PEDv)• Porcine transmissible gastroenteritis (TGEv)• Porcine Deltacoronavirus (PDCoV)

Respiratory • Porcine respiratory coronavirus (PRCv)• Porcine respiratory coronavirus (PRCv)

SNC and gastro enteric

• Porcine Hemagglutinating Encephalomyelitis (PHEV))• Porcine Hemagglutinating Encephalomyelitis (PHEV))

Clinical signs

PEDV current situation

Emergency of PEDV in the US

29/4/13 12/5/13 15/5/1310/5/13 17/5/13 21/5/13

First case description April 30May 6May 8

TGE PCR (‐)Rotavirus PCR (‐)

Pancoronavirus PCR (+)

Viral sequencingISU + NVSL

First official report of PEDV in United State

ISU sequencing = PEDV (China 2012)

ISU‐VDLSpike‐gen PCR (S‐gene)

Dr. Matt Ackermann

USDA. (SECD) Situation Report – Jun 22, 2017www.aphis.usda.gov/animal‐health/secd.

PEDV: Cumulative confirmed and presumptive PEDV positive premises since June 5, 2014

Number of Confirmed Positive Premises by Week

Material and Methods

• Inoculation and housing• Inoculation and housing• CDCD piglets• Groups separated by room

• Pigs individually housed in plastic totes

• No contact between pigs• Oro‐gastric inoculation

• 3 hrs post delivery• Challenge 1x10^3 virus• Gastric tube fed milk replacer 3x daily

• Sample collection• Sample collection• Fecal swabs

• Prior to inoculation• Every 12 hrs thereafter

• Necropsy• 12, 24, 48 and 72 hours post infection

• Necropsy samples• Colonic contents• 5 sections of small intestine

• Duodenum, proximal, mid, and distal jejunum and ileum

PEDD Clinical signs in experimentally infected animals

• 12 hrs post infection• 30% of animals• Diarrhea and lethargy

• 24, 46, 72 hrs post infection• 100% of piglets• Watery diarrhea and vomiting

dehydration, emaciation

Challenge piglets

Gross lesions

Control

Veterinary Diagnostic LaboratoryIowa State UniversityKwonil Jung, et al. 2014

Histological changes associated with PEDV infection

PEDV infects all villi and sporadically infects crypt enterocytes

Necrosis of intestinal mucosa

Atrophy of villi with attenuation, swelling or loss of epithelium on tips of villi,

lateral bridging of villi

• Severe diarrhea and vomiting• All ages affected – Older pigs less severe• No response to antibiotic treatment

• High morbidity, variable mortality• Death = 100% if < 7 d, near 100% < 10 d• Older animals survive but may grow slower, breed less

successfully, and shed virus for an extended time

• 24 hour to 4 day incubation period• Affected pigs observed very quickly• Spreads through herds very fast

PEDV Clinical signs in naturally infected animals

Dr. Matt Ackermann

Diagnostics

• PCR – ready quickly

• Immunohistochemistry

• Serology• IFA• ELISA

• No VI – virus is difficult to grow

• Bioassay to prove infectivity/viability• Time consuming• Expensive• Lacks sensitivity

Take home message

• PEDv infection

• Severe malabsorptive and maldigestive diarrhea

• Starting clinical signs at 12 hours post infection (hpi)

• Affecting 100% of piglets at 24 hpi

• Severe villi blunting and atrophy in neonate piglets

• At 12 hpi – lesions duodenum and ileum

• 24 t 72 hpi - lesions are diffuse throughout small intestine

PRRSV$664

Million USD /year

PEDV$304

Million USD /year

Dr. Holtkamp‐ ISU

Economic implication of PEDV

• Porcine Reproductive and respiratory syndrome

virus (PRRSv)

Swine Respiratory Pathogens

8% 7% 7%3% 3% 2% 2% 2% 1% 1% 1% 0.16% 0.12% 0.07% 0.01%

ENT OF RE

SPIRAT

ESSIONS

Number of Bronchointerstitial Pneumonia. Caused by PRRSV Diagnosed at ISU-VDLN

r of c

Clinical Presentations

Porcine Reproductive and Respiratory Syndrome Virus (PRRSv) Background Information

http://www.elsenburg.com/vets/prrs

Abortions Respiratory Disease

http://www.cvm.umn.edu/sdec/prod/groups/cvm/@pub/@cvmhttp://www.elsenburg.com/vets/prrs

Increase Mortality

Histological Lesions

Commercially Available

• Modified live-attenuated virus (MLV) vaccines

• Inactivated virus vaccine or killed virus vaccine (KV)

