Post on 10-May-2020
June 2015 University of Southern California Sea Grant Proposal
PROJECT TITLE: DEVELOPMENT OF DIGITAL RT-‐PCR METHODS TO QUANTIFY HUMAN-‐ASSOCIATED BACTERIOPHAGE IN STORM WATER AND COASTAL RECREATIONAL WATERS PRINCIPAL INVESTIGATORS: Joshua A. Steele, Microbiologist, Southern California Coastal Water Research Project Adam C. Martiny, Associate Professor, University of California Irvine, Director UCI OCEANS ASSOCIATE INVESTIGATORS: John F. Griffith, Principal Scientist, Southern California Coastal Water Research Project FUNDING REQUESTED: 2016-2017 $59,463 Federal/State $50,406 Match 2017-2018 $59,210 Federal/State $50,568 Match STATEMENT OF THE PROBLEM: Concentrations of Fecal Indicator Bacteria (e.g. Enterococcus, E. coli, fecal coliforms) in recreational waters are monitored to protect swimmers from exposure to waterborne pathogens. Despite these efforts, swimmers may still be at risk from exposure to pathogenic human viruses even when levels of FIB meet standards. The problem is with the indicators: FIB methods are slow, non-‐specific (i.e. they cannot distinguish the source of the contamination), and do not reliably predict the presence of human viruses in recreational water. Traditional viral indicators, such as bacteriophage, are better indicators of viral contamination, but the methods are also slow (e.g. 24 hour incubation before a result) and insensitive (i.e. low levels of bacteriophage can be missed). However, F+RNA coliphage (bacteriophage which infect E. coli and related bacteria) have been shown to distinguish between human and non-‐human associated sources of contamination based on their genotype and were better predictors of gastrointestinal illness than FIB in two recent epidemiological studies at southern California Beaches. Direct molecular assays of the F+RNA coliphage using reverse transcriptase-‐quantitative PCR (RT-‐QPCR) provide a rapid method to measure viral indicators and to track sources of microbial contamination in environmental water. In their current form (using reverse-‐transcriptase PCR), these techniques are susceptible to inhibition by organic compounds found in environmental waters and have exhibited low sensitivity to their target. Here, we propose to adapt these assays to droplet digital reverse-‐transcriptase quantitative PCR (ddRT-‐QPCR) to increase their sensitivity and decrease their susceptibility to inhibition. The adapted molecular assay will support efforts by US EPA to develop a rapid coliphage assay
INVESTIGATORY QUESTIONS:
1. Can the RT-‐QPCR assays for F+RNA coliphage be successfully adapted to digital droplet PCR and used to quantify and distinguish the 4 genogroups in southern California storm water and recreational coastal waters?
2. Can the molecular quantification F+RNA coliphage genogroups be used as a viral indicator in storm water and near shore coastal waters, i.e. will the human-‐associated coliphage correlate with pathogenic viruses in contaminated storm water and coastal waters?
3. Can the molecular quantification of F+RNA coliphage genogroups be used to distinguish human-‐associated from non-‐human associated contamination in storm water and near shore coastal waters?
MOTIVATION: Fecal indicator bacteria (FIB), such as Enterococcus are monitored to protect swimmers and surfers from potentially harmful microbial contamination in recreational waters. Beaches must be posted or closed when these indicators exceed the concentration set by state and federal law. While these bacterial indicators are predictive of health risk when there is an acute, human source of contamination (i.e. human sewage), they do not consistently predict the presence of human pathogenic viruses (Jiang et al. 2001; Noble & Fuhrman 2001; Boehm et al. 2003; Jiang & Chu 2004; McQuaig et al. 2012), or gastrointestinal illness (Colford et al. 2007). Further, they are unable to distinguish between human-‐associated and non-‐human associated sources of contamination, which can alter the risk of swimming-‐related illness (Soller 2010, 2014).
Recognizing the inadequacy of FIB as an indicator organism, the US Environmental Protection Agency (EPA) has embarked on a path to develop water quality standards for coliphage (US EPA 2015). Recent epidemiology studies conducted by our organization in cooperation with EPA in southern California (Mission Bay in San Diego, Avalon Beach on Catalina Island, and at Surfrider Beach in Malibu) found an association between F+ coliphage and gastrointestinal illness (Colford et al. 2007, Griffith et al. submitted). In the two studies in which genotyping was conducted, genotypes III (at Avalon) and III (at Malibu) were found to be significant predictors of gastrointestinal illness (Griffith et al. submitted). SCCWRP has a history of working together with EPA on development of rapid water quality measurements. Our organization was instrumental in testing and promoting the QPCR method for Enterococcus (EPA Method 1609, USEPA 2013) that was included in the 2012 Recreational Water Quality Criteria and we are currently collaborating with EPA Office of Water on coliphage.
It is not surprising that FIB do not correlate with human viruses at southern California beaches, as unless there is a sewage spill or equipment failure, our beaches are not impacted by either treated or untreated wastewater. Here, one of the most likely routes for
viruses to reach beach water is through contaminated groundwater. Unlike bacteria, waterborne viruses and bacteriophage (i.e. viruses that infect bacteria) are not as effectively filtered out as water moves through sand or soil. Further, bacteriophage are more abundant than human viruses (since their bacterial hosts are much more abundant) which makes them more attractive water quality indicators at beaches where the source is groundwater contaminated leaking infrastructure, rather than acute inputs, such as storm water pulses or direct sewage spills. F+RNA coliphage (i.e. single stranded RNA viruses infecting E. coli and related bacteria), bacteriophage infecting human-‐associated Bacteroides bacteria (e.g. Bacteroides GB-‐124 phage Ebder et al. 2007, McMinn et al. 2012), and a bacteriophage discovered from human gut microbiome metagenomes (crAssphage, Stachler & Bibby 2014) have been proposed as potential fecal indicators. The EPA is in the process of creating recreational water quality criteria using coliphages as fecal indicators in ambient waters. Towards this end, the Office of Sceince and Technology has recently published a review assessing the role of coliphages as fecal indicator viruses (USEPA 2015).
F+RNA coliphage have been used as fecal indicators to protect drinking water supplies through cultivation techniques for decades. However, the cultivation is slow (24 hours before getting a result) and does not provide any indication of source of the contamination. Molecular techniques targeting the genogroups of F+RNA coliphage can distinguish between human-‐associated (genogroups II and III) and non-‐human associated (genogroups I and IV) sources, but until recently this was performed as a post-‐cultivation step (Hsu et al., 1995; Beekwilder et al. 1996; Cole et al. 2003; Vinje et al. 2004; Long et al. 2005; Stewart-Pullaro et al. 2006), requiring additional time to result. Recently, direct molecular quantification (through reverse transcription-‐ quantitative PCR i.e. RT-‐QPCR) of the F+RNA coliphage genogroups from environmental sources has been developed and used as a source-‐tracking tool (Orgozaly & Gantzer 2006, Orgozaly et al. 2009, Wolf et al. 2008, 2010, Friedman et al. 2009, 2011, Paar II et al. 2015, Vergara et al. 2015). This method is rapid, with the potential of producing results within 4 hours from sample collection, and specific, identifying genogroups I-‐IV. In addition to the long incubation time many bacteriophage cultivation techniques are relatively insensitive. Because bacteriophage abundance is variable and phage can go undetected by culture methods, requiring non-‐quantitative enrichment in order to enhance detection. Molecular quantification of bacteriophage directly from environmental waters avoids the lengthy cultivation process and, in the case of F+RNA coliphage,. However, the difficulty of effectively capturing coliphage from environmental water and amplifying their signal in the frequent presence of inhibitory substances such as humic acids makes this kind of measurement difficult.
Digital droplet PCR (ddPCR) has the potential to overcome some of the problems associated with PCR inhibition and provides absolute quantification even at low target concentrations. Unlike qPCR, which has been the most popular method for quantifying molecular targets for many years, ddPCR does not depend on cycle threshold and comparison to a dilution series of reference standards for quantification. Rather, ddPCR
utilizes dilution of the target to 1 copy per droplet, followed by amplification, and then counting and quantification using Poisson statistics to determine the number of gene copies. This technique both eliminates the need for a standard curve and combats inhibition because the cycle at which the fluorescent signal appears is no longer relevant for quantification. Droplets with any positive signal are counted as 1’s and those without, as 0’s regardless of the cycle at which they appear. In addition, because of the digital nature of the data, multiple wells can be run concurrently from the same sample and the results combined, raising sensitivity and eliminating the limitations associated with qPCR where one may only use a small fraction of the DNA extracted from a sample in each reaction.
Current epidemiology and Quantitative Microbial Risk Asessment (QMRA) studies in San Diego and a QMRA studies in the Port of Los Angeles at inner Cabrillo Beach will also provide a direct link to water quality measurements and human health outcomes and enable us to test the relationship of the F+RNA coliphage to pathogens and to FIB on the same samples. Inclusion of F+RNA phage digital RT-‐QPCR assays will enhance both projects and provide a comparative analysis of the utility of the assay as a predictor of illness in swimmers and as a fecal source tracking tool.
GOALS AND OBJECTIVES:
A. Overall Goals Our goals are to further EPA efforts to develop rapid, sensitive bacteriophage assays for water quality monitoring and as source identification tools in coastal recreational watersheds. Specifically we aim to 1) to develop a sensitive, robust droplet digital RT-‐PCR assay to measure and distinguish human-‐associated and non-‐human-‐associated F+RNA coliphage genogroups; and 2) apply this assay as microbial source tracking tool in coastal recreational waters and storm waters.
B. 2016-2017 Objectives
As stated above our overall aim is to develop an assay targeting F+RNA coliphage as a viral indicator in coastal watersheds and stormwater. Specifically our objectives are to 1) Adapt RT-‐QPCR methods for F+RNA coliphage genogroups to droplet digital RT-‐PCR; 2) Collect stormwater and nearshore coastal waters suspected of microbial contamination and capture viruses; 3) Apply the droplet digital RT-‐PCR assay as a human and non-‐human associated microbial source tracker in stormwater and recreational coastal waters likely to be impacted by microbial contamination.
