Post on 10-Jun-2020
Towards a Theory ofLandscapesPeter F. Stadler
SFI WORKING PAPER: 1995-03-030
SFI Working Papers contain accounts of scientific work of the author(s) and do not necessarily represent theviews of the Santa Fe Institute. We accept papers intended for publication in peer-reviewed journals or proceedings volumes, but not papers that have already appeared in print. Except for papers by our externalfaculty, papers must be based on work done at SFI, inspired by an invited visit to or collaboration at SFI, orfunded by an SFI grant.©NOTICE: This working paper is included by permission of the contributing author(s) as a means to ensuretimely distribution of the scholarly and technical work on a non-commercial basis. Copyright and all rightstherein are maintained by the author(s). It is understood that all persons copying this information willadhere to the terms and constraints invoked by each author's copyright. These works may be reposted onlywith the explicit permission of the copyright holder.www.santafe.edu
SANTA FE INSTITUTE
Towards a Theory of Landscapes
By
Peter F� Stadlera�b��
aInstitut f�ur Theoretische Chemie� Universit�at Wien
W�ahringerstra�e ��� A���� Wien� Austria
bSanta Fe Institute
� Hyde Park Rd�� Santa Fe� NM �� ��� USA
Stadler� Towards a Theory of Landscapes
�� Introduction
Since Sewall Wright�s seminal paper ��� � the notion of a �tness landscape underlying the dynamicsof evolutionary adaptation optimization has proved to be one of the most powerful concepts inevolutionary theory� Implicit in this idea is a collection of genotypes arranged in an abstractmetric space� with each genotype next to those other genotypes which can be reached by a singlemutation� as well as a value assigned to each genotype� Such a construction is by no meansrestricted to biological evolution� Hamiltonians of disordered systems� such as spin glasses ���� ����and the cost functions of combinatorial optimization problems � �� have the same mathematicalstructure� It has been known since Eigen�s �� pioneering work on the molecular quasispeciesthat the dynamics of optimization on a landscape depends crucially on detailed structure of thelandscapes itself� Extensive computer simulations� see� e�g�� ���� � � ��� have made it very clearthat a complete understanding of the dynamics is impossible without a thorough investigation ofthe underlying landscape �����
The landscapes of a number of well known combinatorial optimization problems� such as theTraveling Salesman Problem TSP� the Graph Bipartitioning Problem GBP� or the Graph MatchingProblem GMP have been investigated in some detail ����� ���� �� �� The distribution of local optimaand the statistical characteristics of down�hill walks have been computed for the uncorrelatedlandscape of the random energy model ���� ��� ��� ��� Furthermore� two one�parameter families oftunably rugged landscapes have been studied extensively� the Nk model and its variants ���� ������� ��� and the p�spin models ��� ��� A detailed survey of a variety of model landscapes derivedfrom folding RNA molecules into their secondary structures has been performed recently ���� ���� � �� ��� ��� ��� � � ��� ���� ��� ���� ���� ��� ����
In this contribution I will present an overview over the mathematical techniques that have proveduseful for an analysis of landscapes� This approach is based on Fourier Series de�ned on thehighly symmetric graphs that occur as con�guration spaces underlying combinatorial optimizationproblems and evolutionary dynamics� We will consider both stochastic models of landscapes�so�called random �elds� and individual �measured� landscapes�
Section � deals with the structure of the con�guration spaces� The mathematical language de�scribed there� mostly permutation group theory and graph theory� seems to be the appropriatebasis for a general theory of ��tness� landscapes�
Section discusses random �elds� The theory of random �elds at this points is mostly a �secondorder theory�� That is to say� it revolves around covariance and correlation measures� The mainemphasis lies here on isotropic random �elds and their correlation functions� Among other resultswe give a characterization of isotropic random �elds in terms of their Fourier coe�cients� Then webrie�y discuss the relation between the autocorrelation function of random �elds and the correlationfunction of the time series obtained from a random walk on the random �eld� Furthermore weinvestigate superpositions and transformations of random �elds�
Section � contains the theory of individual landscapes� The most surprising result concern therelations between �elementary landscapes��which are eigenvectors of the graph Laplacian �� andtheir autocorrelation functions� The relation of the correlation structure and the distribution oflocal optima of the landscape is subject of on�going research� �rst results are discussed in subsection��� The notion of elementary landscapes leads to a re�ned classi�cation scheme for landscapes�The �nal subsections contain material about landscapes on irregular graphs and on anisotropiesin landscapes on highly regular graphs�
Section provides a condensed review of RNA landscapes and a generalization of the theory oflandscapes to sequence�structure mappings�
�See section ��� for details�
� � �
Stadler� Towards a Theory of Landscapes
��Con�guration Spaces
����An Example � TSP
The travelling salesman problem �TSP� ���� is a classical example of an NP�complete � �� combina�
torial optimization problem� Few mathematical problems have attracted as much attention� Given
a distribution of cities the task is to �nd the shortest tour visiting each city once and returning to
the starting point with prescribed costs wij for traveling from i to j� The cost function is
f�� � �n��Xi��
w��i���i��� w��n�����
where � is the permutation encoding the order of the cities� The symmetric problem wij � wji has
applications in X�ray crystallography �� �� electronics ����� and the study of protein conformations
����� The asymmetric case ��� has applications in scheduling chemical processes or from pattern
allocation problems in glass industry�
Besides the cost function there is another ingredient in the problem that is as important� the
combinatorial structure of the con�gurations �in our case the possible tours of the salesman��
Heuristic algorithms designed to �nd approximate solutions of the TSP use the internal structure
of con�gurations to arrange them �hopefully� in a way which simpli�es the search� Typically the
search proceeds from con�guration to a neighboring one�
π
i-1
i
i+1k-1
k
k+1
ki i k
π (i,k) [i,k]π
Figure �� The two most common types of elementarymoves for the TSP are transpositions� �i� k��� and inversions��i� k�� of a tour �� A transposition of the form �i�i� is called canonical transposition�
What does neighboring mean in the case of the TSP! There is no unique answer� instead a few
di"erent ways of de�ning neighborhood come to mind� For a mathematician the most natural
choice is probably to use the exchange of two cities along the tour �a transposition� as elementary
�move�� Alternatively one might allow only the exchange of subsequent cities� this operation is
called a �canonical transposition�� Lin and Kernighan ���� suggested to reverse the order of the
cities in a part of the tour� this move is called inversion� reversal� or �opt move� These three types
of moves are displayed in �gure ��
All landscapes are composed of these two ingredients�
��� a cost function or �tness function f assigning a value to each con�guration� and
� � �
Stadler� Towards a Theory of Landscapes
Table �� The Correspondence of Statistical Mechanics� Combinatorial Optimization and Evolu�
tionary adaptation�
Combinatorial Statistical Folding of Evolutionary Symbol
Optimization Mechanics Biopolymers Adaptation
system size system size chain length chain length n
con�guration micro�state structure sequence x
cost energy energy �tness f�x�
pseudo� temperature temperature mutation� T�� ln q
temperature rate
optimum ground state native state �ttest o
instance sample f
move �spin �ip�y y mutation
y There is no generic term for the elementary process of the dynamics� Ideally� there is only one energy or �tness function in a given system
��� a rule determining whether two con�gurations x and y are neighbors of each other�
As a consequence of ���� the set C of all con�gurations can be viewed as a graph # with each vertexcorresponding to a con�guration and an edge between any two nearest neighbors� A landscape is
therefore simply a real valued function of the vertex set V of some graph #� A list of corresponding
terms for landscapes occurring in di"erent �elds is presented in table ��
Often we are not given a single landscape but a model containing a large number of parameters
which are assigned randomly� It is customary� for instance� to consider TSPs with the cities
randomly distributed in the unit square ����� Such a model is not a landscape but consists of
an entire probability space whose elements are landscapes� These so�called random �elds will be
discussed in section �
����Groups
������Permutation Groups
In this section we brie�y recall the basic de�nitions of the theory of permutation groups as far
as we will need them in this contribution� An excellent introduction to permutation groups is
Wielandt�s book ������ Let X be a �nite set and G a group acting on X� notation �G�X�� The
group identity will be denoted by e� The cardinality of X is the degree N of the permutation
group� The cardinality of G itself is called the order of G� The permutation matrix associated with
a group element g � G is
gijdef���
�� if g�i� � j� otherwise
In this notation we identify an element of the abstract group G with its representation as a
permutation matrix� Analogously� we will write G also for the group of permutation matrices
corresponding to the group elements g � G�
D�x� def��� fy � Xjy � g�x�� �g � Gg is an orbit of G in X� The orbits of G partition the set X�
We have y � D�x� �� D�y� � D�x��
� �
Stadler� Towards a Theory of Landscapes
The centralizer of G in the algebra of all N � N matrices over C � i�e��
C�G�X� def���
�Q � C N�N jQg � gQ for all g � G
��
is called the commuting algebra of G on X� It seems to play a key role in the study of highly
symmetric con�guration spaces� We will also need a few simple properties of permutation groups�
De�nition� Let G be a permutation group acting on X�
� G acts transitively in X if there is only a single orbit of G�
� G acts regularly on X if g�x� � x for some x implies that g is the group identity�
� A subset Y � X such that for each g � G we have either g�Y � � Y or g�Y � � Y � iscalled a block� The one�point subsets of X� and X itself� clearly ful�l this requirement for all
permutation groups� they are usually referred to as trivial blocks� G acts primitively on X if
there are no non�trivial blocks�
������Orbits� Orbitals� and Symmetry Classes
If G acts transitively on X it does not necessarily so� on X �X� We will denote the orbits of G
on X �X by ��� ��� ��� etc�
There is a one�to�one relation�ship between the orbits of G on X�X and the orbits of the stabilizer
subgroup
G�def��� fg � G j g��� � �g
of an arbitrary element � � X�
$� � fv � X j �v� �� � ��g��� � f �u� v� � X �X j � � G � ��v� � $� � ��v� � � g �
An orbital is a mapping % from X into the subsets of X such that
�i� %�x� is a Gx�orbit x � X�
�ii� g�%�x�� � %�g�x���
Let %��x� denote the orbitals� i�e�� %��x� is the orbit of the stabilizer Gx of x that corresponds to
the orbit $� of G�� the stabilizer of the �reference vertex� �� We have therefore x � %��y� if and
only if �x� y� � ��� We will refer to � as the symmetry class to which the orbits $� and �� as well as
the orbital %� belong� The mirror image of an orbital is de�ned by
%��x� � fg���x�jg�x� � %�x�g�
it is again an orbital of G acting on X� Consequently� for each � there is a � such that %�� � %��
We write � � ���
The symmetry class corresponding to the diagonal on X � X will be denoted by �� i�e�� �� �
f�x� x�jx � Xg� The number of symmetry classes is M ��
The cardinalities of the sets %��x� are of course independent of x� It is often called a subdegree of
G� it will be denoted here by j�j�
�g�x� y�def��� �g�x�� g�y��
� � �
Stadler� Towards a Theory of Landscapes
������ Incidence Matrices
A central part of the theory discussed in this contribution are the matrices R��� de�ned by
R���xy �
�� if �x� y� � ��� otherwise
�
�� if x � %��y�� otherwise
Higman � � called them incidence matrices of the transitive permutation group G on X� The
mirror image of a symmetry class belongs to the transpose of the corresponding incidence matrix�
�R����� � R����� The collection of the M � matrices R��� will be denoted by R�
De�nition� Let A � fA�� A�� � � � � AMg be a collection of N � N ��� matrices with the following
properties�
�i� A� � I� the identity matrix
�ii�MXj��
Aj � J � the matrix with all entries ��
�iii� For all � � i� j � M we have AiAj �MXk��
sijkAk�
�iv� For all � � i � M there is a j such that A�i � Aj �
The we call A an incidence scheme�
Properties �i�� �ii�� and �iii� imply that A forms the basis of an algebra of dimension M �� we
will denote this algebra by hAi�A well known result is the following�
Theorem� Let X be a �nite set and let G be a permutation group operating transitively on
X� Then the collection of the matrices R forms an incidence scheme� In fact� the collection R
generates the commuting algebra of G on X�
hRi � C�G�X��
Proof� It is trivial that �i�� �ii�� and �iv� are satis�ed� It is shown in ����� Thm� ����� and ����
Thm� ����� that the matrices R��� form a basis of the commuting algebra C�G�X�� see also � ��
and thus �iii� holds as well�
������ Intersection Numbers and Collapsed Matrices
We de�ne the intersection numbers of the orbitals %� and %� with respect to the orbital %� by
s�����def��� j%��u� �%��w�j with u � %��w��
It is easy to see that these numbers really depend only on �� �� and � � �� The intersection matrix
of the orbital %� is the matrix with entries �s����� ��
The intersection numbers are of course closely related to the incidence matrices� In fact� we have
the following
Lemma� R����R��� �X�
s����� R����
� �
Stadler� Towards a Theory of Landscapes
Proof� We have �R����R����xy �Xz
R����xz R���
zy �Xz
R���zx R���
zy
���fzjz � %��x� � z � %��y�g
�� � j%��x� �%��y�j � s����� �
where � is such that x � %��y�� i�e�� it is the coe�cient of R�xy�
The intersection matrices provide an elegant means for determining if G acts primitively on X�
Lemma� � � ������ G acts primitively on X if and only if all intersection matrices R��� are
irreducible�
Higman � � shows that the intersection matrix S��� can be obtained from the incidence matrix
R��� by the following procedure�
Suppose the points of X are arranged according to the symmetry classes �� and consider the
corresponding blocks of R��� �see the example below�� Each block has by construction constant
column sum� Construct the matrix &R��� by replacing each block by its column sum� Using the
terminology in ���� we call a matrix obtained by this procedure collapsed�
Theorem� �i� The collapsed incidence matrices are the intersection matrices� i�e�� &R����� � s