Experimental Vaccines

• Viral vector vaccines

• DNA vectors vaccines

• Subunit vaccines

Current Status and Future Direction of PRRSV Vaccine

PRRSV diagnosis

PRRS Information

2 4 26

May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May

Qtr2 Qtr3 Qtr4 Qtr1 Qtr2

2015 2016

1‐3‐4

1‐7‐4

Total cases analyzed 10401-3-4 pattern: 1441-7-4 patter: 896

PRRS MLV PCR

PCR - PRRSV BIVI MLV-likeAnimal ID Specimen Ct / Result CommentB, OF, Tube #2 Oral fluid >40 / Negative

Sequencing and Analysis - PRRSVAnimal ID Specimen Target Gene RFLP CommentB, OF, Tube #2 Oral fluid ORF5 1-3-4 Wild type

Sequence HomologyReference VirusInglevac ATP Lelystad Prime Pac Inglevac MLV FosteraPercent Identity 84.6% 62.7% 85.4% 84.8% 85.6%

NucleotideATGTTGGGGAAATGCTTGACCGCGGGTTATTACTCGCAATTGCTTTTTTTGTGGTGTATCGTGCCATTCTGTCTTGTTGCGCTCGCCAACGCCAACAACGGCAGCAGCTCTCATTTACAGTTGATTTATAACCTGACGATATGTGAGCTGAACGGCACAGATTGGCTGAACGATCATTTCAGCTGGGCGGTGGAGACTTTCGTCATCTTCCCTGCGTTGACCCACATTGTCTCTTATGGCGCCCTCACCACTAGCCATTTTCTTGACACGGTCGGCCTGATCACTGTGTCCACCGCCGGATATTATCACAAGCGGTATGTATTGAGCAGCATTTACGCTGTTTGTGCCCTGGCTGCGTTGGTTTGCTTCGCCATTAGGTTGGCGAAAAATTGCATGTCCTGGCGCTACTCGTGTACTAGATATACCAATTTTCTCCTGGACACTAAGGGCAAACTCTACCGCTGGCGGTCACCCGTCATCATAGAGAAGGGGGGTAAAGTTGATGTTGAGGGCCATTTGATTGACCTCAAAAGAGTTGTGCTTGATGGTTCCGCGGCAACTCCTGTAACCAAAGTTTCAGCGGAACAATGGGGTCGTCCTTAG

PCR Applied Biosystems - PRRSVAnimal ID Specimen US Ct / Result EU Ct / Result CommentB, OF, Tube #2 Oral fluid 25.3 / Positive >=37 / Negative

PCR has primers to MLV vaccine virusPositive indicates vaccine virus

Note:Can’t rule out wild‐type infection in addition to vaccine virus

Slide courtesy of Dr. Darin Madson

PRRS Sequencing

• Can there be more than 1 PRRS isolate within a clinical sample?• When you sequence the PCR product, which isolate do you get?• Is the most predominate (highest titered sample) sequenced?• Is that virus the issue?

• PRRS sequencing primers are close to MLV vaccine virus; preferential will sequence this virus even if there are other present

• If near somewhat equal quantities

• May need to use Next Generation Sequencing(NGS) to determine

Slide courtesy of Dr. Darin Madson

• Porcine Reproductive and respiratory syndrome virus

(PRRSv)

Swine Vesicular disease

Foot and mouth disease (FMD)

Picornaviridae, Aphthovirus

Swine vesicular disease (SVD)

Picornaviridae, Enterovirus

Vesicular Stomatis(VS)

Rhabdoviridae, Vesiculovirus

Vesicular Stomatis(VS)

Rhabdoviridae, Vesiculovirus

Vesicular exanthema of swine(VESV)

Calicivirdae, Vesivirus

Foot and Mouth Disease Swine Vesicular Disease

Vesicular ExanthemaVesicular Stomatitis

Clinical Comparison: Snout

Center for Food Security and Public Health, Iowa State University, 2011

Idiopathic vesicular disease and neonatal mortality associated (Seneca Virus A)

Introduction- Clinical Signs & Lesions

• Vesicular lesions of the snout and feet of sows, lameness• No additional lesions found on necropsy

Canning et al. 2016.

Senecavirus A in neonatal pigs

Slide courtesy of Dr. Chris Rademacher

• Piglets- death of weakness, lethargy, diarrhea, hyperemia

(Case 4) South Dakota, Finishing herd, 7/29/15. Gross findings

(Case 4) South Dakota, Finishing herd, 7/29/15. Market Pig Shedding Study

Senecavirus A diagnosis

Detection Methods

• RT‐PCR of vesicular fluid, nasal swabs, serum, oral fluids, tissue• Found in tissues with no pathologic changes

Detection Methods

• RT‐PCR of vesicular fluid, nasal swabs, serum, oral fluids, tissue• Found in tissues with no pathologic changes

• Immunohistochemistry (IHC)

• In situ hybridization (ISH)

• Virus isolation

• Electron microscopyJianqiang Zhang, et al

• ELISA

• IFA

• Virus neutralization

Detection Methods

(Case 5) Neonatal mortality in a sow farm, 9/17/15.