METHODS:
We will develop and test sensitive (potentially detecting a single gene copy) and robust (resistant to PCR inhibition) droplet digital RT-‐PCR methods adapted from recently developed RT-‐QPCR assays applied to wastewater and environmental samples (e.g. Wolf et
al. 2010,, Paar III et al 2015, Vergara et al. 2015). These assays can distinguish multiple F+RNA coliphage genotypes at once by targeting shared coat protein and RNA replicase genes. Duplexing the digital RT-‐QPCR assay will allow for two targets to be detected in one reaction, doubling the information from a given sample. Because it was designed as a multiplex assay in environmental samples and sewage, we are planning to adapt the set of primers and probes from the viral tool box of Wolf et al. (2010) shown in Table 1. Although there are other primer sets for F+RNA coliphage (e.g. primer and probe sets developed by Friedman et al. 2011 and recently employed in environmental samples by Paar III et al. 2015, Vergara et al. 2015), we chose the Wolf et al. primer set due to the optimization of Wolf et al. for multiplexing and the potentially broader range for F+RNA phage GIII. After conversion of the RNA in the sample to complementary DNA using reverse transcriptase, the complementary DNA will be quantified via droplet digital PCR. The multiplexed primers and probes can all be amplified at the same temperatures dissociation at 95°C 15s, annealing/extension at 59°C 60s for 45 cycles. Cultivable bacteriophage (e.g. MS2 for GI, GA for GII, Qβ for GIII, or HB for GIV) will be used as positive controls and for optimization during the development of the ddRT-‐QPCR assay. We expect that we will maintain similar specificity (i.e. amplifying only the intended genogroup) and will increase the sensitivity (i.e. lower the limit of detection) compared to the RT-‐QPCR assay. In order to account for potential inhibitory compounds found in environmental samples (e.g. humic acids, phenolic compounds), we will conduct both spike-‐dilution tests, and use an internal amplification control (following Friedman et al. 2011). This, in addition to the RT control, will enable us to determine robustness of the ddRT-‐PCR assay. We have found in previous studies that the nature of the small-‐volume ddPCR itself tends to be robust to inhibition. The reactions will be placed into droplets generated on the BioRad ddPCR system, run on BioRad CFX thermocyclers and read in the BioRad QX-‐100 or QX-‐200 digital droplet reader. The reagents and equipment have been previously tested by SCCWRP and represent the state-‐of –the-‐art for droplet digital PCR (Cao et al. 2015, Steele et al. 2015, in prep). In addition to this technology, SCCWRP is collaborating with Arizona State University and the Monterey Bay Aquarium Research Institute to develop an automated sampler and field-‐worthy droplet digital PCR platform. The proposed assays would be ideal for adaptation and testing on the field platform for microbial source-‐tracking studies. The adaptation and testing will likely require the first half of the year 1 to complete. Once we are assured that the assay is performing satisfactorily, we will apply the assay to quantify F+RNA coliphage genotypes in fresh and archived samples
F+RNA phage
Genogroup Primer Name Forward Primer Reverse Primer Probe
GI FphGI GTCCTGCTCRACTTCCTGT
ATGGAATTSCGGCTACCTACA
CGAGACGCTACCWTGGCTATCGC
GII FphGII ACCTATGTTCCGATTCASAGAG
GGTAGGCAAGTCCATCAAAGT
CACTCGCGATTGTGCTGTCCGATT
GIII FphGIII (MX1)
TTTGAGGCTRTGTTGCGACA
CCGTGGSGTACACTCTTG
CGGYCATCCGTCCTTCAAGTTTGC
GIII FphGIII (Qβ)
CCGTCCGTTGAGGGTATGTT
CGAGGSGTACACGCTTG
CGGYCATCCGTCCTTCAAGTTTGC
GIV FphGIV AAGACWGGTCGGTACAAAGT
ARCTTCACCTCGGGAAKTC
CCGGATGAAGGCACTGTCCTGAATC
We will begin collecting samples from storm water, estuaries, and marine waters in the coastal zone in Southern California while the adaptation of the RT-‐QPCR to digital PCR is underway. Thus, we plan to collect samples during the first 18 months of the project. This will give us both wet and dry seasons to collect storm water and beach water. We will target 5 locations throughout southern California likely to suffer from aging, leaky infrastructure including watersheds in San Diego, Orange County, and Los Angeles County. We anticipate collecting storm water samples from San Diego and Malibu, near-‐shore beach samples from beaches in the City and County of San Diego, Doheny State Beach, and Newport Beach (in Orange County), and Inner Cabrillo Beach, and Malibu (Los Angeles County).
Doheny State Beach and Newport Beach are at the end of urbanized watersheds. Newport Back Bay is less urbanized, but still has a profound urban influence that ends in a wetland, water treatment ponds to reduce nutrients, and a small marina. These locations are all near to UC Irvine and SCCWRP’s laboratory and will be easily accessible. An ongoing study of surfer wet weather epidemiology, water quality and quantitative microbial risk assessment in San Diego in one large, urbanized watershed, and one small, urbanized watershed at SCCWRP is directly measuring pathogens, but virus samples can be collected and archived for F+RNA coliphage analysis. The Martiny lab conducts regular sampling for phytoplankton, bacteria, and viruses, in the near shore ocean off of Newport Beach, which is influenced by Orange County and South Los Angeles County watersheds. Samples of opportunity alongside the Bight ’13 wet and dry weather stormwater sampling in Malibu
Table 1. Primers and Probes from Wolf et al. 2010 used for multiplex digital RT-QPCR
and the upcoming Inner Cabrillo Beach water quality and QMRA study (in the heavily urbanized port of Los Angeles) which SCCWRP is beginning this year. Malibu, a less urbanized but frequently contaminated watershed, and Doheny State Beach have both been the focus of earlier epidemiology and microbial source tracking studies (Griffith et al. submitted). We also have access to archived virus samples from epidemiology and water quality studies collected during 2008-‐2015 from Malibu, Avalon, Doheny State Beach, and San Diego which can be used for F+RNA coliphage assay application. Viral samples from Newport Beach, Newport Back Bay, and Doheny will also be collected and tested on the automated sampler and portable ddPCR system being developed by the Monterey Bay Aquarium Research Institute, Arizona State University, and SCCWRP. The adapted ddRT-‐PCR assay will be tested on the new instrument to gauge the feasibility of automating viral indicators and RT-‐PCR on the portable digital PCR instrument.
Samples at all sites will be taken in duplicate. For large volume samples we will concentrate the viruses using a 30 kDa hollow fiber filter with a foam elution from InnovaPrep (recently tested on environmental samples at SCCWRP, Fig 1). For small volume samples we will use the alumina coated nanoCeram filters (Li et al. 2010; Ikner et al. 2011) or multi-‐cellulose ester type HA filters (after Katayama et al. 2002) both of which capture viruses by electrostatic charge. For the type HA filters, water samples will be amended with MgCl2 and acidified to pH 3.5 to allow viruses to adsorb to the filter membrane and then be directly extracted (Conn 2012, Katayama et al. 2002). For the nanoCeram filters, the viruses will adsorb to the nano-‐aluminum coating and be eluted by a solution of phosphate buffered saline at pH 9.3, with 0.1% NaPP and 0.05M glycine (Ikner et al 2011). Once viruses are captured they will either be preserved and stored in RNAlater or flash frozen in liquid N2 and stored at -‐80°C until extraction. These virus capture techniques performed well in a recent comparison of virus recovery from stormwater,. HA filters showed the highest recovery at a low (105 phage gene copies per L), and InnovaPrep showing the most consistent recovery with large (20L) volume samples. The filters or the concentrates will be extracted using MoBio environmental virus kit with mechanical lysis using glass beads, β-‐mercaptoethanol and a phenol:chloroform:isoamyl alcohol extraction. A standard RNA extraction control (e.g. Mouse Lung β-‐actin RNA) will be added to each sample (after Conn et al. 2012). All RNA work will use cleaned dedicated lab space (e.g. prep-‐stations or hoods) and cleaned, dedicated pipets to avoid contamination with enzymes that would degrade the RNA in the samples.
All data generated by the project will cleaned, formatted, and be made publicly available through the California Environmental Data Exchange Network, or on SCCWRP’s website. In addition, the publications will be open-‐access and data and protocols generated by this project will be housed on a publicly accessible website either in an open sharing site such as GitHub. Water quality data collected by SCCWRP is routinely incorporated into public databases including the California Environmental Data Exchange Network (CEDEN) which combines sample location, date, and water quality information and other metadata.
RELATED RESEARCH: While there has been no human-‐associated bacteriophage research funded recently by USC Sea Grant, there have been prior Sea Grant projects that examined the relationship of fecal indicator bacteria (FIB) and pathogenic microorganisms including bacteria and viruses. Prior research by Jones and Fuhrman examined the fate and dispersal of pathogens in stormwater at Southern California Beaches, and will inform this study. This work on transport will also provide a means to extend the current research beyond the sites that we are able to test and provide necessary context for the proposed research. Development of
Figure 1. Percent recovery of bacteriophage MS2 (F+RNA Coliphage GI) from three different virus capture filtrations. Data from (Steele et al. 2015, in prep.). The recovery is shown as a percent of the bacteriophage MS2 quantity spiked. The high concentration contained 108 phage gene copies per L and the low concentration contained 105 phage gene copies per L.