����� �
�ii� The intersection matrices span an algebra &C�G�X� which is isomorphic to the commuting
algebra C�G�X��
Proof� See � ��
������Association Schemes
De�nition� Let A � fA�� A�� � � � � AMg be an incidence scheme� A is an association scheme if we
have in addition
�v� For all � � i� j � M holds AiAj � AjAi�
If �iv� is replaced by
�iv�� A�i � Ai we call A a symmetric association scheme�
Commutativity �v� follows already from �i�� �ii�� �iii�� and �iv��� Note that Godsil � �� uses the
term 'association scheme� for symmetric association schemes� We use here Delsarte�s ��� original
terminology�
The theory of association schemes plays a fundamental role in algebraic combinatorics� Many
questions concerning distance regular graphs are best discussed in this framework� It plays a
fundamental role in coding theory� and is important for the theory of polynomial spaces� For a
recent textbook on this topic see � ���
Theorem� The incidence matrices form an association scheme� i�e�� the commuting algebra of
�G�X� is commutative� if and only if the irreducible constituents of the permutation representation
are inequivalent�
Proof� The argument in � � ������� is based on ����� Thm� ����
We will not use the incidence matrices R��� themselves but we will rather work with the sym�
metrized incidence matrices (R��� de�ned by
(R��� �
�R��� if � � ��
R��� R���� if � � ��
Of course� these matrices are again ��� matrices� It will be an important question under which
conditions they form again an incidence scheme� If this is the case� then they form even a symmetric
� � �
Stadler� Towards a Theory of Landscapes
association scheme which will be denoted by (R� Obviously� a trivial su�cient condition is that
R��� � R���� for all symmetry classes �� i�e�� if all orbits of G are �self�paired�� A less trivial
condition can be obtained from the above theorem�
Lemma� If the incidence matricesR��� form an association scheme then the symmetrized incidence
matrices form a symmetric association scheme�
Proof� If the incidence matrices R��� commute� so do the symmetrized incidence matrices (R����
It remains to show that (R��� (R��� is a linear combination of symmetrized incidence matrices� The
product of two symmetric matrices is symmetric if and only if they commute� thus the product(R��� (R��� is again a symmetric matrix� We have
(R��� (R��� �X�
p���R��� � � (R��� (R����� �X�
p����R������
The symmetry of the product implies p��� � p����� i�e�� the product is in fact a linear combination
of the symmetrized incidence matrices�
����Graphs
������Graphs and Their Associated Matrices
Adjacency Matrix�
A graph consists of a set V of N vertices and a set of edges� Two vertices x and y are neighbors
�one says that x and y are adjacent� if they are joined by an edge� The set of edges will be denoted
by E� We will denote the set of neigbors of a vertex x by N �x�� The number of neighbors� jN �x�jis called the degree of the vertex x� We will need the diagonal vertex degree matrix D which has
the entries Dxydef��� jN �x�jxy� where ij is Kronecker�s symbol� A graph is regular if all vertices
have the same degree� In this case we will use D to denote the common vertex degree� i�e�� the
vertex degree matrix is DI� where I is as usual the identity matrix�
A graph # is uniquely described by the N �N matrix A de�ned by
Axydef���
�� if y � N �x�� otherwise�
It is called the adjacency matrix of # as its non�zero entries correspond to the pairs of adjacent
vertices� therefore A is symmetric�
A path of length is a sequence of vertices x�� x�� � � � � x� such that fxi��� xig is an edge for � � i � �
A well known result� see� e�g�� ���� links the number of paths of given length with the adjacency
matrix�
Lemma� The entry x� y in the s�th power of the adjacency matrix� As� equals the number of paths
of length s from x to y� For later reference we note here the following
De�nition� A simple random walk ����� on # starting at � is a Markov process with transition
matrix
T � D��A
and initial condition p��x� � x���
� � �
Stadler� Towards a Theory of Landscapes
Distance Matrices�
The notion of a path suggest a natural de�nition of a distance between two vertices of a graph�
let d�x� y� denote the minimum length of a path joining the vertices x and y� In this contribution
we will consider only �nite connected graphs� Thus d�x� y� is �nite for any two vertices� It is easy
to check that this distance measure is metric on the vertex set of #� i�e�� for all x� y� z � V the
following is true�
�i� d�x� y� � � if and only if x � y�
�ii� d�x� y� � d�y� x�� and
�iii� d�x� y� � d�x� z� d�z� y��
It is natural to consider the sets
Nk�x�def��� fy � V j d�x� y� � k g
and the distance matrices A�k� with entries
A�k�xy
def���
�� if d�x� y� � k� otherwise
Of course� A��� � I� the identity matrix� and A��� � A� the adjacency matrix�
Incidence Matrix and Graph Laplacian�
A second important matrix links the vertices and edges of #� For each edge h � fv� wg we chooseone of the two vertices as the �positive end� and the other one as the �negative end� of the edge�
The choice of the orientation is completely arbitrary� The matrix
r�ij �
��� � vertex vi is the positive end of edge ej�� vertex vi is the negative end of edge ej� otherwise
is called the incidence matrix of #�
The notion of an incidence matrix of a graph should not be confused with the incidence matrices
of transitive permutation groups described above ) they are unrelated� The choice of the symbol
r is intentional� In fact� let f � V � IR be an arbitrary function� Then �rf��h� � f�v� � f�w�
where h is the edge fv� wg� and v is the positive end of the edge h� This is as close to a di"erential
operator as one can get on a graph�
The matrix
� � A �D
is called the Laplacian on #� For regular graphs this becomes A�DI� where D is now the constant
vertex degree of #� For an arbitrary function f � V � IR we have
��f��x� �X
y�N�x�
f�y� � f�x�
�
The graph Laplacian shares its most important properties with the familiar Laplacian operator in
IRn as listed in the following
� � �
Stadler� Towards a Theory of Landscapes
Theorem� The graph Laplacian � has the following properties�
�i� � is symmetric�
�ii� � is non�positive de�nite�
�iii� � is singular� the eigenvector ��� � � � � �� belongs to the eigenvalue (*� � �� If # is connected
�as we will always assume�� then *� has multiplicity ��
�iv� � � �r�r� that is� it corresponds to �second derivatives� on the graphs��v� for all landscapes f and g holds Green�s formula in the following form
Xx�V
f�x���g��x� �Xx�V
g�x���f��x� � �Xh�E
�rf��h��rg��h��
�vi� hrf�rgi � �hf��gi � �hg��fi for arbitrary f� g � V � IR� where h � � � i is the usual scalarproduct in IRN �
Proof� �i� is obvious� �ii� and �iii� are well known� see� e�g�� ���� ���� and �iv� is Proposition ��� of
����� Green�s formula �v� is checked by explicit calculation� see e�g�� ������
The graph Laplacian has received considerable attention in the theory of electrical networks� see�
e�g�� ���� Chap� �� A recent book on potential theory on in�nite discrete lattices is ������ Mark
Kac ���� has asked whether the knowledge of the spectrum of a Laplacian with Dirichlet boundary
conditions is su�cient to completely determine the shape of its domain� Shortly after Kac�s talk a
series of papers� e�g�� � � ��� �� investigated the analogous question for the graph Laplacian� Given
the spectrum of �� how much geometric information on the underlying graph can be retrieved!
The set of eigenvalues of the adjacency matrix is called the spectrum of the graph #� The spectral
properties of the matrices A� T � and � are closely related� For later reference we note the following
trivial
Lemma� Let # be a regular graph with adjacency matrix A and vertex degree D� Then A� T �
and � have the same eigenvectors and the corresponding eigenvalues *k� �k� and (*k belonging to
the eigenvector �k are related via
(*k � *k �D and �k � *k D�
������Symmetry and Regularity of Graphs
An automorphism of # is mapping � � V � V � such that ���x�� ��y�� is an edge of # if and only
if �x� y� is an edge of #� The set of all automorphisms forms a group� the automorphism group
Aut�#��
A large number of di"erent symmetry properties have been de�ned for graphs� These notions
can be subdivided into two classes depending on whether their de�nition uses properties of the
automorphism group� For reference we mention here the most important ones�
� �
Stadler� Towards a Theory of Landscapes
Regularity Conditions
� # is regular if all vertices have the same number D of neighbors�
� # is distance degree regular if the cardinality of the sets
Nk�x�def��� fy � V j d�x� y� � k g
depends only on k�
� # is walk regular if the number of closed walks of length r starting at vertex x is independent
of x for all r� or equivalently� if �Ar�xx is independent of x for all r�
� # is distance regular if the cardinalities of the intersections Ni�u� �Nj�v� depends only on the
distance d�u� v�� The distance matrices A�k� with entries a�k�xy � � if d�i� j� � k and a
�k�xy � �
otherwise form a symmetric association scheme�
� # is strongly regular if the cardinality of the intersections N��u��N��v� depends only on whether
u and v are adjacent or not� Usually one excludes complete graphs� Strongly regular graphs are
then distance regular with diameter �� They play a prominent role in algebraic combinatorics�
� # is k�set�regular if� given a subset Y consisting of at most k vertices� the number of vertices
joined to each vertex in Y depends only on the isomorphism type of the induced subgraph of
Y in #� Consequently� ��set�regular is regular� and ��set�regular is strongly regular�
Transitivity Conditions
� # is vertex transitive if Aut�#� acts transitively on V � i�e�� if for any two vertices x and y there
is an automorphism � such that ��x� � y�
� # is generously vertex transitive if Aut�#� acts generously transitively on V � i�e�� if for any two
vertices x and y there is an automorphism � such that ��x� � y and ��y� � x�
� # is edge transitive if Aut�#� acts transitively on the set E of edges �considered as unordered
pairs of vertices��
� # is weakly symmetric if it is both vertex transitive and edge transitive�
� # is symmetric if for all vertices x� y� u� v � V such that �x� y� and �u� v� are edges there is an
automorphism � ful�lling ��x� � u and ��y� � v�
� # is t�arc transitive if Aut�#� acts transitively on �arcs� consisting of at most t subsequent
edges such that two consecutive edges in the arc are not identical� Note that arcs can contain
a vertex or an edge twice� but it is not allowed to backtrack a single step� ��arc�transitive is
the same as �symmetric��
� # is distance transitive if for any four vertices x� y� x�� y� � V such that d�x� y� � d�x�� y�� there
is an automorphism ful�lling ��x� � x� and ��y� � y��
� # is metrically k�transitive if for any two k�tuples of vertices �x�� � � � � xk� and �y�� � � � � yk� which
satisfy d�xi� xj� � d�yi� yj� there is an automorphism ful�lling ��xi� � yi� In other words� a
graph is metrically k�transitive if any isometry between sets of at most k vertices can be extended
to an automorphism� Metrically ��transitive is the same as vertex�transitive� metrically ��
transitive is the same as distance�transitive�
� # is k�set�transitive if any isomorphism between induced subgraphs of sets consisting of at most
k vertices extends to an automorphism of #� For k � �� k�set transitive graphs are metricallytransitive with diameter ��
� # is homogeneous if it is k�set transitive for all k�
� # is metrically homogeneous if it is metrically k�transitive for all k�
The relations between the animals in this zoo of graph theoretical properties is shown in �gure ��
In the following sections we will discuss the most important properties in a little more detail�
� �� �
Stadler� Towards a Theory of Landscapes
REGULAR
Cyclesk-arc-transitive
k>7
7-arc-transitive
6-arc-transitive
5-arc-transitive
4-arc-transitive
3-arc-transitive
2-arc-transitive
metrically homogeneousmetrically 6-transitive
metrically 5-transitive
metrically 4-transitive
metrically 3-transitive
DISTANCE TRANSITIVEmetrically 2-transitive
homogeneous5-set-transitive5-set-regular
STRONGLY REGULAR2-set-regular
SYMMETRIC1-arc-transitive
DISTANCE REGULAR
CAYLEY GRAPHS
generouslyvertex-transitive
VERTEX-TRANSITIVE
4-set-transitive
3-set-transitive
2-set-transitive
4-set-regular
3-set-regular
CGCG
weakly symmetric
distance degree regular walk regular
Figure �� A zoo of symmetry properties of graphs has been studied� Arrows indicate implications� equivalentproperties are shown within the same rectangle� CGCG refers to Cayley graphs with an Abelian group�Cayley graphs are discussed in section ������
������Vertex�Transitive Graphs
A most important class of graphs are derived from groups� Let H be a group with N elements and
+ a set of generators� of H such that
�i� e � +� and�ii� x � + implies x�� in +�Then the graph #�H�H��+� with vertex set V � H and edge set f�x� y�jxy�� � + is called theCayley graph of the group H with respect to the set of generators +�
Not all vertex transitive graphs are Cayley graphs� however� A famous counter�example is the
Petersen graph� �gure ��
Sabidussi ����� gives a method for constructing all vertex transitive graphs from groups which is
closely related to Cayley graphs� Let � be an equivalence relation on the vertex set of a graph #�Then the graph # � has the equivalence classes as its vertices� and two such vertices are joined by
an edge if and only if there is at least one edge connecting the two classes in #� Now let H� � H
�� is a set of generators of the group H if each element x � G can be represented as a product of members of H�
� �� �
Stadler� Towards a Theory of Landscapes
be a subgroup of H� and let + again be a set of generators of H� The left cosets of H� induce an
equivalence relation � on H� We will denote the graph #�H�+� � by #�H�H��+�� Explicitly� its
vertex set and its edge set are
V � fgH � j g � Hg and E � f�aH�� bH�� j aH� � bH� � aH� � �bH�+� � � g �
As an example consider the Cayley graph of the symmetric group Sn with the set of all transpo�
sitions as set of generators� The set of all rotations forms a cyclic group ZZn � Sn� The graph
#�Sn�ZZn� T � is a sensible choice for dealing with a traveling salesman problem� see sect� ����
Theorem� ��� A graph # is vertex transitiv if and only if there is a group H� a subgroup H� � H
and a set of generators + ful�lling �i� and �ii� above with + �H� � such that # � #�H�H��+��
��� A graph # is a Cayley graph if and only if its automorphism group contains a subgroup G
which acts regularly on the vertex set� Then # � #�G�+� with an appropriate set of generators�
Proof� The �rst statement is due to Sabidussi ������ the second one is proved in ���� ����
Lateron we will need a few properties of simple random walks on vertex transitive graphs� If # is
vertex transitive� let us de�ne the probability �s� that a simple random walk of s steps ends in a
vertex contained in the symmetry class ��
An explicit expression for �s� is given in ����� see sect� ������ The relation of �s� and the powers
of the adjacency matrix is also of interest� for vertex transitive graphs one �nds �����
As �X�
Ds
j�j�s�R��� def
���
X�
,s�R����
������Cayley Graphs
It is easy to see that a left multiplication of x � G by an arbitrary g � G� i�e�� the permutation
action x �� gx� is an automorphismof #�G�+�� i�e�� the group of left multiplications (G is a subgroup
of Aut�#�G�+��� By construction (G acts transitively on G� Consequently� �yz� y� belongs to the
same orbit of (G� and hence also to the same orbit of Aut�#�G�+��� as �z� e�� where e is the group
identity which we choose as reference vertex in the Cayley graph� Setting x � yz this implies
xy�� � z �� �x� y� � ��z
where �z denotes the symmetry class to which z belongs� Now consider the N�N matrices de�ned
by
G�z�xy �
�� if xy�� � z� otherwise
Lemma� The matrices G�z� form an incidence scheme G with the following properties�
�i� G�e� � I�
�ii�P
z�GG�z� � J �
�iii� G�r�G�s� � G�rs��
�iv� G�z��� � �G�z����
Proof��i� and �ii� are obvious� Properties �iii� and �iv� are checked by direct computation�
� �� �
Stadler� Towards a Theory of Landscapes
The algebra spanned by G is �isomorphic to� the group algebra of G� In particular� if G is a
commutative group� then G is an association scheme� and hGi is a commutative algebra�The matrices R��� are obtained from the matrix representation of the group algebra via
R��� �Xz� �
G�z� and (R��� �X
z�� �� ���
G�z��
An immediate consequence of this representation is the following
Lemma� Let # be a Cayley graph of a commutative group G� Then the symmetrized incidence
matrices (R��� form a symmetric association scheme�
Proof� It su�ces to observe that the matricesR��� commute� The lemma then follows immediately
from the lemma in sect� ���� �
The �Cartesian� product #� � #� of two graphs has vertex set V �#� � #�� � V �#��� V �#��� Two
vertices �x�� x�� and �y�� y�� are connected by an edge if either �i� x� � y� and x�� y� are adjacent
in #�� or �ii� x� � y� and x�� y� are adjacent in #�� It is easily checked that the product of two
Cayley graphs �G��+�� � �G��+�� is the Cayley graph �G� � G��+�� where G� � G� is the direct
product of the two groups and + � �+��fe�g�� �+��fe�g�� e� and e� being the group identities�
������Distance Regular Graphs
A connected graph # is distance regular if for any two vertices u and v� and any two integers k and
l� the numbers
s�d�kl
def��� jNk�u� �Nl�v�j
depend only on d def��� d�u� v�� that is� on the distance of the vertices u and v� The numbers s
�d�kl
are known as the intersection numbers of #� Let x by an arbitrary reference vertex� Then
� � � fxg� N �x�� N��x�� � � � � NM �x� �
is called the distance partition of # centered at x� where M � diam#� the diameter of the graph�
Distance regularity strongly restricts both the algebraic and the geometric properties of a graph�
The most important features are summarized below�
Lemma� Let # be distance regular� Then the distance matrices A�d� form a symmetric association
scheme� and A � A��� has exactly M � distinct eigenvalues�
Proof� See� e�g�� � �� Chap�����
Lemma� The sequence krdef��� jNr�x�j is unimodal and kr � kM�r for all r � M �� Thus the
average distance -d of two vertices is at least diam# ��
Proof� See� e�g�� � �� Chap�����
Distance transitivity implies distance regularity� The converse is not true� A counterexample can
be found in � �� see also ���� ��c��
� � �
Stadler� Towards a Theory of Landscapes
����Fourier Series on Graphs
A series expansion in terms of a complete and orthonormal system of eigenfunctions of the Laplace
operator is commonly termed Fourier expansion� We will adopt the same terminology here follow�
ing Weinberger�s paper ������ Thus let f � V � IR be a real valued function on the vertex set of #
and let f�sg denote a complete orthonormal set of eigenvectors of the graph Laplacian �� Thenwe call
f�x� �Xy�
by�y�x�
the Fourier expansion of f �
It will turn out to be convenient to label the eigenvectors �y by the vertices of the underlying graph
#� This is possible because the eigensystem of the �nite symmetric operator � is complete� In
general� this labeling is arbitrary�
For Cayley graphs of commutative groups �Cgcgs�� however� the eigenvectors and eigenvalues have
a particularly simple form� Let x � �x�� � � � � xm� denote the component wise representation of the
group element x which is obtained from the decompositions of the commutative group G into a
direct product ofm cyclic groups of orders Nk� The group action is represented by component�wise
addition modulo Nk�
x � y � �x� y� mod N�� x� y� mod N�� � � � � xm ym mod Nm��
The Fourier basis of a Cgcg� which coincides with a complete set of eigenvectors since Cayley
graphs are regular� are of the form ���
eg�x� � exp
���i
Xk
xkgkNk
��
and the corresponding eigenvalues are given by
*g �Xx��
eg�x� and (*g �Xx��
�eg�x� � ���
Note that in this special case we have a canonical labelling of the eigenvectors� For convenience
we recall a few basic properties of the functions ex�y��
�i� eg�x� � ex�g��
�ii� eg�x � y� � eg�x�eg�y� and eg�h�x� � eg�x�eh�x��
�iii� eg�x�e�g�x� � �� where the asterisk denotes complex conjugation�
�iv�P
x�G eg�x�e�h�x� � Ngh andP
l�G el�x�e�l �y� � Nxy� where N is the total number of
con�gurations�
These functions have the well�known form of the Fourier basis on C n� They are� of course� the
characters of the group commutative G� Except for property �ii�� which will be crucial for some
results in the following� the above statements are immediate consequences of Schur�s Lemma� and
are therefore true for the characters of arbitrary groups� see� e�g�� �����
� �� �
Stadler� Towards a Theory of Landscapes
Since � is symmetric� the Fourier basis f�yg can always be chosen real valued� it is convenient�however� to allow for complex conjugate pairs of eigenvectors� In particular� we will use the
following identity for functions on a Cgcg�
f�x� �Xl�G
alel�x� �Xl�G
a�l e�l �x��
Since we deal with a �nite vector space with a scalar product �for which we will use the notation
h � � � i in this paper�� spanned by eigenvectors f�yg of the graph Laplacian� the familiar propertiesof Fourier series� such as Parseval�s equation
kfk� � hf� fi �Xy�
hf� �yih�y � �yi
��
�
and the mean square approximation theorem hold for all landscapes on all connected graphs� For
the convenience of the reader we recall
Proposition� �Mean Square Approximation Theorem�
Consider a landscape f on # with Fourier expansion
f�x� �Xy�V
ay�y�x�
Let X be a subset of V � let
g�x� �Xy�X
by�y�x�
be an approximation to f � Then the squared approximation error kf � gk� � h�f � g�� �f � g�i isminimized by choosing by � ay � hf� �yi for all y � X�
��� Spectral Properties of the Adjacency Matrix
������Equitable Partitions
De�nition� Let � � ���� ��� � � � � �M � be a partition of the vertex set V into the cells �i�
i � �� � � � �M � � is called equitable if the number of neighbors which a vertex in � has in cell � is
independent of the choice of the vertex in �� In other words� � is equitable if for all �� � � � holds
.A��def��� jN �y� � �j �
Xx��
Axy for all y � ��
We call .A a combinatorially collapsed adjacency matrix�
There is an �M �� � N matrix associated with each partition � of V into M � cells� This
matrix will also be denote by ��
��xdef���
�� if x � �� otherwise
� � �
Stadler� Towards a Theory of Landscapes
We remark that this de�nition is the transpose of the convention in Godsil�s book � ��� while it
conforms the notation used by Bollob/as ����� Equitable partitions have been introduced by Schwenk
������ more recently they have been used by Powers and coworkers as colorations� see� e�g�� �����
����� see also ���� Chap����
Theorem� Let � an equitable partition of the vertex set V of a graph #� Then the following
statements hold�
�i� �A � .A��
�ii� If e is an eigenvector of A with eigenvalue *� then � � �e is a right eigenvector of .A with
the same eigenvalue provided � � �� For later reference we note the explicit formula
���� �Xx��
e�x�
�iii� If � is a right eigenvector of .A� then
���� ��
j�j����
is a left eigenvector of .A�
�iv� If � is a left eigenvector of .A� then �� is an eigenvector of A which is constant on all cells�
�v� j�j� .Ar��� � j�j� .Ar����
�vi� The characteristical polynomial of .A divides the characteristical polynomial of A�
�vii� If # is connected then the A and .A have the same spectral radius�
Proof� See � �� chap� ��
There is an intimate relation between the orbits of a group of automorphisms acting on V and the
equitable partitions of a graph�
Lemma� Let G � Aut�#� be an arbitrary group of automorphisms of #� Then the orbits of G
form an equitable partition �G of V �
Proof� See � �� p�����
The converse is not true� There are equitable partitions which are not induced by any automor�
phism group� For an example see � �� p����� One says that a partition �� is a re�nement of �� in
symbols �� � �� if each cell of �� is contained in some cell of �� The equitable partitions form a
lattice with respect to re�nement � �� p�����
� �� �
Stadler� Towards a Theory of Landscapes
������Equitable Partitions with a Reference Vertex
The results �vi� and �vii� on equitable partitions can be strenghtened if � ful�ls a single� simple
additional condition� An equitable partition � which has a cell �� � fug consisting of the singlevertex u will be called equitable partition with reference vertex�
Theorem� Let � be an equitable partition with reference vertex u� Then A and .A have the same
minimal polynomial� and * is an eigenvalue of A if and only if it is an eigenvalue of .A�
Proof� See ���� Thm������
As an example we note that the distance partitions of a distance regular graph as well as the orbits
of an arbitrary stabilizer subgroup Gx � Aut�#� of a vertex transitive graph form an equitable
partition of V with a reference vertex�
Lemma� Let � be an equitable partition of a graph # with reference vertex �� Then there is
always a basis f�ig of left eigenvectors of the corresponding combinatorially collapsed adjacencymatrix .A with the following properties�
�i� The eigenvectors are normalized such that ���� � ���� � ��
�ii� The left eigenvectors are orthogonal w�r�t� the scalar product ha� bi �X�
a���b���j�j�
�iii� This basis is unique if all eigenvalues of .A are simple�
Proof� The corresponding result in ���� is formulated for the collapsed adjacency matrix &A of a
vertex transitive graph� but only the properties of equitable partitions with a reference vertex are
used in the course of the proof�
A few remarks on distance regular graphs are in order here�
Lemma� Let # be distance regular and let � be a distance partition with respect to an arbitrary
reference vertex x� Then .A�d�kl � s
�d�kl �
Proof� This follows immediately from the discussion in � �� Chap�����
The lemma states that we recover the intersection numbers of a distance regular graph as the
combinatorially collapsed distance matrices� This is analogous to the relation of the incidence
matrices and their intersection numbers in Higman�s theory� although there are no group actions
involved in the case of distance regular graphs�
������The Adjacency Algebra
The adjacency algebra of a graph # is the matrix algebra spanned by the powers of the adjacency
matrix� It will be denoted by A�#�� Of course� this algebra is commutative� It is clear from
the previous section that the properties of A�#� are closely linked to the equitable partitions with
reference vertices� since its dimension coincides with the degree of the minimal polynomial of A or.A� In particular� therefore� the dimension of A�#� is bounded above by � plus the number of cells
in an equitable partition with reference vertex� On the other hand we have the following lower
bound on the dimension of the adjacency algebra�
Theorem� Let # be a connected graph with diameter diam#� Then the dimension of the adjacency
algebra A�#� is at least diam# ��
Proof� See ���� Prop������
� �� �
Stadler� Towards a Theory of Landscapes
This result suggests that equitable partitions with a reference vertex x are always re�nements of the
corresponding distance partition centered at the reference vertex x� We do not know whether this
is actually true� Another important question is whether there is always an equitable partition with
reference vertex such that all eigenvalues of .A are simple� The above discussion� along with the
striking similarity of the algebraic properties of distance regular graphs and the theory of incidence
structures seems to suggest that it might even be possible to base the investigation of con�guration
spaces entirely on equitable partitions with reference vertices instead of graph automorphisms�
Here we will return� however� to the safer grounds of vertex transitive graphs� for which Higman�s
beautiful theory of intersection numbers is applicable� since the automorphism group of a vertex
transitive graph acts by de�nition transitively on V � The incidence scheme R�#� associated with
a vertex transitive graph # is of course the one of Aut�#� acting on V � V � see sect� ���� The
algebra spanned by R�#� is usually referred to as the commuting algebra of the graph� denoted by
C�#�� Since the adjacency matrixA is a linear combination of the matrices R��� we have necessarily
A�#� � (R�#��
Theorem� Let # be vertex transitive� Then the following statements are equivalent�
�i� A�#� � C�#��
�ii� All eigenvalues of the collapsed adjacency &A matrix are simple�
�iii� The powers of A span C�#�� i�e�� all matrices R��� are polynomials in A�
�iv� The powers of &A span &C�#��
Proof� �i��� �ii��� �iv� follows immediately from � � ��������
�i� �� �iii� The matrices R��� form the basis of a vector space of dimension M �� We have
seen in section ��� that
As �X�
,s�R��� with ,s� �
Ds�s�j�j �
The coe�cients ,s� form a �M ��� �M �� matrix which can be invertible only if the number
of distinct eigenvectors of A equals the number of symmetry classes� i�e�� if all eigenvalues of the
collapsed adjacency matrix are simple� Since A�#� � C�#� the converse is also true� Hence , is
invertible if and only if all eigenvalues of &A are simple�
Property �iii� has been termend � ,�property� in ������ It seems to be of particular importance
for the theory of landscapes and random �elds� It is not known �to the author� whether the ,�
property is related to any of the well�studied graph theoretical properties of con�guration spaces�
Not all vertex transitive graphs ful�l �iii�� An example for a vertex transitive graph without the
,�property is the permutohedron� i�e�� the Cayley #�Sn�K� of the symmetric group with the setof canonical transpositions �i� i �� as generators�
� �� �
Stadler� Towards a Theory of Landscapes
���Examples of Con�guration Spaces
�����Sequence Spaces
Consider the set of all sequences of length n� which are composed of letters taken from some
�nite alphabet of size �� The canonical distance is given by the number of positions in which two
sequences x and y di"er� this metric distance measure is the Hamming distance � ��� The graph
obtained from connecting two sequences if and only if their Hamming distance is d�x� y� � � is
called the Hamming graph or sequence space Qn�� The sequence space Qn
� is the n�fold product of
the complete graph with � vertices with itself� A complete graph with � vertices can be regarded