Reports of high neonatal morbidity and increment in mortality rate in pigs less than 7 days.

With or without diarrhea (more common with diarrhea)No significant diagnostic lesions Occasional smooth/mucoid E. Coli isolated and rotavirus detected

11 Clinically affected sows 22 piglets11 Clinically normal sows 11 piglets

18%36%

Serum Feces Tonsil

Percentage of positive sows

Clinically affetcted Clinically normal

33% 33% 33%

18%36% 27%

Serum Feces Tonsil

Percentage of positive piglets

Clinically affetcted Clinically normal

Field investigation

Detection of Senecavirus A (SVA) by RT-qPCR in a SVA-affected swine breeding farm

Senecavirus A recombinant VP1 protein ELISA sample-to-positive (S/P) IgG antibody response

Veterinary Diagnostic LaboratoryIowa State UniversitySlide courtesy of Jordan Kraft

Senecavirus A PCR Positive Cases by Farm Type

SITIVE

DATE BY WEEK

Senecavirus A PCR Positive Cases by Farm Type

Sow Growing Pig Unknown/Other

• Increment in cases of Idiopathic Vesicular Disease associate with the presence of SV-A in show and finisher pigs

• Increment in cases of PWM associated with Idiopathic Vesicular Disease in sow and associate with the presence of SV-A

• We identified a new SV-A contemporary strain genetically different from the historical SV-A US strain

Summary

• Viral mutation origin

• Host-pathogen interaction

• Predisposing factors

• Clinical, serological and viral prevalence

• Viral persistence in the environment

• Viral inactivation

Question to be answered

Thanks for your attention

Questions?

Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot...

Documents

Transcript of Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot...

Swine and The Swine Industry

+ Market Swine & Grades of Swine Megan Kay. + Objectives Identify swine classes. Define swine grades. List characteristics of ideal swine.

Enterovirus 腸病毒特報

Transgenic mouse model for the study of enterovirus 71 ... · Enterovirus 71 (EV71) is a human enterovirus species A of the genus Enterovirus within the Picornaviridae family, and

Enterovirus Reverse Transcriptase Polymerase Chain ... · PDF fileEnterovirus Reverse Transcriptase Polymerase Chain Reaction ... Microsoft PowerPoint - 10X enterovirus FAQ Sheet [Compatibility

Highly diverse population of Picornaviridae and other ... · RESEARCH ARTICLE Open Access Highly diverse population of Picornaviridae and other members of the Picornavirales,in Cameroonian

UNIVERSITI PUTRA MALAYSIA THE NUCLEOCAPSID …psasir.upm.edu.my/id/eprint/5910/1/FBSB_2005_10(1-24).pdf · berasal dari genus Enterovirus dan famili Picornaviridae. Beberapa letusan

Conserved RNA Secondary Structures in Picornaviridae Genomes · ments in seven of the currently nine genera in the family Picornaviridae. Compared Compared with previous studies we

Congenital cytomegalovirus, parvovirus and enterovirus ...

Acute flaccid myelitis associated with enterovirus-D68 ...

Enterovirus 71 and Coxsackievirus A16 3C Proteases ...library.ibp.ac.cn/html/slwj/000296253900064.pdf · spectrum antiviral activity against other members of the family Picornaviridae

PED & Swine Disease Matrix · 2019. 4. 18. · affect swine Representative virus affecting swine AASV Average Score AASV SHC Rank NPB Rank Group IV (+ssRNA)5 Picornaviridae Apthovirus

N Dengue Virus n Adenovirus n Non Polio Enteroviruses Coxsackie virus Coxsackie virus Echovirus Echovirus Enterovirus Enterovirus.

PICORNAVIRUS (Enterovirus & Rhinovirus)

Evolutionary Genetics of Human Enterovirus 71: Origin ...evolve.zoo.ox.ac.uk/.../Oliver_Pybus_files/EvolutionaryGeneticsOfEV7… · Evolutionary Genetics of Human Enterovirus 71:

Emerging Diseases in the Global Swine Herd - Symp... · Emerging Diseases in the Global Swine Herd ... Enterovirus swine vesicular disease virus Kobuvirus porcine kobuvirus Sapelovirus

Infeccion por enterovirus

Microbiologia Clinica- Presentacion Power Point Enterovirus Polio

Names for Swine : Hogs Pigs Swine Swine Industry change: Factory farms.

enterovirus manuelllllllllllllllllllll