Percen
t Recov
ery
0
10
20
30
40
50
60
70
80
HA NanoCeram InnovaPrep
High Concentration
Low Concentration
Filter TypeFilter Type
molecular assays for viruses have been funded in the past by USC Sea Grant in research performed by SCCWRP and USC including hepatitis A virus assays (research to J.F. Griffith) and enterovirus assays (Noble et al. 2003, Fuhrman et al. 2005) in coastal water and storm water. Research on the correlation between human enteric viruses and FIB by Noble and Fuhrman was crucial to understanding the limitations of FIB and exploring the behavior of viruses as the basis for rejecting the links between FIB and pathogens in beach water (Noble & Furhman 2001, Fuhrman et al. 2005). The proposed work will add to the physical oceanography and molecular assays performed as USC Sea Grant projects. We note that while there is unlikely a direct connection, the Sea Grant studies by Shipe and Sanudo-‐Wilhelmy looking at nutrient and metal inputs and their effect on phytoplankton, along with the harmful algal bloom research are related in that the proposed research would be able to identify likely sources of nutrient and pathogen contamination; particularly at locations with groundwater seeping into the beach, contaminated by leaky infrastructure. Current research at the Southern California Coastal Water Research Project is complementary to the proposed research. Two ongoing studies are using source identification and direct pathogen quantification to inform a Quantitative Microbial Risk Assessment of urbanized coastal and harbor waters. The Surfer Health Study in San Diego is currently pairing health outcomes during wet weather events to water quality measurements using fecal indicators, direct measurement of pathogens by ddPCR, and the microbial source identification for QMRA. A separate QMRA study will begin this year to measure the water quality, quantify pathogens, and predict risk at Inner Cabrillo Beach in Los Angeles Harbor. SCCWRP also coordinates the Southern California Bight Montioring Program acting as the source of QPCR standards and the data analysis clearing house for microbial measurements using QPCR. SCCWRP also performs sampling at 5 sites in watersheds in Northern Los Angeles County.. SCCWRP is also collaborating with the Monterey Bay Aquarium Research Instititue and Arizona State Unviersity to develop an automated environmental sampler for microbial samples (including viruses) and a portable, field-‐based droplet digital quantitative PCR machine. This research will enable SCCWRP to add capabilities to this project and make a wider comparison between quantitative molecular assays for microbial source tracking. Combining the proposed F+RNA phage digital PCR assays with the bight samples, and to other archived samples where available, will also allow for correlation to earlier cultivation assays and other pathogen and FIB measurements
SCCWRP recently coordinated a 27-‐laboratory comparative study of 41 microbial source-‐tracking assays referred to collectively as the Source Identification Protocol Project (SIPP; Boehm et al. 2013) and specifically investigated virus and coliphage assays in 13 labs. Although pathogenic viruses and F+RNA coliphage genotypes were analyzed, the coliphage assays relied on cultivation prior to genotyping. (Harwood et al. 2013). SCCWRP has also been at the forefront of developing rapid molecular methods for microbial water quality and has developed many bacterial and viral assays over the past 15 years, collaborating with the US EPA and leading academic laboratories including development of pathogenic virus assays (e.g. Gregory et al. 2011, Love et al 2014), pathogenic bacteria assays (e.g. Lu et al. 2012), and molecular indicator methods targeting functional genes and fecal indicator bacteria (e.g. Johnston et al. 2010, Converse et al 2012). The microbiology department at
SCCWRP has developed digital PCR assays for Enterococcus and a human-‐specific Bacteroides marker (HF183) and applied them to water quality analysis in the Bight Monitoring Program (Cao et al. 2015). In addition, SCCWRP is in the process of adapting human adenovirus, human norovirus, murine norovirus, and coliphage MS2 to digital PCR (Cao et al. in prep, Steele et al 2015, in prep). The proposed research would add another tool to the cultivation independent source identification toolbox and provide a rapid viral indicator that can be used for source identification. In collaboration with other groups at UCI and USC, the Martiny lab manages a time-‐series MiCRO (Microbes In the Coastal Region of Orange County) at Newport Pier (Allison et al., 2012). This time-‐series is located in conjunction with a SCCOOS automatic shore station and includes continuous measurements of salinity, temperature and chlorophyll as well as weekly samples of dissolved and organic nutrients, bacterial and phytoplankton counts using flow cytometry, DNA measurements of bacterial diversity and various extra cellular enzyme activites. The Martiny lab also examines the molecular analyzes of bacterial diversity in the broader region of Orange County and have a large collection of DNA samples that can be used in this project. The Martiny lab also has ample experience with complex molecular analyses and harbors extensive equipment for the proposed work. Coliphage plaque assays have been a part of EPA standard methods 1601 and 1602 for recreational water quality for over a decade (EPA 2001a,b) and have been found to be useful indicators of viruses in environmental waters (LeClerc 2000). The US Environmental Protection Agency has recently announced that it is reviewing F+RNA coliphage (including direct quantification via RT-‐QPCR) as a fecal viral indicator of water quality and will incorporate coliphage assays into the new water quality criteria (EPA 2015). Earlier genotyping work was performed on cultivated coliphage plaques as a secondary identification step (Hsu et al., 1995; Beekwilder et al., 1996;; Vinje et al., 2004). Further genotyping work has shown that genogroups I and IV are more associated with non-‐human E.coli sources, i.e. animal fecal material, and genogroups II and III are more often associated with human E. coli sources i.e. fecal material (Cole et al., 2003; Long et al., 2005; Stewart-Pullaro et al., 2006). Direct quantification of the coliphage genogroups without cultivation has been developed to get around limitations of cultivation methods and to compare coliphage indicators to pathogenic virus measurements through methods such as RT-‐PCR line blots (Love et al. 2008) or RT-‐QPCR (Kirs and Smith, 2007; Ogorzaly and Gantzer, 2006, Orgozaly et al. 2009 Wolf et al., 2008, 2010, Flannery et al. 2013, Paar III et al. 2015, Vergara et al. 2015). US EPA has also developed assays to identify genogroups I-‐IV from both cultivated F+RNA coliphage (Friedman et al. 2009, 2011) and directly quantifying them from environmental RT-‐QPCR (Paar III et al. 2015) as well. However, these molecular assays have rarely been applied to in California coastal waters and only a few have been applied to California estuaries and watersheds. The proposed work will not only adapt the method to a new molecular technology, but will also be the first to apply these molecular methods widely to Southern California stormwater and coastal waters.
BUDGET-RELATED INFORMATION:
A. Budget Explanation/Detailed Justification $109,869 is requested ($59,463 Federal and $50,406 matching) for the first year and $109,778 is requested ($59,210 Federal and $50,568 matching) for the second year to perform the proposed research. SEA GRANT TRAINEE One Sea Grant Trainee is requested for the 2-‐year duration of the proposed research for 9 months at 50% time (4.5 months) each year. The Sea Grant Trainee will be a graduate student at UC Irvine and is expected to perform the bulk of the lab work after training by the PIs and SCCWRP staff, The Sea Grant Trainee will get assistance from SCCWRP staff and the Principal and Associate Investigators in planning, sample collection, processing, data analysis and manuscript preparation. Southern California Coastal Water Research Project Budget Justification SALARIES AND WAGES Salary support is requested for Dr. Joshua Steele. As the PI, Dr. Steele will be responsible for project planning and management of the study. Also, Dr. Steele will oversee data analysis and publications along with the mentoring of the Sea Grant Trainee. Dr. Steele will spend one month annually on this study at a starting base salary of 78,960. Salary support is also requested for Dr. John Griffith who will be responsible for project planning, mentoring the Sea Grant Trainee, contribution to data analysis and manuscript preparation. Dr. Griffith will spend two weeks annually on the study at a starting base salary of $124,848. Salary equivalent to 2.25 months annually for lab technicians to collect samples is also included. EMPLOYEE BENEFITS Fringe benefits for SCCWRP employees are calculated at 52.2% of the base salary rate. MATERIAL AND SUPPLIES Materials and supplies are requested at $26,000 for year 1 ($18000 Federal and $8000 match) and $20,000 ($15000 Federal and $5000 match) in year 2. This includes $12,000 in ddPCR, QPCR, and reverse transcriptase reagents and supplies, primers and fluorescent Taqman probes, $8000 in sample collection and filtration supplies, $2000 for coliphage cultivation positive controls, E.coli hosts, and media, and $4000 for dedicated pipets for RNA-‐work, and lab expendables such as pipet tips, DNAse and RNAse-‐free water, lo-‐bind tubes for nucleic acid storage.
TRAVEL Travel support is requested at $6000 ($3000 Federal $3000 match) in year one and $4000 ($3000 Federal; $1000 match in year two) for sample collection at potentially contaminated beaches as outlined in the methods, this will allow for mulitple collection
trips to 6 southern California beaches (Malibu, Avalon, Inner Cabrillo Beach, Doheny State Beach, San Diego) and transportation of the samples back to the lab at UC Irvine or SCCWRP on ice (if live) or on dry ice (if captured on filters or concentrated). The average travel cost per collection trip is $584, including gas, vehicle use fees or rentals, ice, coolers, dry ice, and food costs for the sampling trip. Annual travel support is requested for the PI to travel to a national meeting (e.g. ASM) to present the results from the project. The projected costs for the meeting are $1500 for each meeting (~$400 flight, ~$500 registration, $400 hotel and $200 for meals). PUBLICATION COSTS Costs for page fees, figure fees and open access publications are requested ($0 federal, $3000 match). INDIRECT COSTS Indirect costs are calculated using SCCWRP’s federally approved indirect rate of 86.94% exclusively on wages and benefits only. No indirect costs are added to supplies or travel funds.
University of California Irvine Budget Justification SALARIES AND WAGES Two weeks of summer salary is requested for PI Adam Martiny each year. He will be responsible for project planning, mentoring the graduate student, contribute to the data analysis, and writing the papers. Actual salary rate was used. A 2% cost of living increase was applied to each period of this proposal as well as an 8% merit increase, where applicable. EMPLOYEE BENEFITS The composite benefit rate for PI Adam Martiny is 12.7%. The composite benefit rates are agreed upon by the University of California and the UC Office of the President. TRAVEL Annual travel support is requested for the PI and graduate student to travel to a national meeting (e.g., Ocean Sciences or ASM) to present the results from the project. The projected costs are $1500 for each meeting (~$400 flight, ~$500 registration, $400 hotel and $200 for meals). INDIRECT COSTS Facilities and Administrative costs were estimated in accordance with UCI’s approved indirect cost rate agreement. The 54.5% indirect cost rate effective 7/1/11 was used based on the nature of the work proposed. UCI’s indirect cost rate agreement was approved by DHHS, the Federal Cognizant Audit Agency for UCI on 4/27/11.