as the Cayley graph graph of an arbitrary group G of order � with + � G n feg� Thus Hamminggraphs are Cayley graphs of commutative groups� and they are distance transitive� see e�g�� �����
Hamming graphs constitute the most common class of con�guration spaces� Their automorphism
group is well known ���
Aut�Qn�� � S� o Sn � Sn��S��n �
where Sm denotes the symmetric group on m elements�
011
0
1
00 10
01 11
000
111
0000
1111
001
100
010
110
101
Figure �� Hypercubes Qn� for n � through n � �� Vertices belonging to the same symmetry class � are marked
by a common symbol� Vertices within a symmetry class have common distance from the reference vertex�� The hypercubes are distance transitive� since their symmetry classes are de�ned by the distance fromthe reference vertex�
The following results on the eigenvalues and eigenvectors of the sequence spaces are well known�
see� e�g�� ���� �� �� � � ��� �� � ����
The eigenvalues and left eigenvectors of the collapsed adjacency matrix &A of a sequence space Qn�
are given by*p � n��� ��� p��
�p�d� ��
��� ��pnpK���n�p �d��
where K���n�p are the Krawtchouk polynomials
K���n�p �d� �
pXj��
����j d
j
� n� d
p� j
���� ��p�j �
� � �
Stadler� Towards a Theory of Landscapes
The multiplicity of *p w�r�t� the full adjacency matrix A is m�*p� � �����pnp
� all eigenvalues are
simple w�r�t� the collapsed adjacency matrix &A� The left eigenvectors �p of &A ful�ll the orthogonality
relation
h�k� �li � �n
�� � ��knk kl
with respect to the scalar product
ha� bi �nX
d��
��� ��d n
d
�a�d� b�d��
and the symmetry relation �p�d� � �d�p��
�����Generalized Hamming Graphs
The name Generalized Hamming Graph is sometimes used for direct products of sequence spaces�
They correspond to sequences where the alphabet is not the same for all positions� Such graphs
have turned out to be useful when considering the inverse folding problem for RNA secondary
structures ����� ���� An RNA secondary structure can be partioned into the unpaired regions
where each position can be realized by one of the � nucleotides G� C� A� and U� and the paired
regions� where each base pair can be realized by one of the � types of base pairs �GC� CG�
AU� UA� GU� and GU�� The set of sequences compatible with the given structure can then be
considered as the graph
C �� Qnu� �Qnp
�
where nu and np are the numbers of the unpaired positions and of the base pairs� respectively�
0
1 2
3
4 5
12
0
54
3
6 7
8 9
a b
Figure �� a� The trigonal prism graph is the smallest vertex transitive graph which is not edge transitive� Its vertexset decomposes into four symmetry classes which are the reference vertex � � f�g itself� its neighborswithin the same triangle �a � f��g� its neighbor in the other triangle �b � f�g� and the remainingvertices � � f���g which have distance two from the reference vertex�b� The Petersen graph is the smallest distance transitive graph which is not a Cayley graph of anygroup� It has three classes of vertices� the reference vertex � � f�g� its neighbors � � f��� �g� and allother vertices � � f���� ������ �g�
� �� �
Stadler� Towards a Theory of Landscapes
The simplest case of a Generalized Hamming Graph which is not a sequence space is the trigonal
prism Q� � Q�� see �gure �a� Its collapsed adjacency matrix is
&A �
�B�� � � �� � � �� � � �� � � �
�CA
The eigenvalues of &A� the corresponding left eigenvectors� and the multiplicities of these eigenvalues
in A are*� � �� � ��� �� �� �� m�*�� � �*� � � �� � ��� �������� m�*�� � �*� � � �� � �����
� � ������ m�*�� � �
*� � �� �� � ������ ���� ��� m�*�� � �
�����Johnson Graphs
The vertices of the Johnson graph J �n� k� are the subsets consisting of exactly k elements from a set
with n elements� Two vertices are adjacent if the corresponding subsets have k�� exactly elementsin common� The Johnson graphs are distance transitive� see� e�g�� � ��� The graph J �n� n �� foreven n is the natural con�guration spaces for bipartitioning problems� see sect� ������ ��� �� ���
�����Odd Graphs
The odd graphs are relatives of the Johnson graphs� The vertex set of O�n� is the set of all
�n� ���subsets of a ��n� �� set� Two vertices x and y in O�n� are joined by an edge if the subsets
corresponding to x and y are disjoint� O��� is a single vertex and O��� is the triangle graph�
The Petersen Graph O��� Figure �b� is the smallest graph which is distance transitive but not a
Cayley graph ���� The symmetry classes are the three distance classes � � f�g� � � f�� �� g� and� � f�� � �� �� ��g� with j�j � �� j�j � � and j�j � �� The collapsed adjacency matrix is
&A �
�� � � � � �� � �
�A
The eigenvalues of &A� the corresponding left eigenvectors� and the multiplicities of these eigenvalues
in A are*� � �� � ��� �� �� m�*�� � �*� � � �� � ��� �� ���
� � m�*�� � *� � �� �� � �����
� �� � m�*�� � �
Note that the multiplicities m�*i� of the eigenvalues of A are �� � and �� while the the symmetry
classes contain �� � � vertices� respectively�
The odd graphs O�n� are distance transitive� with degree n and diameter n � �� its completeautomorphism group of is
Aut�O�n�� �� S�n���
see ���� ��d�� The spectrum of is also known for all n
*k � ����k�n� k� with m�*k� �
�n� �
k
�� �n� �k � �
�
where � � k � n � � indexes the distinct eigenvalues�
� �� �
Stadler� Towards a Theory of Landscapes
�����Cayley Graphs of the Symmetric Group
Let Sn denote� as usual� the symmetric group on n elements� and let T be the set of all trans�
positions �i� j�� It is well known that the transpositions generate the symmetric group� The
corresponding Cayley�graph #�Sn� T � is hence a possible choice for the con�guration space of an�city travelling salesman problem� Little is known in general on these graphs� We will use them
here in order to explain the de�nitions in the above sections on a non�trivial example� #�Sn� T �has N � n0 vertices and is regular with degree n�n � �� �� Furthermore they are bipartite sincetranspositions change the sign of a permutation�
The cases n � � and n � � are trivial� #�S�� T � is an isolated vertex� and #�S�� T � is the connectedgraph with N � � vertices�
The �rst case of interest is #�S�� T �� see �gure � It has N � � vertices� and its diameter is
�� It coincides with the complete bipartite graph K���� which is known to be distance transitive�
Therefore the symmetry classes are the distance classes� K��� may serve as an example for the fact
that Cayley graphs of non�commutative groups can coincide with Cayley graphs of commutative
groups� Consider the commutative group with N � � elements� namely C��C�� with the notation
C� � fe� ag and C� � fe� b�-bg� It is easy to check that + � fa� ab� a-bg generates C��C�� and that
#�C� � C��+� � K��� � +�S�� T ��
1 2 3
4 5
0
Figure � The Cayley graph ��S�� T � coincides with the distance transitive graph K���� which is also obtained as��C��C��fa�ab� a�bg�� where C� � fe� ag and C� � fe� b��bg are the cyclic groups with � and � elements�respectively�
We emphasize at this point that the results presented in this paper depend only on the structure
of the con�guration space and not on the particular group representation used to construct this
graph� For instance we may regard a landscape on #�S�� T � as a landscape on #�C��C��+�� i�e��
as a landscape on a Cgcg� even though the physical model might force us to use the symmetric
group�
The adjacency matrix and the collapsed adjacency matrix of #�S�� T � are
A �
�BBBBB�
� � � � � �� � � � � �� � � � � �� � � � � �� � � � � �� � � � � �
�CCCCCA
&A �
�� � � � � � � �
�A
� �� �
Stadler� Towards a Theory of Landscapes
The eigenvalues� the corresponding left eigenvectors of &A� and the multiplicities of the eigenvalues
in A are*� � �� � ��� �� �� m�*�� � �*� � � �� � ��� ����
� � m�*�� � �*� � � �� � ������ �� m�*�� � �
The graph #�S�� T � has N � �� vertices� it is shown in �gure �� and its adjacency matrix is given
in table ��
1234
2134 3214 4231 1324 1432 1243
3124 41322143
2314 24313412
42133241 4321
1423 1342
3421 3142 4312 2413 23414123
Figure � The Cayley graph ��S�� T �� Symmetry classes with respect to the reference vertex ����� are indicatedby di�erent shadings�
A close inspection of the graph shows that there are symmetry classes� The collapsed adjacency
matrix &A of #�S�� T � is
&A �
�BBB�� � � � �� � � �� � � � �� � � � �� � � �
�CCCA �
which has the following eigenvalues and left eigenvectors�
*� � � �� � ��� �� �� �� ��*� � � �� � ��� �� ���
� � ������
*� � � �� � ��� �� ����� � ��
*� � �� �� � ������ ���
� � �����
*� � �� �� � ������ �� �����
� � �
Stadler� Towards a Theory of Landscapes
The eigenvalues of #�Sn� T � can be obtained explicitly for all n� Let � � �kl�� kl�� � � �klrr � �
���� ��� � � � � �m� be a partition of n� i�e��Pr
i�� liki �Pm
j�� �j � m� with ki � kj and �i � �j
whenever i � j� It is well known that the conjugacy classes of the Sn correspond to the partitions
of n via the cycle�decomposition of the permutations �see� e�g�� Jacobson �� � p� ���� The conju�
gacy classes of Sn are contained in the symmetry classes of the graph #�Sn� T �� see ����� Lem����The eigenvalues of #�Sn� T � have been obtained from the characters of the symmetric group� One
�nds
* ��
�
��n mX
j��
�j��� �j�j��� �
see� e�g�� ��� ��� ����
����A Concluding Remark
In the previous sections we have outlined a broad spectrum of tools for an analysis of the graph
theoretic and algebraic properties of graphs without giving �the result�� The reason for this is
twofold� �i� The study of the structure of the con�guration spaces is interesting in itself and provides
the necessary basis for a wide range of models beyond the theory of landscapes� see for instance
����� ���� �ii� In the investigations reported in the subsequent chapters of this contribution we
will frequently require certain algebraic properties of the matrices R���� for instance� we will need
for some proofs that the (R��� form an association scheme� and for other results we will have to
require that all eigenvalues of the collapsed adjacency matrix are simple� Let me just assure the
reader that all of the theory of landscapes discussed below works just �ne on the most important
type of con�guration spaces� the Hamming graphs� On the other hand� most of it is still under
construction for the more irregular classes of graphs� in particular for the Cayley graphs of the
symmetric group�
� �� �
Stadler� Towards a Theory of Landscapes
��Random Fields
����Preliminaries
������Denition
Many of the model landscapes mentioned in the introduction contain a stochastic element� a
particular instance is generated by assigning a usually large number of parameters at random�
This procedure suggests the following
De�nition� The set ff � C � IRg together with a measure ���f f g forms the probability space 1�which we will call a random �eld on C ���
The measure ��� can be recast in the form P �c�� c�� � � � � cN � which is the probability that for all
con�gurations xi holds simultaneously f�xi� � ci� where ci � IR� and N is the total number of
con�gurations� Then the expected value of a random variable X de�ned on the random �eld is
given byRX d��� which takes the form
E �X� �ZIRN
X dP �c�� � � � � cN � �
We will restrict the use of the term landscape to mappings f � C � IR� Therefore� an element of a
random �eld on C is a landscape�
������Gaussian Random Fields
The well�known Gaussian probability density in IR is
gm�� �x�def���
�p�� �
exp
� �
����x�m��
��
The corresponding measure is ����m���� def��� gm�����L� where ���L denotes the Lebuesgue measure�
The degenerate case ����m� �� is by de�nition the Dirac measure centered at m� ����m���� is called
a Gaussian measure for all m and �� In the N �dimensional case one de�nes a measure ��� the be
Gaussian if for any linear map h � IRN � IR the measure h����� is Gaussian� It is uniquely de�ned
by the vector �m of means and the nonnegative de�nite covariance matrix C� We will say a random
�eld is Gaussian if its probability measure is Gaussian� �����m�C�� If C is positive de�nite there is a
probability density function
g�m�C�x�def���
�p��
N
�pdet C
exp
����x� �m�C���x� �m�
�
such that �����m�C� � g�m�C���L�
� � �
Stadler� Towards a Theory of Landscapes
������Averages
In many cases of practical importance� however� we are not given the random �eld� instead we have
only a single instance �i�e�� a landscape� and little or no clue from what kind of a random �eld it
might have been drawn� This is the case� e�g�� for the landscapes of RNA and protein folding� viral
adaptation� and for some technical optimization problems such as the �low autocorrelated string
problem� � �� In this situation we have to be content with averages over values taken from our
single instance� We will use the following notation� E � � � denotes averages over random �elds� whileangular brackets h i denote averages over con�gurations in a landscape�� For example we have
Var�f�x�� � E �f�x���� E �f�x��� and ��var�f � � hf�i � hfi��
where the �rst average is taken over all sample functions of the random �eld f evaluated at a �xed
position x � C� while the second average runs over all vertices x in a �xed instance f � The averages
over con�gurations in a single landscape are of course merely well de�ned �nite sums� In practice�
however� one has to resort to Monte�Carlo sampling techniques in order to evaluate these mean
values for a problem of practical interest� In particular we have
hfi def���
�
N
Xx�V
f�x��
which gives a precise meaning to the angular brackets�
Of course the two variances Var�f�x�� and �� are not the same in general� This can be seen� for
instance� from the following �trivial�
Example� Consider a �degenerate� Gaussian random �eld with E �f�x�� � � for all x and
E �f�x�f�y�� � � for all x and y� A sample function drawn from this random �eld is almost
always constant since the correlation of any two points is �� The constant value -f of this �at
landscape� however� is drawn from a Gaussian distribution with mean zero and unit variance� In
fact� Var�f�x�� � � for all x� while the empirical variance measured on a sample function is almost
always �� � � since almost all sample landscapes drawn from this random �eld are completely �at�
If� for a given quantity X� both averages give the same result in a particular model �at least in the
limit of in�nite system size�� one says that X is a self�averaging quantity ���� ����
�This notation should not be confused with h � i or h � i which are used for scalar products�
� �� �
Stadler� Towards a Theory of Landscapes
����Karhunen�Lo�eve Decomposition
Recall that a random �eld on # is a probability space 1 � �ff � C � IRg� ����� An importantcharacteristic of 1 is its covariance matrix C � �Cxy�x�y�V � which is de�ned element�wise by
Cxy � E �f�x�f�y�� � E �f�x��E �f�y���
Denote by f�sg a complete set of orthonormal eigenvectors �which exists by symmetry of C��Although f�sg can be chosen real� we will admit complex vectors as well� Then the random �eld
f on # can be represented in mean square sense as
f�x� $�Xy�
ay�y�x�� i�e�� E�� f�x� �
Xy�
ay�y�x�
���� � � �
This series representation is known as the Karhunen�Lo�eve decomposition of the random �eld 1� It
coincides for �nite sets with the well known principal component analysis introduced by Hotelling