B. Matching Funds
SCCWRP will match $50,406 in the first year and $50,568 in the second year of the proposed research. The match will come from internal funding for adapting the F+RNA coliphage digital RT-‐QPCR Assay ($40,000) this will be used for salary, benefits, travel, sample collection and processing, and supplies. In addition, $60,974 in sample collection, processing, nucleic acid extraction, lab supplies, travel, and in kind salary will be matched from three ongoing grants as follows: $20,000 from the Wet Weather Epidemiology grant from the City and County of San Diego to SCCWRP and it has extensive field research in San Diego County. $25,000 will be used from the Inner Cabrillo Beach QMRA Study and $10,974 will be used from the Automated Digital PCR study which are California State Clean Beach Initiative Grants and have extensive field research and sampling components. Adding extra sample collection and processing in support of this project will help . While not exclusively used for this project, and thus not included in matching, we note that this project is possible due to the droplet digital PCR machine, PCR-‐clean hoods, and biosafety cabinets in the laboratories at SCCWRP.
ANTICIPATED BENEFITS: This rapid, sensitive detection of fecal indicator viruses will further efforts by EPA to develop coliphage as a water quality indicator for microbial monitoring, used as a source tracking tool by marine beach managers and water quality regulators, and should also inform stormwater agencies and sanitation agencies trying to prioritize infrastructure maintenance along heavily developed and populated beaches. This project will also serve as a West Coast case study for EPA’s efforts to develop criteria for ambient water quality standards using coliphage. We note that epidemiology studies done at Doheny State Beach, Avalon, Malibu, Ocean Beach and Tourmaline Surfing Park will also provide a link to beachgoer health and a broader context for these results that will interest public health agencies. Visitors to the beaches, surfers, and swimmers will also benefit from a greater understanding of the beach water quality. Environmental advocacy and citizen science groups such as the Surfrider Foundation (see attached letter from CEO Chad Nelsen) will also benefit from the assay and source tracking results. The droplet digital RT-‐PCR protocols will be available for academic institutions, private, and public environmental research in water quality. SCCWRP will also provide training in the capture, extraction, and molecular quantification of F+RNA coliphage using ddPCR to academic and public environmental labs. The research will provide support and training in environmental microbiological research and cutting edge molecular analyses for a graduate student (Sea Grant Traineeship) at UC Irvine advised by A. Martiny; and will also provide research support for an early career scientist (J. Steele).
COMMUNICATION OF RESULTS:
The new OCEANS Initiative at UC Irvine lead by PI Martiny has a mission to promote interdisciplinary research to understand and improve California ocean health. It will provide a platform to inform and educate the public in Southern California and communicate with the broader scientific community. SCCWRP can communicate this information directly to decision makers in California, and is a leader in implementing new technologies and scientific methods for microbial beach water quality. This research will be presented to the SCCWRP Commission and Commission Technical Advisory Group with members from the Southern California Wastewater and Stormwater Agencies, the State and Southern California Regional Water Resources Agencies, the California Ocean Protection Council and California Ocean Science Trust, EPA Region IX. Co-‐PIs, Associate Investigator, and the Sea Grant Trainee will have opportunities to address the State Water Resources Control Board Beach Water Quality Working Group and the Surfrider Foundation. The trainee and Co-‐PIs will also be encouraged to communicate with the EPA and stormwater, sanitation, and environmental agencies outside of California through such venues as the UNC Water Microbiology Conference. REFERENCES: Allison, SD, Chao, Y, Farrara, JD, Hatosy, SM and AC Martiny. Fine-‐scale temporal variation in marine ectoenzymes of coastal southern California. Front. Microbio. 2012. Beekwilder, J., Nieuwenhuizen, R., Havelaar, A.H., vanDuin, J., 1996. An oligonucleotide hybridization assay for the identification and enumeration of F-‐specific RNA phages in surface water. J. Appl. Bacteriol. 80 (2), 179–186.
Boehm, A.B., Fuhrman, J.A., Mrse, R.D., Grant, S.B., 2003. A tiered approach for the identification of a human fecal pollution source at a recreational beach: Case study at Avalon Bay, Catalina Island, California. Environmental Science and Technology 37, 673e680.
Boehm, A.B., Van De Werfhorst, L.C., Griffith, J.F., Holden, P.A., Jay, J.A., Shanks, O.C., Wang, D., Weisberg, S.B., 2013. Performance of forty-‐one microbial source tracking methods: A twenty-‐seven lab evaluation study. Water Research 47: 6812–6828.
Cao, Y., Raith, M.R., J.F. Griffith. 2015. Droplet digital PCR for simultaneous quantification of general and human-‐associated fecal indicators for water quality assessment. Water Research 70:337-‐349 Cole, D., Long, S.C., Sobsey, M.D., 2003. Evaluation of F+ RNA and DNA coliphages as source-‐specific indicators of fecal contamination in surface waters. Appl. Environ. Microbiol. 69 (11), 6507–6514.
Colford Jr., J.M., Wade, T.J., Schiff, K.C., Wright, C.C., Griffith, J.G., Sandhu, S.K., Burns, S., Hayes, J., Sobsey, M., Lovelace, G., Weisberg, S.B., 2007. Water quality indicators and the risk of illness at non-‐point source beaches in Mission Bay, California. Epidemiology 18, 27e35.
Conn, K.E., Habteselassie, M.Y., Denene Blackwood, A., Noble, R.T., 2012. Microbial water quality before and after the repair of a failing onsite wastewater treatment system adjacent to coastal waters. Journal of Applied Microbiology 112 (1), 214–224. Converse, R.R., Griffith, J.F., Noble, R.T., Haugland, R.A., Schiff, K.C., and S.B. Weisberg. 2012. Correlation between quantitative PCR and culture-‐based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches. Applied and Environmental Microbiology 78: 1237-‐1242 Ebdon, J.; Muniesa, M.; Taylor, H. The application of a recently isolated strain of Bacteroides (GB-‐124) to identify human sources of faecal pollution in a temperate river catchment. Water Res. 2007, 41 (16), 3683−3690.
Flannery J, Keaveney S, Rajko-‐Nenow P, O'Flaherty V, Doré W (2013) Norovirus and FRNA bacteriophage determined by RT-‐qPCR and infectious FRNA bacteriophage in wastewater and oysters. Water Res 47:5222–5231 Friedman SD, Cooper EM, Casanova L, Sobsey MD, Genthner FJ (2009) A reverse transcription-‐PCR assay to distinguish the four genogroups of male-‐specific (F+) RNA coliphages. J Virol Meth 159:47–52 Friedman SD, Cooper EM, Calci KR, Genthner FJ (2011) Design and assessment of a real time reverse transcription-‐PCR method to genotype single-‐stranded RNA male-‐specific coliphages (Family Leviviridae). J Virol Meth 173:196–202 Fuhrman, J.A., Liang, X.L., Noble, R.T., 2005. Rapid detection of enteroviruses in small volumes of natural waters by real-‐time quantitative reverse transcriptase PCR. Applied and Environmental Microbiology 71 (8), 4523e4530.
Griffith, J.F., Weisberg, S.B., Arnold, B.F., Cao, y., Schiff, K.C., and Colford, J.M. submitted Epidemiologic evaluation of alternate microbial water quality indicators at three California Beaches. Water Research Harwood VJ, Boehm AB, Sassoubre LM, Vijayavel K, Stewart JR, Fong T-‐T, Caprais M-‐P, Converse RR, Diston D, Ebdon J, Fuhrman JA, Gourmelon M, Gentry-‐Shields J, Griffith JF, Kashian DR, Noble RT, Taylor H, Wicki M (2013) Performance of viruses and bacteriophages for fecal source determination in a multi-‐laboratory, comparative study. Water Res 47:6929–6943 Hsu, F.C., Shieh, Y.S.C., Vanduin, J., Beekwilder, M.J., Sobsey, M.D., 1995. Genotyping male-‐ specific RNA coliphages by hybridization with oligonucleotide probes. Appl. Environ. Microbiol. 61 (11), 3960–3966.
Ikner, L.A., Soto-‐Beltran, M., Bright, K.R., (2011). New method using a positively charged microporous filter and ultrafiltration for concentration of viruses from tap water. Applied and Environmental Microbiology 77 (10), 3500–3506. Jiang SC, Chu W (2004) PCR detection of pathogenic viruses in southern California urban rivers. J Appl Microbiol 97:17–28 Jiang, S.C., Noble, R., Chui, W.P., 2001. Human adenoviruses and coliphages in urban runoff impacted coastal waters of Southern California. Applied and Environmental Microbiology 67, 179-‐184. Johnston C, Ufnar JA, Griffith JF, Gooch JA, Stewart JR (2010) A real-‐time qPCR assay for the detection of the nifH gene of Methanobrevibacter smithii, a potential indicator of sewage pollution. J Appl Microbiol 109:1946–1956 Katayama, H.H., Shimasaki, A.A., Ohgaki, S.S., (2002). Development of a virus concentration method and its application to detection of enterovirus and norwalk virus from coastal seawater. Applied and Environmental Microbiology 68 (3), 1033–1039. Kirs M, Smith DC (2007) Multiplex Quantitative Real-‐Time Reverse Transcriptase PCR for F+-‐Specific RNA Coliphages: a Method for Use in Microbial Source Tracking. Applied and Environmental Microbiology 73:808–814 Leclerc, H., Edberg, S., Pierzo, V., Delattre, J.M., 2000. Bacteriophages as indicators of enter-‐ ic viruses and public health risk in groundwaters. J. Appl. Microbiol. 88 (1), 5–21.
Li, D., Shi, H.-‐C., Jiang, S.C., (2010). Concentration of viruses from environmental waters using nanoalumina fiber filters. Journal of Microbiological Methods 81 (1), 33–38. Long, S.C., El-‐Khoury, S.S., Oudejans, S.J.G., Sobsey, M.D., Vinje, J., 2005. Assessment of sources and diversity of male-‐specific coliphages for source tracking. Environ. Eng. Sci. 22 (3), 367–377.