in � ����� see also ������ Its most important property is
Theorem� ���� The coe�cients ay are uncorrelated with respect to the measure ���� i�e�� E �axa�y� �E �ax�E �a�y� if x � y�
����The Markov Property
Properties related to the Markov property of time series have been �rst studied in the context of
spatial stochastic processes� There are two non�equivalent de�nitions of nearest neighbor models
in the literature� one due to Bartlett ��� sect� ���� based on conditional probabilities� and the other
one due to Whittle ���� based on a particular product form of the joint probability distribution
P ��c�� These two approaches have been linked in the early seventies by the Hammersley�Cli"ord
theorem� which we will discuss below�
Let p�c�� c�� � � � � cN � be a probability density function �or� if the number of possible states ck is
countable� the probability for the f�xi� � ci for all i�� Recall that in the continuous case we have
p�c�� c�� � � � � cN � ��N
�c��c� � � ��cnP �c�� c�� � � � � cN �
in terms of the cummulative probabilities used above�
De�nition� A random �eld 1 on a graph # has the Markov Property if the conditional probability
density
p�cxjc�� c�� � � � cx��� cx��� � � � cN �
depends for each x � V only on the neighbors of x� that is� on the values cy of all all vertices
y � N �x��
Theorem� �Hammersley�Cli"ord�
Let p��c� � � be an absolutely continuous probability density function �in the continuous case� or
� �� �
Stadler� Towards a Theory of Landscapes
the probabilities of the states �c in the discrete case�� Then the following holds�
The random �eld 1 is Markovian if and only if there is a function
Q��c� def��� g�
NXi��
cigi�ci� Xi�j
cicjgij�ci� cj� Xi�j�k
cicjckgijk�ci� cj� ck� � � �
ful�lling p��c� � exp�Q��c�� Rexp�Q��c��d�c such that gi��i�� �ip vanishes identically whenever the
subgraph of # induced by vertex set fxi� � xi�� � � � � xipg is not complete� i�e�� if not all pairs of thesevertices are edges in #�
Proof� The original Proof by Hammersley and Cli"ord ����� has never been published� A
detailed discussion can be found in Besag�s paper ��� A proof for discrete variables can be found
in � ��� Moussouris �� gives three di"erent proofs and shows that the positivity condition cannot
be omitted� Less general results for regular lattices are described in �� � ����
The denominatorRexp�Q��c��d�c is reminiscent of the partition function in statistical physics� A
very detailed theory is available for stationary Gaussian Markov time series� It remains to be seen
if a comparably rich and interesting structure can be developed also for the class of Markovian
random �elds on graphs� A simple result in this direction will be discussed at the end of the
following section�
���� Isotropy
������Characterization of Isotropic Random Fields
De�nition� A random �eld on a graph # is isotropic if and only if
�i� E �f�x�� � a� for all con�gurations x � #��ii� Suppose the pairs of con�gurations �x� y�� �u� v� belong to the same symmetry class ���
Then E �f�x�f�y�� � E �f�u�f�v���Remark� The notion of isotropy for random �elds is analogous to the de�ntion of stationarity for
stochastic processes� Following the conventions of Karlin and Taylor ��� our notion of isotropy
should be called �covariance isotropic�� �weakly isotropic�� or �wide sense isotropic�� Weinberger�s
����� de�nition corresponds to �strictly isotropic�� For a Gaussian random �eld the notions of
�weak� isotropy and strict isotropy coincide�
Lemma� Let # be a vertex transitive graph� Then a random �eld on # is isotropic if and only if
�i� E �f�x�� � a� for all x � V � and
�ii� there exist a constant C�� � Var�f�x�� and a real valued function � of the symmetry classes
with ���� � � such that
C � C��
X�
����R����
Proof� This is a simple rewriting of the above de�nition� observing that all entries in the covariance
matrix belonging to a �xed symmetry class � are the same and correspond to the non�zero entries
of R����
� �� �
Stadler� Towards a Theory of Landscapes
Note that by symmetry of the covariance matrixC we have ���� � ������ i�e��C � C��P
�� ��(��R�����
The function ���� is called the autocorrelation function of the random �eld� It will be discussed in
section ��
Theorem� Let # be a vertex transitive graph for which the matrices R���� form a symmetric
association scheme� and let 1 be an isotropic random �eld on #� Then the adjacency matrix A
of # and the covariance matrix C of the random �eld f commute� i�e�� Fourier decomposition and
Karhunen�Lo2eve decomposition coincide�
Proof� By assumption there is a commutative algebra h (Ri spanned by the matrices R����� Since
C is a linear combination of these matrices we have C � h (Ri� Of course A is contained in this
algebra as well� and hence AC � CA�
Remark� The case of Cgcg is dealt with in ������ The case of distance transitive graphs is proved
in ������ and an extension to vertex transitive graphs for which the commuting algebra coincides
with the adjacency algebra is discussed in ������
As a consequence we immediately conclude that the Fourier coe�cients are uncorrelated for an
isotropic random �eld on a vertex transitive graph with the ,�property� see sect� �� �� A more
detailed result can be obtained for isotropic landscapes on a Cgcg�
Theorem� A random �eld on a Cgcg is isotropic if and only if
�i� E �al� � � for all l � �� the coe�cient a� is arbitrary�
�ii� The coe�cients are pairwise uncorrelated� E �akal� � E �jalj��kl��iii� E �jalj�� � V ��� depends only on the symmetry class � to which l belongs�
Proof� A complete proof is given in ����� based on ������
Note that this theorem depends on the fact the we can relate the eigenfunctions ep�x� directly with
symmetry classes� This is not possible� however� for more general graphs ������ The relation of
Fourier coe�cients and isotropy on more general graphs certainly deserves attention in forthcoming
investigations�
������Landscapes on the Hypercube and the p�Spin Models
The vertices of a Boolean hypercube are the sequences of length n taken from an alphabet of size
� � �� Without loosing generality we may use the alphabet f ����g� A con�guration is then astring � of �spins� �k � f ����g� An alternative encoding uses a binary string x� with xi � f�� �g�The following result is well known in the literature�
Lemma� Any landscape f on the Boolean Hypercube can be written as
f��� � J� nX
p��
Xi��i�� �ip
Ji�i� ip�i��i� � � ��ip �
where the Ji�i� ip are constants�
Proof� See� e�g�� ����� �����
The p�spin Hamiltonian
Hp��� �X
i��i�� �ip
Ji�i� ip�i��i� � � ��ip
� � �
Stadler� Towards a Theory of Landscapes
was introduced by Derrida ��� in order to bridge the gap between the SK model ������ which is
the special case p � � and the random energy model ��� �� �� ��� The coe�cients Ji�i� ip
are i�i�d� Gaussian random variables with mean � and unit variance�� The autocorrelation func�
tion of the p�spin Hamiltonian Hp��� is simply � � �p for all p ���� Finally we remark that
�q���def��� �i��i� � � ��ip is of course only an alternative representation of the Fourier basis vectors
eq�x� on the Boolean hypercube�
������Autocorrelation Functions of Isotropic Random Fields
As usual let # be a vertex transitive graph� Consider a simple random walk fx�� x�� � � �g on #�see sect� ����� Weinberger ����� has suggested to use the time series obtained by evaluating the
random �eld at each step in order to gather information on the random �eld itself� The correlation
function along such a time series is de�ned by
r�s� �E �f�xt�s�f�xt��� E �f�xt�s�f�xt��p
Var�f�xt�s��Var�f�xt���
For isotropic random �elds this reduces to
r�s� �E �f�xs�f�x���� E �f�x����
Var�f�x����X�
�s����� �
In the light of this equation it is not surprising that there is a simple relation between the auto�
correlation functions ���� and r�s��
Theorem� Let # be a vertex transitive graph and consider an isotropic random �eld on # with
correlation functions ���� and r�s�� respectively� Then�
�i� r�s� � �s if and only if � &A � *��
�ii� Let f�pg be the orthonormal system of left eigenvectors of &A described in section ���� We
have r�s� �P
p bp�p if and only if ���� �P
p bp�p� Of course� such a decomposition always
exists�
Proof� This theorem is the content of �����
An immediate consequence is the following surprising relation between eigenvalues and eigenvectors
of a large class of graphs�
Corollary� Let # be symmetric� i�e�� assume that # is vertex transitive and that it has a symmetry
class
�� � f �x� y� j d�x� y� � � g
consisting of all pairs of neighbors� Then �p��� � �p�
Proof� See ������
�In Derrida�s original formulation the variance was chosen to be S�p � p��np� such that the variance of the Hamil�
tonian itself is independent of n�
� � �
Stadler� Towards a Theory of Landscapes
������Gaussian Markovian Isotropic Random Fields
A stationary Gaussian Markov process in IR� a so�called Ornstein�Uhlenbeck process or AR���
process� has an autocorrelation function of the form ��t� � exp��at�� Gaussian Markovian isotropic
random �elds present an immediate generalization� Hence we are interested in the form of their
covariance matrices� For simplicity we will assume that the Gaussian distribution is non�degenerate
�i�e�� that the covariance matrix C is invertible� and that the con�guration space # is a symmetric
graph�
Theorem� Let # be symmetric and let 1 be a Markovian Gaussian isotropic random �eld on #�
Then its covariance matrix is of the form
C � a��I �A���
Proof� Consider the function Q��c�� Since 1 is Gaussian we have
Q��c� � ���
��c� �m�C����c� �m�
where �m is the vector of expected values mx
def��� E �f�x��� Isotropy implies �m � m��� Without
loosing generality we can assume therefore that m� � �� The Markov property now requires that
�C���xy � � unless x � y or x and y are neighbors in #� Since C is an element of the commuting
algebra of # so is C��� i�e�� C�� must be a linear combination of the matrices R���� Symmetry of
# implies that the identity I and R��� � A are the only R��� matrices which have non�zero entries
only in the diagonal and for pairs of neighbors� Thus the covariance matrix must be of the form
C�� � b�I b�A�
���Homogeneity
The de�nition of isotropy becomes void if the graph # does not have symmetries� In fact� almost
all graphs have only the trivial group of automorphisms� Nevertheless� it is possible to consider
random �elds and their correlation structure on such objects� To this end we introduce the following
De�nition� A random �eld 1 on a graph # is homogeneous if
�i� E �f�x�� � a� for all x � V � and
�ii� E �f�x�f�y�� � E �f�u�f�v�� whenever d�u� v� � d�x� y��
Note that isotropy and homogeneity are the same thing if # is distance transitive�
Homogeneous random �elds play a special role on distance regular graphs� Isotropy is in general
trivial on this class of graphs� since distance regular graphs need not even be vertex transitive� In
particular� the main result of sect� ��� holds for homogeneous random �elds on distance regular
graphs� In general� however� isotropy proves to be the more powerful concept for deriving inter�
esting theorems� In particular� the condition for obtaining exponential autocorrelation functions
along simple random walks on a non distance transitive graph requires in general di"erent covari�
ances for pairs of vertices in di"erent symmetry classes which may well belong to the same distance
class� Thus there will in general be no homogeneous random �elds with this property�
� � �
Stadler� Towards a Theory of Landscapes
��� Superpositions of Random Fields
�����Denition
Note that we regard a p�spin model as random �eld on the Boolean Hypercube� For the next result
we have to state precisely what we mean by a �sum� of random �elds�
De�nition� Let 1i � �ff � V � IRg� ���i� be random �elds on #� The superposition of two random�elds on # with �xed coe�cients a� b � IR is the probability space
a1� b1�def��� �ff � V � IRg� ����� with �����f� �
Zg
������
ag������
�
b�f � g���
The e"ect of this de�nition is that elements of the probability spaces 1i are added as independent
random variables�
Theorem� A Gaussian isotropic random �eld on the Boolean hypercube is a superposition of
p�spin models with independent coe�cients�
Proof� See ������
�����The Random Energy Model
The results derived in the previous section allow us to calculate a �spectrum� 3�� � 3� of the
autocorrelation functions� ��d� �Pn
���3����d��
We consider here a random �eld on a vertex transitive graph� where the values f�x� are i�i�d�
random variables �see� e�g�� � ��� This Random Energy Model �REM� introduced by Derrida ���
�� �� has been applied to a variety of problems� in particular to the maturation of the immune
system ���� ����
Lemma� Let # be vertex transitive� The REM is isotropic and has autocorrelation function
���� � � for all � � ��Proof� See ������
As a consequence a Gaussian REM on a Boolean hypercube � that is� Derrida�s original model � is
a superposition of p�spin models� Derrida argued that the REM is the limit p �� of the p�spin
models� The following theorem makes the sense in which this is true more precise�
Theorem� Let # be vertex transitive� Then the spectrum of the REM is
3�� ��
h��� ��i
On a Boolean hypercube Sn� we have explicitly� 3�p� ��
�n
n
p
��
Proof� See ������
Hence the REM on the Boolean hypercube can be represented as a superposition of a �continuum�
of p�spin models with p � n ��
� � �
Stadler� Towards a Theory of Landscapes
�����Nk Models
The Nk model assigns a real valued ��tness� to the bit string b by �rst assigning a real valued
��tness contribution�� fi � to the ith bit� bi� in b� Each such assignment depends� not just on i
and the value of bi� but also on � � k � n other bits� which we call its �neighbors�� The �tness
contribution of each site is a random function� fi�bi�� of the substring� bi� formed by the ith bit
and its k neighbors� fi�bi� is assigned by selecting an independent random variable from some
distribution� such as the uniform or Gaussian distributions� for each of the �k�� possible values of
bi� thus generating a ��tness table� for the ith site� There is a di"erent� independently generated
table for each of the n sites� Then� given any string of n bits� the total �tness of the string� f � is
de�ned as the average of the �tness contributions of each site� that is�
f�b� ��
n
nXi��
fi�bi��
The Nk model comes in di"erent ��avors� depending on the choice of neighbors in�uencing a
particular site �tness� The simplest ) but not the only ) way of choosing neighbors� at least for
even k� is to use the k sites adjacent to site i� that is� the bits at sites i � k � through i k ��
As in the original formulation of the model� we introduce periodic boundary conditions to assign
neighbors to sites i with i � k � and i � n � k �� In other words� we assume that the sites are
arranged in a circle� such that site n is next to site �� �Periodic boundary conditions are chosen
because they minimize chain length dependent end e"ects and because we are interested in bulk
properties only�� This choice of neighbors gives rise to a class of short range spin glasses� We will
call this arrangement the �adjacent neighborhood� model� AN� Alternatively� we could assign the
neighbors by randomly selecting� for each site i� k other sites� This assignment of neighbors makes
the model similar to a long range� dilute spin glass� It will be referred to as �random neighborhood�
model� RN� In a third variation we drop the requirement that fi depends on bit i� This version
will be called �purely random� model� PR� The Nk model reduces to the REM for k � � n� see
e�g�� �����
Lemma� The autocorrelation functions of the Nk model with random� purely random� and adja�
cent neighborhood� respectively are given by
�RN �d� � ��� d
n���� k
n � ��d
�PR�d� � ��� k �
n�d
�AN �d� � �� k �
nd
�nd
min�k�n���d�Xj��
�k � j ��
n� j � �
d� ���
Proof� For a proof see� e�g�� the appendix in �����
Lemma� The autocorrelation function of the adjacent neighbor Nk model� �AN � is a polynomial
of degree k �� Its autocorrelation function is therefore of the form
�AN �d� �k��Xp��
3p�p�d� �
� �
Stadler� Towards a Theory of Landscapes
0 10 20 30 40 50 60 70 80 90 100Mode p
10-200
10-180
10-160
10-140
10-120
10-100
10-80
10-60
10-40
10-20
100
A(p
)
PRRNAN
0 10 20 30 40 50 60 70 80 90 100Mode p
10-60
10-50
10-40
10-30
10-20
10-10
100
A(p
)
PRRNAN
Figure �� Spectral decompositions of Nk models on Boolean hypercubes with n � ��� The logarithmic plotsemphasize that the two random neighborhood Nk models involve all modes � � p � n for all k while theAN models are superpositions of the modes � � p � k � n�
Proof� See ����� Thm�����
The coe�cients 3�� can be obtained explicitly for sequence spaces� if the correlation function ��d�
is known�
3�� �h��� �ih��� ��i �
n0
�n
nXi��
��i�
pXj��
����j��� ��p�i�jj0�i � j�0�p� j�0�n j � i� p�0
For Nk models this expression has been evaluated numerically� results are shown in �gure ��
Weinberger and Stadler ��� concluded based on a comparison of correlation lengths� that Nk
models roughly resemble p�spin models with p � �k �� �� This view is supported by the spectra
of the Nk models showing that the dominating modes are those centered around -� � �k �� � for
all three versions of the Nk model ������ The convergence of Nk models and p�spin models is similar
to the case of the p�spin models and the REM� If k scales linearly with n� i�e�� if �k �� n� � � ��
then we expect that the spectrum in terms of the scaled variables � � p n will be concentrated at-� � � � in the limit n ���
�����Superposition of Nk Models
We have seen that all isotropic random �elds on the Boolean hypercube can be constructed by
superpositions of p�spin models� Kau"man�s Nk�models cannot be used for this purpose� Let
fNk�x�g denote a set of Nk models with parameter k� such that
E �Ni�x�Nj�y�� � E �Ni�x��E �Nj�y�� � �
whenever i � j� i�e�� we suppose that the entries in the �tness tables are uncorrelated also between
the random �elds� Given the construction of the Nk model this is the natural assumption� Then
we have the following
� � �
Stadler� Towards a Theory of Landscapes
Theorem� Let 1 be an isotropic random �eld of the form 1 �kmaxXk��
�kNk� i�e�� 1 is a superposition
of Nk models� Then 3�p� � � for all p � kmax �� Furthermore 3�p� � � for all p � n if at least
one of the Nk models Nk is an RN or a PR version of the Nk model�
Proof� The result is obtained by a direct calculation of the covariance matrix� see ������
Corollary� A p�spin model cannot be represented as a superposition of Nk models for all p � ��The empirical correlation functions of the ��spin model and the Nk�model with k � � coincide� The
empirical correlation function of a p�spin model with p � � cannot be modeled by a superpositionof Nk models�
�� �Transformations
������Operators on Landscapes and Random Fields
Let f � C � IR be a landscape on C and let F � RjV j � RjV j be a vector �eld� Then we explain
F �f � � C � IR component�wise as
F �f ��x� def��� �F �f�x��� f�x��� � � � � f�xN � �x �
i�e�� we interpret F as an operator acting on the landscape f � Before we proceed we brie�y introduce
the two most common examples�
�i� The averaging �or smoothing� operator % is de�ned in the above notation as
%�f ��x� def���
�
� N �x�
��f�x�
Xy�N�x�
f�y�
�A �
�
� N �x���I A�f �x�
% is of course a linear operator� its e"ect is averaging the �tness values over a ball of radius
�� Consequently it amounts to applying the matrix �I D����I A� to the vector of �tness
values�
�ii� Let � � IR � IR be an arbitrary function� Then ��f � is explained as the composition of f
and �� i�e��
��f ��x� def��� ��f�x���
Now let 1 � �ff � C � IRg� �� be a random �eld on C� Then
F �1� def��� �fF �f � � C � IRg� ��
is again a random �eld on C� In the following we will brie�y discuss some properties of the random�elds F �1� which are obtained from a simple random �eld 1 by means of the two types of operators
described above�
� �
Stadler� Towards a Theory of Landscapes
������Averaging and Iterated Smoothing Landscapes
The basic properties of linear transformations of random �elds are compiled in the following
Theorem� Let C be the covariance matrix of a random �eld 1 and let 3 be a linear symmetric
operator�
�i� The covariance matrix of 4 � 3�1� is given by C� � 3C3�
�ii� If 1 is isotropic and # is a vertex transitive graph for which the matrices (R��� form a
symmetric association scheme� then C� � �3��C�
�iii� If # is a in �ii� and 3 � A�#� �that is� 3 is a polynomial in A�� then 4 � 3�1� is again
isotropic on # and �� � c � &3�� where the constant c � � �&3������ is chosen such that
����� � ��
�iv� Under the assumptions of �iii� holds ����� � c �X�
a�P����������� where �� denotes the
eigenvalue of &A belonging to �� � In particular� if � � �j for some j� then we have �� � ��
i�e�� eigenfunctions of &A remain unchanged�
Proof� See ������
Let us now consider the smoothing operator % def���
�D�� �A E�� Suppose # is distance transi�
tive� Then we obtain as an immediate consequence of the above theorem the following explicit
representation of the autocorrelation function
���d� �
P�k��� �k�d���d k�P�
k���k�����k�
where �k�d� � �&%��d�d�k � The coe�cients have a simple combinatorial interpretation� �k�d� is the
number of pairs �u� v� with u � N �x�� v � N �y� with d�u� v� � d k where d�x� y� � d is �xed�
For particular graphs # it is fairly easy to calculate the coe�cients �k�d� explicitly� On Hamming
graphs� for instance� one obtains �����
����d� � d�d� ������d� � �d ��� ����d� ��d���d� � � ��� ���n �d�n� d�� ��� ����d d�d� ����� ���
����d� � ���� ���n � d� ��� ����� ���n� d���d ��
����d� � ��� ����n � d��n� d� ��
Let 1� be the random energy model� The autocorrelation function is ��d� � ��d� The correspond�
ing empirical correlation function is &���� � � and &��d� � �� �N ��� for d � �� respectively� where
N denotes the number of points in the con�guration space� see sect� ���� De�ne 1q � %�1q���� Let
&��q� denote the empirical autocorrelation function expected for an instance of the random �eld 1q�
We will refer to this family of landscapes as iterated smoothing landscapes� ISLs� The numerical
data shown in �gure � indicate that they form indeed a family of tuneably rugged random �elds�
just like the Nk models� In particular� we have the following
Theorem� Let # be a generalized hypercube over an alphabet with � � � letters� Then
limq
&��r��d� � �� �
n
�
�� �d�
� � �
Stadler� Towards a Theory of Landscapes
0 10 20 30 40 50 60 70 80 90 100Hamming Distance d
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
1.0
rho(
d)
0 10 20 30 40 50 60 70 80 90 100Hamming Distance d
-1.0
-0.8
-0.6
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
1.0
rho(
d)
a� b�
Figure �� Autocorrelation function of ISLs on generalized hypercubes with a� ���� and b� ��� for with n����� Thenumber of smoothings are a� r��� �dotted�� r��� �short dashed�� r��� �long dashed�� r���� �dot�dashed��r���� �solid�� and b� r��� �dotted�� r���� �short dashed�� r���� �long dashed�� r���� �dot�dashed�� andr���� �solid�� respectively�
On a Boolean Hypercube �� � �� we have
limq
&��r��d� �n
n ���� �d
n�
�
n �����d�
Proof� See ������
We remark that the contribution of &�n decreases with the size of the con�guration space� The
limiting autocorrelation function corresponds to both the trivial spin glass model with Hamiltonian
H��� �Pj Aj�j� and to the Nk�model with k � �� We also note that for q n� � the landscapes
are essentially uncorrelated� i�e�� the correlation length is o�n�� Numerical estimates show that the
nearest neighbor correlation &��q���� depends only on the ratio q n for large n� see ����� for details�
Instead of starting with a REM one can as well apply the averaging operator to spin glass and Nk
models� For p�spin models one �nds
Theorem� Let 3 be any polynomial of the adjacency matrix of the Boolean Hypercube� Then
the landscapes Hp and 3�Hp� have the same autocorrelation functions�
Proof� See ����� Thm�����
In contrast to the p�spin models� the landscapes of Nk type are a"ected by the smoothing operator�
Theorem� Let f be an arbitrary Nk landscape� Then the autocorrelation function of the land�
scapes %r �f � converges to ��d� � ��� � �d n� �� � ������d with � � � � � as q tends towards
in�nity�
Proof� See ����� Thm�� ��
� � �
Stadler� Towards a Theory of Landscapes
The variants of the Nk model do not behave identically under the action of %� Whenever the
autocorrelation function is a polynomial of degree less than n� then we have � � � in the theorem
above� For exact expressions of the autocorrelation functions of various Nk models see sect� ����
The theorem holds with � � � for all alphabets with � � letters�
������Non�Linear Transformations
Transforming a landscape or a random �eld with a non�linear function is important for instance
in �bio�physical chemistry� since the chemical reaction rate k and activation energies �G�� are
related by Arrhenius� law ����� k � A exp���G�� RT �� where R is a universal constant and T is
the temperature� Consider now a �xed type of chemical reaction� say binding to a �xed target�
Then �G�� will be sequence dependent� and thus it forms a landscape� Consequently the reaction
rate constants form a landscape as well� If we assume� for simplicity� that the pre�exponential
factor A is not sequence dependent� we observe immediately that both landscapes have the same
geometry since the exponential function is monotonic and thus maps local optima to local optima�
see also sect ��� We will see in the following that the correlation structure� however� does not
remain unchanged�
As an example we consider here the correlation function of an exponential transformation F �z� �
exp�qz� of a Gaussian isotropic random �eld with covariance matrix C� It is convenient to de�ne
the correlation coe�cient ��x� y� def��� var�f ���Cxy� The covariance of the transformed random �eld
is given by
C�xy � E �F �f�x��F �f�x���� E �F �f�x���E �F �f�x��� �
For Gaussian random �elds these expectation values are simple Gaussian integrals which can be
evaluated explicitly� The details can be found in ����� The �nal result is
���x� y� �a��x�y� � �
a� � �
where a � eq�
depends on the parameter q in the transformation� The function f�t� � at��a�� is
concave for all t and all a � �� i�e� all q � �� and furthermore f��� � � and f��� � �� It follows
immediately that j��x� y�j � j���x� y�j whenever ��x� y� � �� �� or ���Suppose the correlation function is of the form ��d� � � � �
�d o�d�� where is the correlation
lenght� which will be discussed in sect� ����� in detail� A simple calculation then shows that ���d�
has the same form� with correlation length
� �a� �a loga
� �
q�
for large values of q� Thus the a�dependent pre�factor becomes very small for large absolute value
of q� Thus an exponential transformation can lead to a random �eld with very small correlation
without changing the rank order of the �tness values� and thus without disturbing the distribution
of local optima�
� � �
Stadler� Towards a Theory of Landscapes
��Landscapes
Let us now consider individual landscapes instead of random �elds� We will suppose that we havea means of computing �or measuring� the value of the landscape f � V � IR for all con�gurationsx � V � This means that we have now a �xed matrix of interaction coe�cients in spin glass modelor a �xed matrix of bond lengths for a TSP� Models for biologically important landscapes will bediscussed in section �
����Empirical Correlation Functions
������Characterization of Empirical Correlation Functions
The empirical autocorrelation function of a landscape on a vertex transitive graph is de�ned as��� ��� ��� ���
&���� def���
hf�x�f�y�i�x�y���� � hfi�hf�i � hfi� �
Of course� the autocorrelation function is invariant under the transformation f � f�hfi� Thereforewe can assume without loosing generality hfi � � for the reminder of this chapter� Under thisassumption we may rewrite the de�nition above in the form
&���� ��
j�jhf�R���fihf� fi �
where h � � � i denotes as usual the standard scalar product on Euclidean vector spaces� Of course wehave &���� � &����� in complete analogy with the correlation functions of isotropic random �elds�In fact� the above de�nition tacidly assumes that the landscape is �isotropic� in a certain sense�since we average over entire symmetry classes�
The appropriate de�nition of a correlation function on a distance regular graph is analogous tohomogeneous landscapes�
&�h�d�def���
hf�x�f�y�id�x�y��dhf�i �
�
jNdjhf�A�d�fihf� fi �
where we have again used hfi � �� Note that for distance transitive graphs both de�nitionscoincide�
In the following we characterize the set of all possible empirical autocorrelation functions forsu�ciently symmetric con�guration spaces�
Theorem� Let f��g be an orthogonal basis of left eigenvectors of the collapsed adjacency matrixof a Cgcg #� Then &� is an autocorrelation function of a landscape on # if and only if
&� �X�
3���� 3� � �� 3� � ��X�
3� � ��
The coe�cients 3� can be obtained from the Fourier coe�cients of f �
3� �
Pg�� jagj�Pg�G jagj�
�
Proof� See ����� Thm� ��
As an immediate consequence� all empirical autocorrelation functions ful�lX�
&����j�j � ��
� �
Stadler� Towards a Theory of Landscapes
������Simple Random Walks on Landscapes
Before we proceed to landscapes on more general graph let us consider the empirical correlation
function along a simple random walk� The geometric relaxation of such a random walk is conve�
niently described by the probabilities �s�� de�ned in section ���� that a random walks of length
s ends in symmetry class �� On a vertex transitive graph one obtains ����
�s� �X�
j�j �����h��� ��i �s��
An analogous formula holds for distance regular graphs� with the distance classes replacing the
symmetry classes� For instance� on a sequence space Qn� we obtain explicitly
�sd �nX
p��
K���n�p �d�
��� ��pnp�n
�� �
�� �p
n
�s�
A simple random walk fx�� x�� � � �g induces a time series ff�x��� f�x��� � � �g on a landscape f � The
autocorrelation function of this time series is de�ned by
&r�s� def���
hf�xt�f�xt�s�it � hfi�hf�i � hfi� �
Without loosing generality we assume as above that hfi � �� Clearly the denominator is just thevariance of the landscape� �� � hf�i� The landscape autocorrelation &���� and the random walk
autocorrelation are related by
&r�s� �X�
�s�&���� �
see� e�g�������� The relation between the correlation functions &� and &r is completely analogous to