Love DC, Vinje J, Khalil SM, Murphy J, Lovelace GL, Sobsey MD (2008) Evaluation of RT-‐PCR and reverse line blot hybridization for detection and genotyping F+ RNA coliphages from estuarine waters and molluscan shellfish. J Appl Microbiol 104:1203–1212 Love DC, Rodríguez RA, Gibbons CD, Griffith JF, Yu Q, Stewart JR, Sobsey MD (2014) Human viruses and viral indicators in marine water at two recreational beaches in Southern California, USA. Journal of Water and Health 12:136–16 Lu J, Ryu H, Domingo JWS, Griffith JF, Ashbolt N (2011) Molecular Detection of Campylobacter spp. in California Gull (Larus californicus) Excreta. Applied and Environmental Microbiology 77:5034–5039
McMinn BR, Korajkic A, Ashbolt NJ (2014) Evaluation of Bacteroides fragilis GB-‐124 bacteriophages as novel human-‐associated faecal indicators in the United States. Lett Appl Microbiol 59:115–121 McQuaig, S., Griffith, J.F. and V.J. Harwood. 2012. Association of fecal indicator bacteria with human viruses and microbial source tracking markers at coastal beaches impacted by nonpoint source pollution. Applied and Environmental Microbiology 78:6423-‐6432 Muniesa, M.; Lucena, F.; Blanch, A. R.; Payan, A.; Jofre, J. Use of abundance ratios of somatic coliphages and bacteriophages of Bacteroides thetaiotaomicron GA17 for microbial source identification. Water Res. 2012, 46 (19), 6410−6418.
Noble, R.T., Fuhrman, J.A., 2001. Enteroviruses detected by reverse transcriptase polymerase chain reaction from the coastal waters of Santa Monica Bay, California: low correlation to bacterial indicator levels. Hydrobiologia 460, 175e184.
Noble, R.T., Allen, S.M., Blackwood, A.D., Chu, W., Jiang, S.C., Lovelace, G.L., Sobsey, M.D., Stewart, J.R., Wait, D.A., 2003. Use of viral pathogens and indicators to differentiate between human and non-‐human fecal contamination in a microbial source tracking comparison study. Journal of Water and Health 1 (4), 195e207.
Ogorzaly L, Gantzer C (2006) Development of real-‐time RT-‐PCR methods for specific detection of F-‐specific RNA bacteriophage genogroups: Application to urban raw wastewater. J Virol Meth 138:131–139
Ogorzaly L, Tissier A, Bertrand I, Maul A, Gantzer C (2009) Relationship between F-‐specific RNA phage genogroups, faecal pollution indicators and human adenoviruses in river water. Water Res 43:1257–1264
Paar J III, Doolittle MM, Varma M, Siefring S, Oshima K, Haugland RA (2015) Development and evaluation of a culture-‐independent method for source determination of fecal wastes in surface and storm waters using reverse transcriptase-‐PCR detection of FRNA coliphage genogroup gene sequences. Journal of Microbiological Methods 112:28–35
Soller JA, Schoen ME, Bartrand T, Ravenscroft JE, Ashbolt NJ (2010) Estimated human health risks from exposure to recreational waters impacted by human and non-‐human sources of faecal contamination. Water Research 44:4674–4691
Soller JA, Schoen ME, Varghese A, Ichida AM, Boehm AB, Eftim S, Ashbolt NJ, Ravenscroft JE (2014) Human health Risk implications of multiple sources of faecal indicator bacteria in a recreational waterbody. Water Research:1–35
Stachler E, Bibby K (2014) Metagenomic Evaluation of the Highly Abundant Human Gut Bacteriophage CrAssphage for Source Tracking of Human Fecal Pollution. Environ Sci Technol Lett 1:405–409
Steele, J.A., Raith, M.R., Layton, B.A., Blackwood, A.D., Noble, R. T., Griffith, J.F. 2015 Comparison of Three Filtration Methods to Capture Pathogenic Viruses and Bacteria from Brackish Storm Water. ASM General Meeting Abstracts Stewart-‐Pullaro J, Daugomah JW, Chestnut DE, Graves DA, Sobsey MD, Scott GI (2006) F +RNA coliphage typing for microbial source tracking in surface waters. J Appl Microbiol 101:1015–1026 U.S. Environmental Protection Agency, 2001. Method 1601: Male-‐specific (F+) and Somatic Coliphage in Water by Two-‐step Enrichment Procedure. Office of Water, EPA EPA 821-‐R-‐01-‐030. Washington, DC. U.S. Environmental Protection Agency, 2001. Method 1602: Male-‐specific (F+) and Somatic Coliphage in Water by Single Agar Layer (SAL) Procedure. Office of Water, EPA 821-‐R-‐01-‐029. Washington, DC. U.S. Environmental Protection Agency. 2013. Method 1609: Enterococci in Water by TaqMan® Quantitative Polymerase Chain Reaction (qPCR) with Internal Amplification Control (IAC) Assay. Office of Water, EPA-‐820-‐R-‐13-‐005. Washignton, DC. U.S. Environmental Protection Agency, 2015. Review Of Coliphages As Possible Indicators Of Fecal Contamination For Ambient Water Quality. Office of Water, EPA 820-‐R-‐15-‐098 Washington, DC. Vinje, J., Oudejans, S.J.G., Stewart, J.R., Sobsey, M.D., Long, S.C., 2004. Molecular detection and genotyping of male-‐specific coliphages by reverse transcription-‐PCR and reverse line blot hybridization. Appl. Environ. Microbiol. 70 (10), 5996–6004.
Vergara GGRV, Goh SG, Rezaeinejad S, Chang SY, Sobsey MD, Gin KYH (2015) Evaluation of FRNA coliphages as indicators of human enteric viruses in a tropical urban freshwater catchment. Water Res 79:39–47 Wolf S, Hewitt J, Rivera-‐Aban M, Greening GE (2008) Detection and characterization of F+ RNA bacteriophages in water and shellfish: Application of a multiplex real-‐time reverse transcription PCR. J Virol Meth 149:123–128 Wolf S, Hewitt J, Greening GE (2010) Viral Multiplex Quantitative PCR Assays for Tracking Sources of Fecal Contamination. Applied and Environmental Microbiology 76:1388–1394
Projected Work Schedule Project Title: DEVELOPMENT OF DIGITAL RT-‐PCR METHODS TO QUANTIFY HUMAN-‐ASSOCIATED BACTERIOPHAGE IN STORM WATER AND COASTAL RECREATIONAL WATERS
Activities 2016-2017 F M A M J J A S O N D J
Adapt RT-QPCR assays to ddPCR Begin X X X X X End
Sample Collection and
Processing Begin X X X X X X X X X
F+RNA analysis on fresh and
archived samples
Begin X X X X
Data Analysis Begin X
Progress Reports X X
Presentations X X
Manuscript Preparation
Projected Work Schedule Project Title: DEVELOPMENT OF DIGITAL RT-‐PCR METHODS TO QUANTIFY HUMAN-‐ASSOCIATED BACTERIOPHAGE IN STORM WATER AND COASTAL RECREATIONAL WATERS
Activities 2017-2018 F M A M J J A S O N D J
Adapt RT-QPCR assays to ddPCR
Sample Collection and
Processing X X X
F+RNA analysis on fresh and
archived samples
X X X X X
Data Analysis X X X X X X X X End
Progress Reports X X
Presentations X X X X
Manuscript Preparation Begin X X
OMB Control No. 0648-0362
Expiration Date 1/31/2018
SEA GRANT BUDGET FORM 90-4
GRANTEE: Southern California Coastal Water Research Project GRANT/PROJECT NO.:
DURATION (months 12
12 months 1 Yr.A. SALARIES AND WAGES: man-months
1. Senior PersonnelNo. of People
Amount of Effort Sea Grant Funds Matching Funds
a. (Co) Principal Investigator: 1 1.00 4,935 1,645b. Associates (Faculty or Staff): 1 0.50 1,300 3,902
Sub Total: 2 1.50 6,235 5,547
2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians: 2 2.25 1,800 7,916h. Other: Sea Grant Trainee 1 4.5
Total Salaries and Wages: 5 8.25 8,035 13,463
B. FRINGE BENEFITS: 52.6% 4,226 7,082Total Personnel (A and B): 12,261 20,545
C. PERMANENT EQUIPMENT: 0 0
D. EXPENDABLE SUPPLIES AND EQUIPMENT: 18,000 8,000
E. TRAVEL:1. Domestic 3,000 1,0002. International
Total Travel: 3,000 1,000
F. PUBLICATION AND DOCUMENTATION COSTS: 3,000
G. OTHER COSTS:1 - UCI subcontractor- Co-PI Adam Martiny 15,542 0234567
Total Other Costs: 15,542 0
TOTAL DIRECT COST (A through G): 48,803 32,545
INDIRECT COST (86.94% on wages/benefits only ): 1 10,660 17,861INDIRECT COST (Off campus % of $ ):
Total Indirect Cost: 10,660 17,861
TOTAL COSTS: 59,463 50,406
PRINCIPAL INVESTIGATOR: Joshua A. Steele, Adam C. Martiny
BRIEF TITLE: Human-associated Coliphage Detection using Digital PCR in C
OMB Control No. 0648-0362
Expiration Date 1/31/2018
SEA GRANT BUDGET FORM 90-4
GRANTEE: Southern California Coastal Water Research Project GRANT/PROJECT NO.:
DURATION (months 12
12 months 1 Yr.A. SALARIES AND WAGES: man-months
1. Senior PersonnelNo. of People
Amount of Effort Sea Grant Funds Matching Funds
a. (Co) Principal Investigator: 1 1.00 5,082 1,695b. Associates (Faculty or Staff): 1 0.50 1,340 5,358
Sub Total: 2 6,422 7,053
2. Other Personnela. Professionals:b. Research Associates:c. Res. Asst./Grad Students:d. Prof. School Students:e. Pre-Bachelor Student(s):f. Secretarial-Clerical:g. Technicians: 2 2.25 2,500 6,642h. Other: Sea Grant Trainee 1 4.5
Total Salaries and Wages: 5 6.8 8,922 13,695
B. FRINGE BENEFITS: 52.6% 4,693 7,204Total Personnel (A and B): 13,614 20,899
C. PERMANENT EQUIPMENT:
D. EXPENDABLE SUPPLIES AND EQUIPMENT: 15,000 5,000
E. TRAVEL:1. Domestic 3,000 3,0002. International
Total Travel: 3,000 3,000
F. PUBLICATION AND DOCUMENTATION COSTS: 3,500
G. OTHER COSTS:1 - UCI subcontractor - Co PI Adam Martiny 15,760 0234567
Total Other Costs: 15,760 0
TOTAL DIRECT COST (A through G): 47,374 32,399
INDIRECT COST (86.94% on wages/benefits only ): 65% 11,836 18,169INDIRECT COST (Off campus of $ ):
Total Indirect Cost: 11,836 18,169
TOTAL COSTS: 59,210 50,568
PRINCIPAL INVESTIGATOR: Joshua A. Steele, Adam C. Martiny
BRIEF TITLE: Human-associated Coliphage Detection using Digital PCR in C
Joshua A. SteeleScien&st (Microbiologist) Phone: (714) 755-‐3218Southern California Coastal Water Research Project Fax: (714) 755-‐3299Costa Mesa, California, 92626 Email: joshuas@sccwrp.org
PROFESSIONAL PREPARATION: Ph.D. Biology, University of Southern California, 2010B.S. Molecular Biology, University of California, San Diego, 2000
PROFESSSIONAL EXPERIENCE:2014 – Present Scien&st -‐ Southern California Coastal Water Research Project 2013-‐2014 Associate Research Scien&st -‐ California Ins&tute of Technology, Division of Geology and
Planetary Sciences2010-‐2013 Postdoctoral Scholar in Geomicrobiology, California Ins&tute of Technology, Division of
Geology and Planetary Sciences2008-‐2009 NOAA Sea Grant Knauss Marine Policy Fellow: Legisla&ve Assistant for Rep. Sam Farr (CA-‐17);
U.S. House of Representa&ves
SELECTED PUBLICATIONS:
Steele, J.A., Raith, M.R., Layton, B.A., Blackwood, A.D., Noble, R. T., Griffith, J.F. 2015 Comparisonof Three Filtra&on Methods to Capture Pathogenic Viruses and Bacteria from Brackish Storm Water. ASM General Mee&ng Abstracts
Marlow JJ, Steele JA, Case DH, Connon SA, Levin LA and Orphan VJ 2014 Microbial abundance and diversity paeerns associated with sediments and carbonates from the methane seep environments of Hydrate Ridge, OR. Front. Mar. Sci. 1:44. doi: 10.3389/fmars.2014.00044
Marlow, J.J., Steele, J. A., Ziebis, W., Thurber, A. R., Levin, L. A., & Orphan, V. J. 2014 Carbonate-‐hosted methanotrophy represents an unrecognized methane sink in the deep sea. Nature Communica&ons., 5, 5094. doi:10.1038/ncomms6094
Cram, J. A., Chow, C.-‐E. T., Sachdeva, R., Needham, D. M., Parada, A. E., Steele, J. A., & Fuhrman, J. A. 2014. Seasonal and interannual variability of the marine bacterioplankton community throughout the water column over ten years. Isme Journal.. doi:10.1038/ismej.2014.153
Glass, J.B., H. Yu, J.A. Steele, K.S. Dawson, S. Sun, K.Chourey, R.L. Hekch, V.J. Orphan. 2014 Geochemical, metagenomic and metaproteomic insights into trace metal u&liza&on of methane-‐oxidizing microbial consor&a in sulfidic marine sediments. Environmental Microbiology 16(6), 1592–1611. doi:10.1111/1462-‐2920.12314
Hatosy, S.M., J.B.H. Mar&ny, R. Sachdeva, J. Steele, J.A. Fuhrman, A.C. Mar&ny 2013 Beta-‐diversity of marine bacteria depends on temporal scale. Ecology 94 (9), 1898-‐1904
Chow, C.E.T., R. Sachdeva, J.A. Cram, J.A. Steele, D.M. Needham, A. Patel, A.E. Parada, J.A. Fuhrman In press. Temporal variability and coherence of eupho&c zone bacterial communi&es over a decade in the Southern California Bight ISME Journal 7, 2259–2273; doi:10.1038/ismej.2013.122
Tavormina, P.L., W. Ussler III, J.A. Steele, S.A. Connon, M.G. Klotz, V. J. Orphan. 2013. Depth distribu&on of Cu-‐MMO variants through the oxygen minimum zone along the Costa Rica convergent margin. Environmental Microbiology Reports 5 (3), 414-‐423
Gilbert, J.A., J.A. Steele, J.G. Caporaso, L. Steinbrück, P. Somerfield, J. Reeder, B. Temperton, S. Huse, I. Joint, A.C. McHardy, R. Knight, J.A. Fuhrman, D. Field. 2012 Defining seasonal marine microbial community dynamics. ISME Journal 6:298-‐308.
Steele, J.A., P.D. Countway, L. Xia, P. D. Vigil, J.M. Beman, D.Y. Kim, C. T. Chow, R. Sachdeva, A.C. Jones, M.S. Schwalbach, J. M. Rose, I. Hewson, A. Patel, F. Sun, D.A. Caron, J.A. Fuhrman. 2011 Marine bacterial, archaeal, and pro&stan associa&on networks reveal ecological linkages ISME Journal 5:1414-‐1425.
Xia, L. C., J.A. Steele, J. Cram, Z.G. Cardon, S.L. Simmons, J.J. Vallino , J.A. Fuhrman, F. Sun 2011. Extended local similarity analysis (eLSA) of microbial community and other &me series data with replicates. BMC Systems
Biology 5:S15.Beman, J.M., J.A. Steele, and J.A. Fuhrman. 2011 Co-‐occurrence paeerns for abundant marine archaeal and bacterial
lineages in the deep chlorophyll maximum of coastal California. ISME Journal 5:1077-‐1085.
Fuhrman J.A., J.A. Steele. 2008 Community Structure of Marine Bacterioplankton: Paeerns, Networks, and Rela&onships to Func&on. Aqua&c Microbial Ecology 53:69-‐81.
Fuhrman, J.A., J.A. Steele, I. Hewson, M. S. Schwalbach, M.V. Brown, J. Green, Brown, J.H. 2008 A La&tude Diversity Gradient in Planktonic Marine Bacteria. Proceedings of the Na&onal Academy of Sciences 105:7774-‐7778.
Patel, A., R. Noble, J.A. Steele, M.S. Schwalbach, I. Hewson, J.A. Fuhrman 2007 Virus and Prokaryote Enumera&on from Planktonic Marine Environments by Epifluorescence Microscopy with SYBR Green I. Nature Protocols 2:269-‐276.
Ruan, Q., D. Duea, M.S. Schwalbach, J.A. Steele, J.A. Fuhrman, F. Sun 2006 Local Similarity Analysis Reveals Unique Associa&ons Among Marine Bacterioplankton Species and Environmental Factors. Bioinforma&cs 22: 2532-‐2538.
Fuhrman, J. A., Hewson, I., Schwalbach, M. S., Steele, J. A., Brown, M. V., & Naeem, S. 2006. Annually reoccurring bacterial communi&es are predictable from ocean condi&ons. Proceedings of the Na&onal Academy of Sciences, 103(35): 13104–13109.
Ruan, Q., Steele, J. A., Schwalbach, M. S., Fuhrman, J. A., & Sun, F. 2006. A dynamic programming algorithm for binning microbial community profiles. Bioinforma&cs, 22(12), 1508–1514.
Hewson, I., D.G. Capone, J. A. Steele, J.A. Fuhrman. 2006 Influence of Amazon and Orinoco Offshore Surface Water Plumes on Oligotrophic Bacterioplankton Diversity in the West Tropical Atlan&c. Aqua&c Microbial Ecology 43:11-‐22.
Hewson, I, J.A. Steele, D.G. Capone, J.A. Fuhrman. 2006 Remarkable Heterogeneity in Meso-‐ and Bathypelagic Bacterioplankton Community Composi&on. Limnol. Oceanography 51:1274-‐1283.
Hewson, I, J.A. Steele, D.G. Capone, J.A. Fuhrman. 2006 Temporal and Spa&al Scales of Oligotrophic Surface Water Bacterioplankton Assemblage Varia&on. Marine Ecology Progress Series 311:67-‐77.
Steele, J.A., F. Ozis, J.A. Fuhrman, J.S. Devinny. 2005. Structure of Microbial Communi&es in Ethanol Biofilters. Chemical Engineering Journal 113:135-‐143.
SYNERGISTIC ACTIVITIES:-‐Doctoral Fellow, NSF-‐IGERT: Env. Studies, Policy and Engineering-‐ Sustainable Ci&es Program, USC (2003-‐2004)-‐Par&cipant USC Sustainable Ci&es Internship in Hong Kong SAR, China 2004-‐Sea Grant Trainee, Beach Water Quality Study, 2002
RECENT COLLABORATORS:
R. Noble (UNC), J. Stewart (UNC), A. Mar&ny (UCI), V. Orphan (Caltech), L. Levin (UCSD), W. Ziebis (USC), J. Fuhrman (USC), J. Gilbert (ANL/U. Chigago), F. Sun (USC)
Assoc. Prof. Adam C. Martiny University of California – Irvine Department of Earth System Science Department of Ecology and Evolutionary Biology 3208 Croul Hall, Irvine, CA 92697 http://ess.uci.edu/researchgrp/amartiny/adam-martiny-lab
Tel: (949) 824 9713 Fax: (949) 824 3874 Home: (949) 5725 636 E-mail: amartiny@uci.edu
A. Professional Preparation: Massachusetts Institute of Technology
Ocean Microbiology, Post Doctoral scholar
2003 - 06
Technical University of Denmark Environmental Microbiology Ph.D. 2003
Technical University of Denmark Chemical Engineering M.S. 2000
B. Scientific Appointments: UCI OCEANS, Director University of California – Irvine Associate Professor, Dept. of Earth System Science & Dept. of Ecology and Evolutionary Biology University of California – Irvine
2015 – current 2012 – current
Visiting Professor University of Copenhagen
2012 – 13
Assistant Professor, Dept. of Earth System Science & Dept. of Ecology and Evolutionary Biology University of California – Irvine
2006 – 12
C. Selected publications (50 total): Galbraith, E and AC Martiny. A simple nutrient-dependence mechanism for
predicting the stoichiometry of marine ecosystems. PNAS. 2015.