the relation of � and r in section ���� In particular� we have the following
Theorem� Let # be a Cgcg with an adjacency matrix with eigenvalues D�� and correspond�
ing left eigenvectors ��� Then &r�s� is an autocorrelation function of a simple random walk of a
landscape de�ned on # if and only if
&r�s� �X�
3��s�� 3� � �� 3� � ��
X�
3� � ��
The coe�cients are the same as for the correlation function &��
Proof� See ����� Thm����
The eigenvalues of the transition matrix T are explicitly known for sequence spaces�
�d �*dD� �� d
n
�
�� � �
� �� �
Stadler� Towards a Theory of Landscapes
������General Vertex Transitive Graphs
Let us denote the set of indices of eigenvectors �p belonging to the same eigenvalue (*i of � by
L�i�� Recall that a vertex transitive graph has the ,�property if and only if all eigenvalues of its
collapsed adjacency matrix are simple
De�nition� Let # be vertex transitive with the ,�property� and let f�yg be a Fourier basis� Thende�ne
�i��� ��
j�jh�y � R����yih�y � �yi �
where y � L�i��
Theorem� Let f be a landscape on a vertex transitive graph # which has the ,�property� or a
distance regular graph� Then its empirical autocorrelation function is of the form
&���� �Xi
�Pq�L�i� a
�qP
q ��� a�q
��i���
Proof� See ����� Thm��� for the case of vertex transitive graphs with the ,�property� The case of
distance regular graphs can be dealt with analogously�
For Cayley graphs of commutative groups we have of course �i � �i for all i� Furthermore� it can
be shown that this is also true for a number of examples including the Petersen graph and the
Cayley graph #�S�� T �� see ������ This� and the very form of the above decomposition� strongly
suggests the following
Conjecture� Let # be a vertex transitive graph with the ,�property� Then �i � �i�
We have not been able to �nd a counter example to this conjecture�
������Correlation Length
In order to easily compare di"erent landscapes� or random �elds� it is desirable to reduce the infor�
mation contained in the correlation functions to single number� Most of the emprical correlation
functions &r�s� which have been computed so far are at least approximately decayin exponentials
of the form
r�s� � exp��s � �
where the parameter is the correlation length� Numerically� two approaches have been persued in
di"erent papers for estimating � thereby deliberately neglecting potential devaitions of &r�s� from
the exponential form� In most cases is estimated by interpolation from &r���def��� � e ��� ��� ���
��� ���� Alternatively� one may use linear regression for �tting
� ln &r�s� def���
�
lrs c��
sometimes with the c� � �� This approach is used for instance in ������ Of course� these estimates
can di"er signi�cantly if there are substantial deviations from an exponential function�
A more elegant de�nition relies only on the nearest neighbor correlation r���� using
def��� � �
ln r����
� �� �
Stadler� Towards a Theory of Landscapes
Figure � The correlation lengths of most model landscapes scales linearly with the system size� The examplesshown here are� a� Graph Bipartitioning Problem� and b� Travelling Salesman Problem with transposi�tions �T� and inversions �J�� respectively�
The correlation length ) calculated by any of tha above numerical procedures ) depends linearly
on the system size n in almost all model landscapes that have been investigated so far ��� ���� ����
�� � ����� see �gure � The only notable exception occurs for asymetric TSPs with inversions ������
This strongly suggests to introduce the scaled correlation length � def��� n� It allows to compare
entire families of landscapes� as it does not depend on the size n in general�
Alternative de�nitions of a scaled correlation function emphasize the geometry of the con�guration
space graph # by comparing to the diameter of # � �� def��� diam#� or to the average distance -d
of randomly chosen vertices in #� ��� def��� -d� respectively� We have thus
� �n
diam#�� �
n-d��� �
The quantities relating the di"erent de�nitions are� in most cases� numerical constants close to ��
For instance� we have for Hamming graphs
n
diam#� � and
n-d�
�
�� � �
while we both quantities are � � O� �n� for the Cayley graphs of the symmetric group with bothtranspositions and inversions as move sets� The scaled correlation length will play an important
role for the estimates of the number of local optima discussed in sect �����
����Elementary Landscapes
De�nition� Let # be a graph� � the Laplacian of # and f a landscape on #� We say f is
elementary if
�f K��f � -f � � � �
where -f � hfi � � N �Px� f�x� is the average value of f � and K� is a constant�
� �� �
Stadler� Towards a Theory of Landscapes
Grover � �� observed that the landscapes of a number of classical combinatorial optimization prob�
lems are of this form� see Table �� In order to keep the notation consistent with Grover�s workfor regular graphs we introduce K � K� D where D is as usual the vertex degree� The above
relation for f is the discrete analogue of the Helmholtz equation� or reduced wave equation� ����An equivalent interpretation is that f is an eigenfunction of the Laplacian operator� It is notsurprising that this property is closely related to the properties of the empirical autocorrelation
function of the landscapes�
Theorem� Let # be a Cgcg with vertex degree D� Then the following statements are equivalent�
�i� f is an elementary landscape with parameter K��ii� The empirical autocorrelation function &� of f is a left eigenvector of the collapsed adjacency
matrix &A with eigenvalue * � D� � D�� �K� � D �K���iii� The empirical autocorrelation function &r�s� of f measured along a simple random walk on
# is &r�s� � �s�
Proof� Again we refer to ������
Table ��Elementary Landscapes�
Problem Move Set K ���
NAES Hamming �n
p�spin Hamming �pn
WP Hamming �n
GC Hamming �������n
GBP Exchange �n�
�n�
�n�
�n�
symmetric TSP Transposition �n � �
n
Inversions �n�� � �
n
GMP Transposition �n � �
n
The con�guration space of the GBP is the Johnson graph J �n� n����
The values K for NAES �Non�All�Equal�Satisfyability�� WP �Weight Partition�� GC �Graph Coloring�� GBP �Graph
Bipartitioning�� and TSP �Traveling Salesman Problem� are taken from ����� The value of K for the GMP �Graph
Matching Problem� is derived in ����� The values of � for the GBP and the GMP problem are taken from ���� and
���� respectively� the remaining values are from ����� The optimization mentionened above are discussed in detail
in section ����
This theorem is a central result in the theory of landscapes� While we have a complete proof only
for the special case of Cayley graphs of commutative groups� there is ample evidence that it holdsfor a much broader class of con�guration spaces� In particular it holds true whenever �i � �i for
all eigenvalues *i�
A related result linking elementary landscapes to properties of their correlation functions on alarger class of graphs is given below� Let us call r��� the empirical nearest neighbor correlation of
the landscape� If # is symmetric� that is� if all pairs of neighbors belong to the same orbit� then&r��� � &�����
Lemma� Let f be an elementary landscape on a symmetric graph #� Then &r��� � � �K� with�DK being the eigenvalue of the graph Laplacian corresponding to the landscape�
Proof� See ����� Lemma ����
� � �
Stadler� Towards a Theory of Landscapes
���� Local Optima
������Local Optima and the Eigenstructure of the Laplacian
Local optima are the very feature of a landscape that makes it rugged� An understanding of the
distribution of local optima is thus of utmost importance for the understanding of a landscape�
The eigenstructure of the graph Laplacian o"ers a promising formalism for relating the correlation
structure of a landscape to the geometry of its local optima� In this section we will brie�y describe
a few results along these lines�
The geometric structure of an elementary landscape is closely related to the constant K�� i�e��
the eigenvalue of the graph Laplacian to which f belongs� The solutions of the Laplace equation
�f � � form the harmonic functions on #� It is well known that there are no non�trivial harmonic
functions on �nite connected graphs �see� e�g�� ������ The harmonic functions correspond to the
�at landscapes�
Let f be an arbitrary landscape on #� Let
V� � fx � V jf�x� � �g and V� � fx � V jf�x� � �gbe the set of all vertices on which f is non�negative or non�positive� respectively� Let #� and #� be
the corresponding induced subgraphs of #� The connected components of #� and #� are called the
nodal domains of f � Clearly the geometry of the nodal domains is a very important characteristic
of the landscape f �
The second largest eigenvalue (*� of the graph Laplacian� which is negative for all connected
graphs� is often called the algebraic connectivity of #� Theorem �� �� in ���� states that if f is an
eigenvector of � with eigenvalue (*�� then both #� and #� are connected� i�e�� there are exactly two
nodal domains� Following a suggestion by Kau"man we term this type of landscapes �Fujijama�
landscapes as they consist of only a single �mountain� #�� On a Boolean hypercube we have a
much stronger result� An elementary landscape with eigenvalue (*� is of the form
f��� � J� nX
k��
Jk�k�
and thus there is a unique local maximum �max and a unique local minimum �min� provided the
coe�cients Jk are all non�zero� Note also �min � ��max in this case� It is unknown if a similar
result holds on other graphs as well�
For Riemannian manifolds even more is known� Courant�s Nodal Domain Theorem states that if
all eigenvalues of the Laplacian on a Riemannian manifold are ordered as � � (*� � (*� � � � �� then
the number of nodal domains of an eigenfunction �k belonging to (*k is at most k� see� e�g�� the
book by Chavel �� �� We expect that an analogous theorem holds on graphs� Results along these
lines will be presented elsewhere�
Closely related to these observations is theorem � of Grover � ��� He showed that the local optima
have a characteristic distribution on elementary landscapes� Let zmin and zmax be a local minimum
and a local maximum� respectively� Then
f�zmin� � -f � f�zmax��
i�e�� if f is an eigenvector of � then all local maxima are in #� and all local minima are in #��
Grover also gives bounds on the length of adaptive walks for elementary landscapes�
� �� �
Stadler� Towards a Theory of Landscapes
������The Number of Local Optima
One of the most important characteristics of a landscape is the number N of local optima� Palmer
��� used an at�least�exponetial increase of N with the system size n as de�nition of �rugged�
landscape� Local optima are obstacles for heuristic optimization algorithms� It is a very resonable
conjecture� therefore� that optimization by a general algorithm should be easier if there are fewer
local optima� or probably equivalently� if the nearest neighbor correlation is larger�
It is easy to calculate the number of local optima in two extreme cases� the random energy model�
and the completely correlated landscape �in which �tness is added over independent contributions
from each element in a sequence�� In the completely correlated case� at least in the case of the
Boolean hypercube� there is one single optimum� In a random energy model on graph with vertex
degree D with N vertices there are on average
E �N � � �
D �N
local optima� An extension of these results to landscape with a small correlations can be found in
������
Estimates for the number of local optima are also known for the Nk�model ����� ���� ���� Sherrington�
Kirkpatrick model and related short�range ��spin models ��� ��� ��� � ��� for the Travelling
Salesman Problem with Transpostion metric ����� and for RNA free energy landscapes ����� How�
ever� there is no routine method for deriving the number of local optima and for relating this
number to the corrlation structure of the landscape� In most cases� the number of local increases
exponentially with the system size n�
Let us �rst consider landscapes and random �elds on Hamming graphs� Here we have N � n�� In
statistical mechanics on considers traditionally the parameters
A def��� lim
n
�
nln E �N � and A� def
��� limn
�
nE �lnN ��
It will be convenient to introduce the quantity P def��� � lim
n
�
nlnplo� which is related to A via
P � ln�� A� Note that we have N � An and plo � P�n for large enough systems�
Weinberger ����� gives the following estimate for the probability plo � N N of �nding a local
optimum in an Nk model for medium and large values of k�
plo�Nk � ���� ���k ���� nk�� �
In terms of the scaled correlation length � def��� n this equation becomes
P � ��ln��� ��� ln ���
An interesting variation of the Nk model has been introduced recently by Perelson and Macken
��� for modelling the a�nity maturation of antibodies by somatic hypermutations� In the Block
Model a sequence x over an alphabet with � letter is devided into B independent blocks of size
B N � The �tness f�x� is de�ned as the sum of the �tnesses of the individual blocks� which in
In ���� the blocks are not required to have equal size� We impose this restriction here in order to simplify theformalism�
� � �
Stadler� Towards a Theory of Landscapes
turn are taken to be i�i�d� random numbers drawn from some distribution with �nite variance�
The nearest neighbor correlation is given by r��� � �� � B� implying that the correlation lengthis approximately � B provided B � �� The interesting feature of the block model is that the
number of local optima can be easily estimated ���� One obtains
A � �
nlnE �N � � ln�� B
nln���� �� n
B
�
and� using � � B n for not too few blocks� this translates to
A � ln�� ��ln��� ��� ln �� �
and consequently� the probability for hitting a local optimum at random ful�ls
P � ��ln�� � ��� ln �� �
This estimate coincides with Weinberger�s ����� result for the Nk models�
Using the TAP approach �� � one can estimate the quantities A and A�� Not unexpectedly� short�
rangle spin glasses have more local optima than longe range spin glasses� even the Hamiltonian is
of the same form
H��� �X�i�j�
Jij�i�j
where the sum is taken over all pairs �i� j� of neighboring spins ����� Bray and Moore ���� show
that to a �rst approximation the number of local optima depends on the coordination number z
of the spin lattice �i�e�� z � � for a chain of spins� z � � for a square lattice of Ising spins� and
z � n� � for the SK model��
A�z� � A��z� � ���� ��� � z
Exact expressions are available for the �D case� the linear spin chain�
A�D � � � � ����� and A��D � ln � � ������
These z�expansion is surprisingly accurate� A��� � ������ Note that all these ��spin models havethe same empirical correlation function &�� and thus also the same correlation length � � � �� The
numerical values for A from di"erent models� estimated with di"erent approaches are collected in
table �
Table ��Estimated values of A for landscapes with � � � � on Boolean hypercubes�
Model Method A Ref��spin SK TAP ���� ������spin chain ������ ��Nk k � direct ����� �����Block Model direct ����� ���� 5 �����
The last line is obtained by assuming one local optima in a patch with radius given by the correlation length�
� �� �
Stadler� Towards a Theory of Landscapes
3 4 5 6 7 8 9 10 11 12 13 14 15n
10-6
10-5
10-4
10-3
10-2
10-1
100
Pro
b(lo
c.op
t.)