Mouginot, C, Zimmerman, AE, Bonachela, JA, Fredricks, H, Allison, SD Van Mooy, BAS and AC Martiny. Resource allocation by the marine cyanobacterium Synechococcus WH8102 in response to different nutrient supply ratios. Limnol. Oceanogr. 2015.
Berlemont , R and AC Martiny. Genomic potential for polysaccharides deconstruction in bacteria. Appl. Environ. Microbiol. 2015.
Johnson, ZI, and AC Martiny. New tools for quantifying phytoplankton community structure. Annu. Rev. Mar. Sci. 2015.
Batmalle, C, Chiang, HI, Zhang, K, Lomas, MW and AC Martiny. Development and bias assessment of a method for targeted metagenomic sequencing of marine Cyanobacteria. Appl. Environ. Microbiol. 2014.
Lomas, MW, Bonachela, JA, Levin, SA and AC Martiny. Impact of ocean phytoplankton diversity on phosphate uptake. PNAS. 2014.
Hatosy, SM, Martiny, JBH, Sachdeva, R, Steele, J, Fuhrman, JA, and AC Martiny. Beta-diversity of marine bacteria depends on temporal scale. Ecology. 2013.
Flombaum, P, Gallegos, JL, Gordillo, RA, Rincón, J, Zabala, LL, Jiao, N, Karl, DM, Li, WKW, Lomas, MW, Veneziano, D, Vera, CS, Vrugt, JA, and AC Martiny. Present and future global distributions of the marine Cyanobacteria Prochlorococcus and Synechococcus. PNAS. 2013.
Allison, SD, Chao, Y, Farrara, JD, Hatosy, SM and AC Martiny. Fine-scale temporal variation in marine ectoenzymes of coastal southern California. Front. Microbio. 2012.
Rusch, D.B., Martiny, A.C., Dupont, C.L., Halpern, A.L., and J.C. Venter. Characterization of Prochlorococcus clades from iron depleted oceanic regions. PNAS 107:16184-89. 2010.
Martiny, AC, Kathuria, SK, and P Berube. Widespread metabolic potential for nitrite and nitrate assimilation among Prochlorococcus ecotypes. PNAS. 2009.
Kettler, G, Martiny, AC, Huang, K, Zucker, J, Coleman, ML, Rodrigue, S, Chen, F, Lapidus, A, Ferriera, S, Johnson, J, Steglich, C, Richardson, P, Church, GM and SW Chisholm. Patterns and implications of gene gain and loss in the evolution of Prochlorococcus. PLoS Genet. 2007.
Martiny, AC, Jørgensen, TM, Albrechtsen, HJ, Arvin, E, and S Molin. Long-term succession in structure and diversity of a biofilm formed in a model drinking water distribution system. 2003.
D. Synergistic Activities: • Founder and director of a new interdisciplinary academic initiative at UC
Irvine named UCI OCEANS. The goal of this initiative is to elevate the level and visibility of oceans-related research, strengthen connections with a local community that deeply values ocean health, recruit and engage top students at all levels. The initiative will focus on the ocean system and integrate urban-ocean couplings.
• Director of the Flow Cytometry and Cell sorting Facility for research and training at UCI
• Collaboration with Minority Science Programs for mentoring undergraduate students at UC-Irvine
• Collaboration with Orange County K-12 teachers to use art in the science curriculum
• PI for Gateway program for Community College students in Orange County. The program provides research opportunities for underrepresented students.
E. Graduate and Postdoctoral Advisors: Søren Molin, DTU, Hans-Jørgen Albrechtsen, DTU, Erik Arvin, DTU Sallie Chisholm, MIT F. Ph.D. Thesis Advisor (6 total) and Postgraduate-Scholar Sponsor (5 total): Grad Students: Chau Pham, Cecilia Batmalle Georgia Tech, Alyssa Kent UCI, Stephen Hatosy UCI, Allison Moreno UCI, Catherine Garcia UCI. Post docs: Pedro Flombaum CLIMA, Renaud Berlemont, CSULB, Agathe Talarmin KAUST, Nathan Garcia UCI, Junhui Li UCI.
John F. GriffithPrincipal Scien,stDepartment of Microbiology Phone: (714) 755-‐3228Southern California Coastal Water Research Project Home: (714) 756-‐0990Costa Mesa, California, 92626 Email: johng@sccwrp.org
PROFESSIONAL PREPARATION: Ph.D. Biology, University of Southern California, 2006B.S. Biology and environmental Studies, University of Southern California, 1995
PROFESSSIONAL EXPERIENCE:2010 -‐ Present Principal Scien,st, Microbiology, Southern California Coastal Water Research Project 2006 -‐ 2010 Supervising Scien,st, Southern California Coastal Water Research Project2005 -‐ 2006 Senior Scien,st, Southern California Coastal Water Research Project2001-‐ 2005 Microbiologist, Southern California Coastal Water Research Project
SELECTED PUBLICATIONS:
Cao, Y., Raith, M.R. and J.F. Griffith. 2015. Droplet digital PCR for simultaneous quan,fica,on of general and human-‐associated fecal indicators for water quality assessment. Water Research 70:337-‐349
Love, D.C., Rodriguez, R.A., Gibbons, C.D., Griffith, J.F., Stewart, J.R. and M.D.Sobsey. 2014. Human viruses and viral indicators in marine water at two recrea,onal beaches in southern California, USA. Journal of Water and Health 12:136-‐150
Yau, V., Schiff, K.C., Arnold, B.F., Griffith, J.F., Gruber, J.S., Wright, C.C., Wade, T.J., Burns, S., hayes, J.M., McGee, C., Gold, M., Caa, Y., Boehm, A.B., Weisberg, S.B. and J.M. Colford. 2014. Effect of submarine groundwater discharge on bacterial indicators and swimmer health at Avalon Beach, CA, USA. Water Research 59:23-‐36
Riedel, T.E., Zimmer-‐Faust, A.G., Thulsiraj, V., Madi, T., Hanley, K.T., Eben,er, D.L., Byappanahalli, M., Layton, B., Raith, M., Boehm, A.B., Griffith, J.F., Holden, P.A., Shanks, O.C., Weisberg, S.B., and J.A. Jay. 2014. Detec,on limits and cost comparisons of human-‐ and gull-‐associated conven,onal and quan,ta,ve PCR assays in ar,ficial waters. Journal of Environmental Management 136:112-‐120
Arnold, B.M., Schiff, K.C., Griffith, J.F., Gruber, J.S., Yau, V., Wright, C.C., Wade, T.J., Burns, S., Hayes, J.M., McGee, C., Gold, M., Cao, Y., Weiseberg, S.B. and J.M. Colford. 2013. Swimmer illness associated with marine water exposure and water quality indicators: Impact of widely used assump,ons. Epidemiology 24:845-‐53. doi: 10.1097/01.ede.0000434431.06765.4a
Raith, M., Eben,er, D., Cao, Y., Griffith, J. and S. Weisberg. 2013. Factors affec,ng the rela,onship between quan,ta,ve polymerase chain reac,on (qPCR) and culture-‐based enumera,on of Enterococcus in environmental waters. Journal of Applied Microbiology 116:737-‐746. DOI: 10.1111/jam.12383
Ryu, H., Henson, M., Elk, M., Toledo-‐Hernandez, C., Griffith, J., Blackwood, D., Noble, R., Gourmelon, M., Glassmeyer, S. and J.W. Santo Domingo. 2013. Development of quan,ta,ve PCR assays targe,ng the 16S rRNA genes of Enterococcus spp. and their applica,on to the iden,fica,on of Enterococcus species in environmental samples. Applied and Environmental Microbiology 79:196-‐204
Bourlat, S.J., Borja, A., Gilbert, J., Taylor, M.I., Davies, N., Weisberg, S.B., Griffith, J.F., Lejeri, T., Field, D. and J. Benzie. 2013. Genomics in marine monitoring: New opportuni,es for assessing marine health status. Marine Pollu,on Bulle,n DOI:10.1016/j.marpolbul.2013.05.042
Cao, Y., Van De Werkorst, L.C., Dubinsky, E.A., Badgley, B.D., Sadowsky, M.J., Andersen, G.L., Griffith, J.F. and P.A. Holden. 2013. Evalua,on of molecular community analysis methods for discerning fecal sources and human waste. Water Research DOI:10.1016/j.watres.2013.02.06
Harwood, V.J., Boehm, A.B., Sassoubre, L.M., Kannappan, V., Stewart, J.R., Fong, T-‐T., Caprais, M-‐P., Converse, R.R., Diston, D., Ebdon, J., Fuhrman, J.A., Gourmelon, M., Gentry-‐Shields, J., Griffith, J.F., Kashian, D.R., Noble, R.T., Taylor, H. and M. Wicki. 2013. Performance of viruses and bacteriophages for fecal source determina,on in a Mul,-‐laboratory, compara,ve Study. Water Research DOI:10.1016/j.watres.2013.04.064
Schriewer, A., Goodwin, K.D., Sinigalliano, C.D., Cox, A.M., Wanless, D., Bartkowiak, J., Eben,er, D.L., Hanley, K.T., Ervin, J., Deering, L.A., Shanks, O, C., Peed, L.A., Meijer, W.G., Griffith, J.F., Santodomingo, J., Jay, J.A., Holden, P.A. and Stefan Wuertz. 2013. Performance evalua,on of canine-‐associated Bacteroidales assays in a mul,-‐laboratory comparison study. Water Research DOI:10.1016/j.watres.2013.03.062
Boehm, A.B., Van De Werkorst, L.C., Griffith, J.F., Holden, P.A., Jay, J.A., Shanks, O.C., Wang, D. and S. B. Weisberg. 2013. Performance of forty-‐one microbial source tracking methods: a twenty-‐seven lab evalua,on study. Water Research DOI:10.1016/j.watres.2012.12.046
Cao, Y., Van De Werkorst, L.C., Scol, E.A., Raith, M.R., Holden, P.A. and J.F.Griffith. Bacteroidales terminal restric,on fragment length polymorphism (TRFLP) for fecal source differen,a,on in comparison to and in combina,on with universal bacteria TRFLP Water Research DOI:10.1016/j.watres.2013.03.060
Layton, B.A., Cao, Y., Eben,er, D.L., Hanley, K., Ballesté, E., Brandão, J., Byappanahalli, M., Converse, R., Farnleitner, A.H., Gentry-‐Shields, J., Gidley, M.L., Gourmelon, M., Lee, C.S., Lee, J., Lozach, S., Madi, T., Meijer, W.G., Noble, R., Peed, L., Reischer, G.H., Rodrigues, R., Rose, J.B., Schriewer, A., Sinigalliano, C., Srinivasan, S., Stewart, J.,Van De Werkorst, L.C., Wang, D., Whitman, R., Wuertz, S., Jay, J., Holden, P.A., Boehm, A.B.,
Shanks, O., and J.F. Griffith. 2013 Performance of Human Fecal Anaerobe-‐Associated PCR-‐Based Assays in a Mul,-‐Laboratory Method Evalua,on Study Water Research DOI:10.1016/j.watres.2013.05.060Converse, R.R., Griffith, J.F., Noble, R.T., Haugland, R.A., Schiff, K.C., and S.B. Weisberg. 2012. Correla,on between
quan,ta,ve PCR and culture-‐based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches. Applied and Environmental Microbiology 78: 1237-‐1242
McQuaig, S., Griffith, J.F. and V.J. Harwood. 2012. Associa,on of fecal indicator bacteria with human viruses and microbial source tracking markers at coastal beaches impacted by nonpoint source pollu,on. Applied and Environmental Microbiology 78:6423-‐6432
Dubinsky, E.A., Esmaili, L., Hulls, J.R., Cao,Y., Griffith, J.F. and G. L. Andersen. 2012. Applica,on of Phylogene,c Microarray Analysis to Discriminate Sources of Fecal Pollu,on. Environmental Science and Technology 46:4340–4347
Colford Jr, J.M,, Schiff, K.C., Griffith, J.F., Yau, V., Arnold, B.F., Wright, C.C., Gruber, J.S., Wade, T.J., S Burns, Hayes, J., McGee, C., Gold, M., Cao, Y., Noble, R.T., Haugland, R. and S.B. Weisberg. 2012. Using rapid indicators for Enterococcus to assess the risk of illness aqer exposure to urban runoff contaminated marine water. Water Research 46:2176-‐2186
Goodwin, K.D., McNay, M., Cao, Y., Eben,er, D., Madison, M. and J.F. Griffith. 2012. A mul,-‐beach study of Staphylococcus aureus, MRSA, and enterococci in seawater and beach sand. Water Research 46:4195-‐4207
Shanks, O.C., Sivaganesan, M., Peed, L., Kelty, C., Blackwood, A.D., Greene, M.R., Noble, R., Bushon, R., Stelzer, E.A., Kinzelman, J., Anna'eva, T., Sinigalliano, C., Wanless, D., Griffith, J.F., Cao, Y., Weisberg, S., Harwood, V.J.,
Fuhrman, J.A., Griffith, J.F., and M.S. Schwalbach. 2000. Prokaryo,c and viral diversity in marine plankton. Ecological Research. 17:183-‐194
Stol, L.D., T.P. Hayden, and J.F. Griffith. 1996 Benthic Foraminifera at the Los Angeles County Whites Point Ousall Revisited. Journal of Foraminiferal Research. 26 357-‐368
Griffith, J.F. and S.B. Weisberg. 2011. Challenges in Implemen,ng New Technology for Beach Water Quality Monitoring: Lessons Learned form a California Demonstra,on Project. Marine Technology Society Journal 45:65-‐73
SYNERGISTIC ACTIVITIES:Doctoral Fellow, NSF-‐IGERT: Env. Studies, Policy and Engineering-‐ Sustainable Ci,es Program, USC (1999-‐2000)-‐Sea Grant Trainee, Pathogenic Viruses in the Coastal Ocean, 1995 -‐ 2001
RECENT COLLABORATORS:M Sadowsky (U MN), R. Noble (UNC), J. Stewart (UNC), A. Boehm (Stanford), J. Jay (UCLA), P. Holden (UCSB), J. Fuhrman (USC), V. Harwood (USF), B. Arnold (UCB), J. Colford (UCB)
THESIS ADVISORY & POSTGRADUATE-‐SCHOLAR SPONSOR:
C.Lee (UCLA), R. Converse (UNC, Chapel Hil)
SUMMARY PROPOSAL FORM PROJECT TITLE: DEVELOPMENT OF DIGITAL RT-‐PCR METHODS TO QUANTIFY HUMAN-‐ ASSOCIATED BACTERIOPHAGE IN STORM WATER AND COASTAL RECREATIONAL WATERS OBJECTIVE: Our overall goals are to adapt and further develop a rapid, sensitive water quality monitoring and source-tracking tool that can be used to track the movement of viruses in coastal recreational waters and can be used to track human-associated contamination. Specifically we aim to 1) to develop a sensitive, robust droplet digital RT-PCR assay to measure and distinguish human-associated and non-human-associated F+RNA coliphage genogroups; and 2) apply this assay as microbial source tracking tool in coastal recreational waters and storm waters. METHODOLOGY: We will develop and test sensitive (potentially detecting a single gene copy) and robust (resistant to PCR inhibition) droplet digital RT-QPCR methods adapted from recently developed multiplex Reverse Transcriptase-QPCR assays applied to wastewater and environmental samples. These assays can distinguish multiple F+RNA coliphage genotypes at once by targeting shared coat protein and RNA replicase genes. Using this assay, we will quantify F+RNA coliphage genotypes collected from storm water, estuaries, and marine waters in the coastal zone in Southern California. Specifically we will target beaches likely to suffer from aging, leaky infrastructure and collect and filter 1-5L of seawater to capture the viruses by adsorption onto electronegative mixed cellulose ester filters. We also will draw on a sample archive previously collected by SCCWRP and the Martiny lab at UC Irvine consisting of large (20L) and small (0.5-1L) volume storm water samples from San Diego and Malibu, and near-shore beach samples from Ocean Beach and Tourmaline Surfing Park (San Diego), Doheny State Beach, Newport Beach (Orange County), Avalon, and Malibu (Los Angeles County). RATIONALE: Levels of fecal indicator bacteria (FIB) are used to monitor the recreational water quality to protect swimmers from exposure to pathogens found in fecal material, but are an imperfect indicator. The main limitation is that concentrations of FIB have been shown to be poorly correlated with the presence of human enteric viruses (e.g. Human Norovirus, Enterovirus or Adenovirus) that are responsible for the majority of gastrointestinal illnesses in swimmers. Other limitations include discerning the source of FIB (human or non-‐human), the dilution and degradation of FIB in the environment, and the physical removal of bacteria as they are transported through groundwater. Viruses and bacteriophage (i.e. viruses that infect bacteria) are not filtered out by sand or soil at the same rate as much larger bacteria. Further, bacteriophage are more abundant than human viruses (since their bacterial hosts are much more abundant) which makes them more attractive water quality indicators at beaches where the source of contamination is leaking infrastructure, rather than acute inputs, such as storm water pulses or sewage spills. F+RNA coliphage (i.e.
viruses infecting E. coli), bacteriophage infecting human-‐associated Bacteroides bacteria (e.g. Bacteroides GB-‐124 phage), and a bacteriophage discovered from human gut microbiome metagenomes (crAssphage) have been proposed as potential fecal indicators. Traditional cultivation techniques are slow, taking up to 18-‐24 hours to quantify the number of phage, followed by molecular analysis to identify phage genotypes. Adding to these difficulties, bacteriophage abundance is variable and can go undetected by culture methods, requiring non-‐quantitative enrichment cultivation in order to enhance detection. Molecular quantification of bacteriophage directly from environmental waters avoids the lengthy cultivation process and, in the case of F+RNA coliphage, measures genotypes associated with human (genotypes II and III) and non-‐human (genotypes I and IV) fecal sources.
DATA SHARING PLAN: All data generated by the project will cleaned, formatted, and be made publicly available through the California Environmental Data Exchange Network, or on SCCWRP’s website. In addition, the publications will be open-‐access and data and protocols generated by this project will be housed on a publicly accessible website either in an open sharing site such as GitHub.
July 7, 2015 Dr. Joshua Steele Department of Microbiology Southern California Coastal Water Research Project 3535 Harbor Blvd. Suite 110 Costa Mesa, CA 92626 Dear Dr. Steele, I am pleased to hear about your proposal to USC Sea Grant seeking to develop a digital PCR assay for human-associated coliphage in the urban ocean. At the Surfrider Foundation, we are interested in innovative techniques to measure the health of the coastal ocean and in rapid, sensitive methods for monitoring coastal water quality. As you know from our previous collaborations, we are especially interested in the links between coliphage as a measure of viral contamination and gastrointestinal illness in swimmers and surfers. We would find this technique a useful addition to the rapid, molecular water quality methods that we can use to measure coastal health. Sincerely,
Dr. Chad Nelsen CEO
Global Headquarters P.O. Box 6010 San Clemente, CA USA 92674-6010 Phone: (949) 492 8170 Fax: (949) 492 8142 Email: info@surfrider.org www.surfrider.org