Figure ��� Number of local optima of a TSP� with neighborhood de�ned by transpositions� as a function of systemsize� The dotted line corresponds to one local optimum in a patch with a radius of one correlation length�
A rough estimate for the number of local optima on landscapes with a Gaussian distribution of
values has been proposed in ������ One concludes immediately from the discussion in sect� ����
that an assumption on the distribution function is in fact necessary� In a fully correlated landscape�
i�e�� correlation length � maxd�x� y� one expects to �nd a single optimum� Let B�r� denote thenumber of vertices in a neighbourhood with radius r around an arbitrary con�guration� We expect
then� that there are roughly O��� local optima in a patch with radius � i�e�� plo � � B��� For
Hamming graphs this estimate becomes explicitly ����
P � ��ln��� ��� ln ��� ��� �� ln�� � ���
It deviates from the above estimates by the term ����� ln������ See also table for a comparison
of numerical values for landcsapes with � � � � on a Boolean hypercube�
The parameters A and P are not useful in cases where the number and6or the probability of local
optima is not exponential� The TSP with transposition metric provides such an example� For
landscapes on #�Sn� T � one estimates
plo � �
0
e�
���
���� �
#�n��
��e� �����
��n�
see ���� For the TSP with transpositions we have � � � �� i�e��
plo � const�����n
�n ��0
This is in very good agreement with the numerical data ������ see also �gure ���
A rigorous theory linking the correlation structure of Gaussian landscape with the number N of
local optima is still missing� The example of the ��spin models above shows� furthermore� that
there cannot be a simple equation linking the correlation length with the number of local optima�
� �� �
Stadler� Towards a Theory of Landscapes
On the other hand� the fairly small numerical range of A for various ��spin models leaves at least
room for rough estimates�
The distribution of local optima cannot be studied directly for large values of n since plo decreases
exponentially in most cases� Some information of local optima� and on the distribution their basins
of attraction can be obtained from adaptive and gradient walks� see� e�g�� ����� A statement closely
related to the crude estimate for N is that the length of a gradient walk should be approximately
equal to the correlation length� while adaptive walks should be longer by a factor that depends
on the structure of the con�guration space only� Numerical evidence for the Nk model and RNA
landscapes is consistent with this statement�
The statistics of walks and local optima of the random energy model is known in detail ���� ��� ��
���� This landscape is qualitatively di"erent from the correlated landscapes discussed above in that
the walk lengths are O�logn� as opposed to O�n�� and the probaility of hitting a local optimumat random is pl�o� � � �� D�� as apposed to exponentially decreasing� Here D is� as usual� the
vertex degree of the a con�guration� i�e�� the number of nearest neighbors�
���� Some Example Landscapes
������Traveling Salesman Problems
The Traveling Salesman Problem TSP has already been discussed in the introductory section ����
Here we will focus on a few more formal aspects� Recall that the cost of tour � is given by
f��� �Xj
w��j���j��� �
where the indices are interpreted modulo n� An arbitrary matrix W can be uniquely decomposed
into its symmetric component W � �W W�� � and its antisymmetric component W� �
�W �W�� �� it will be convenient to de�ne
f��� def���
Xj
w��j���j��� �
f��� f����
��
f���� def���
Xj
w���j���j��� �
f��� � f����
��
Note that f and f� can be viewed as cost functions of TSPs with �distance matrices� W and
W�� respectively�
Theorem ��� Both f and f� are elementary landscapes on the Cayley graphs of the symmetric
group with the transpositions and the inversions as generators� respectively� In particular we have
for transpositions
�f ��n� ���f � -f� � � �f� �nf� � � �
and for inversions ��opt moves� Lin 7 Kernighan �� � we �nd
�f n�f � -f � � � �f� n�n ��
�f� � ��
� �� �
Stadler� Towards a Theory of Landscapes
The landscape of a TSP with transpositions or inversions is elementary if and only if W is either
symmetric or antisymmetric�
Proof� The rather tedious computations which are based on � �� can be found in ����� Thm����
Asymmetric TSPs hence provide an example of fairly simple composite landscapes� They consist
of two modes corresponding to the symmetric and the antisymmetric part of the distance matrix
W � respectively� It is also interesting to note in this context that canonical transpositions �i� i ��
do not lead to an elementary landscape�
Consequently� the nearest neighbor correlations of the symmetric and antisymmetric components
of a TSP with transpositions are r��� � �� � n and r��� � � � � �n� ��� respectively� i�e�� verysimilar� In fact� numerical estimates ����� had been consistent with r��� � � � � n for large n in
both cases� In the case of inversions we have a symmetric mode with nearest neighbor correlation
r��� � � � � �n � �� and an antisymmetric contribution with a vanishingly small contributionr��� � �� �n� �� � ��It is interesting to correlate these values of r��� with known facts about the performance of heuristic
optimization algorithm� in particular with the simulated annealing� It has been observed by serveral
authors that simulated annealing on symmetric TSP is much more e"ective when reversals instead
of transpositions are used as move set� see� e�g�� the books by Aarts and Korst ��� or Otten
and vanGinneken ���� Furthermore� Miller and Pekny ��� have observed that reversals are a
remarkably bad move set for asymmetric TSPs� These observations are in accordance with the
conjecture that landscape with smoother correlation functions have fewer local optima and are thus
easier to optimize on� cp� ������ In particular the di"erence between symmetric and asymmetric
TSPs when reversals are used is easily explained in these terms� while for the symmetric TSP the
landscape is as smooth as possible� it is completely rugged for the antisymmetric case�
Numerical data by Stadler and Schnabl ����� indicate that the correlation functions &r�s� of both
the symmetric and the antisymmetric components should be of the form r���s� we do not� however�
have a proof for this conjecture for all n�
������Graph Bipartitioning Problem
Consider a graph G with an even number n of vertices and a symmetric matrix H of edge weights�
A con�guration is a partition of the vertex set into two subsets A and B of equal size� The cost
function is
f��A�B�� �Xi�A
Xj�B
Hij�
i�e�� the total weight of edges connecting the two subsets� Usually one is interested in minimizing
the total edge weight f��A�B�� connecting the two subsets A and B� see e�g�� ���� As a close
relative of the Sherrington�Kirkpatrick model the Graph Bipartitioning Problem� GBP� has received
considerable attention�
The usual move set for this problem is exchanging a vertex in A with a vertex in B� The resulting
graph is the Johnson graph J �n� n ��� see sect� ����� The random �eld associated with the GBP
is constructed by assigning the edge weights Hij � Hji independently and identically distributed�
� � �
Stadler� Towards a Theory of Landscapes
a� b�
c� d�
e� f�
Figure ��� Examples of autocorrrelation functions�a� GBP� b� graph matching �upper curves� and low autocorrelated binary string problem� c� TSP withtransposition metric� d� symmetric TSP with inversions� e� asymmetric TSP with inversions� f� asym�metric TSP with a restricted set of inversions as move set�
Stadler and Happel ��� � have shown by explicit calculations that the correlation functions of this
random �eld are
��d� � �� � dn
�� �
n� �� ��
d
n
�� �� �
n� ��
r�s� �
�� �
n �
n�
�s�
irrespective of the particular distribution from which the Hij�s are drawn� Our results imply that
��d� is an eigenvector with eigenvalue r��� of the Johnson graph J �n� n ���Grover � �� found that each instance of the GBP is an elementary landscape with K � � n� � n��see also table � Hence we �nd in fact the expected result K � �� �� We take this as one further
� � �
Stadler� Towards a Theory of Landscapes
hint that the theorems proved in the previous sections for Cgcg are in fact true for a much larger
class of con�guration spaces�
������The Low Autocorrelated Binary String Problem
The LABSP � � �� consists of �nding binary strings � over the alphabet f��� �g with low ape�riodic o"�peak autocorrelation Rk��� �
PN�ki�� �i�i�k for all lags k� These strings have technical
applications such as the synchronization in digital communication systems and the modulation of
radar pulses� The quality of a string � is measured by the �tness function
f��� �n��Xk��
Rk�����
In most of the literature on the LABSP the merit factor F ��� � n� ��f���� is used� This transfor�
mation gives rise to a non�Gaussian distribution of merit factors� see ��� for details�
It can be shown ����� Lemma ��� that the landscape f of the LABSP can be written as
f��� � a�
d n� e��Xk��
n��kXi��
��i�i�k��� n��Xk��
n��Xi��
Xj ��i�k�i�i�k
�i�i�k�j�j�k��� �
and thus the empirical autocorrelation functions of the LABS are
&��d� � ���O�� n�����d� O�� n����d��
&r�s� � ���O�� n�� �� �d
n
�s O�� n�
�� �d
n
�s�
The landscape of the LABPS is thus not elementary� it consists of a superposition of two modes�
namely p � � and p � �� The smoother p � � contribution becomes negligible for large n� so
that f behaves for long strings almost like an elementary p � � landscape� This fact explains why
the LABPS has been found to be much harder for simulated annealing than� say� the SK spin glass
���� The empirical autocorrelation function &r�s� has been computed numerically ����� based on the
merit factor F � The numerical estimate for the correlation length
def��� � �
ln r���� ����� � n� ���
is in excellent agreement with the asymptotic value � n � O��� obtained above�
������Not�All�Equal�Satisability
Consider a vector of n binary variable� A literal is a variable or its complement� A clause is a
set of three literals that does not contain both a variable and its complement� A clause is said
to be satis�ed if at least on literal is � and at least one literal is �� An instance of the Not�All�
Equal�Satis�ability Problem �NAES� is given by a set of c clauses� the cost function is the number
of non�satis�ed clauses� The move set is de�ned by �ipping the value of a single variable� thus the
con�guration space is the Boolean Hypercube� It is shown in � �� that NAES has an elementary
landscape� see also table �
� � �
Stadler� Towards a Theory of Landscapes
������Graph Coloring
An instance of a graph coloring problem GC consists of a graph G�V�E� and a number � of colors�
A con�guration x is a ��coloring of the vertex set V � i�e�� an assignment of one color x�p� to each
vertex p of the graph� The cost function is the number edges �p� q� � E for which both incident
vertices p and q have the same color�
f�x� �X
�p�q��E
x�p�x�q��
A move is the replacement of one color by another one at single vertex� The con�guration spaces
are thus the General Hamming graphs� i�e�� sequence spaces over the alphabet of the � colors� The
landscape of a GC is elementary � ��� see table �
�����Weight Partition
Given a string of n �spins� x � �xi� � f��� �gn and corresponding weights wi� the cost function
is given by
f�x� �
�nXi��
wixi
��
�
The move set is given by �ipping a single spin� hence the con�guration space is again a hypercube�
The landscape of a Weight Partition Problem WP is elementary � ��� see table �
������Graph Matching Problem
Given a graph G with n vertices and a symmetric matrixW of edge weights� the task of the Graph
Matching Problem GMP is to partition the graph into n � pairs of vertices such that the sum of the
edge weights corresponding to these pairs is optimal� A convenient encoding of the problem is the
following� Let � � Sn be a permutation of the vertices� We assume that the vertices are arranged
such that ����k� ��� ���k�� form a pair� The cost function is hence
f��� �
n��Xk��
W���k�������k��
Again� the con�guration space is the symmetric group� and hence the set of all transpositions
forms a canonical move set� The disadvantage of this encoding is� however� a very large degree
of redundancy� In fact� �n ��0�n�� permutations represent a single matching ����� As the models
discussed above the landscape of the GMP is elementary� see ����� Thm���� and table � Numerical
estimates of correlation functions can be found in ������
� � �
Stadler� Towards a Theory of Landscapes
���Classi�cation of Landscapes
������Fractal Landscapes
Gregory Sorkin ����� proposed the following de�nition of a fractal �tness landscape which is built
on the idea of fractional Brownian motion �����
De�nition� A landscape is fractal if hkf�x�� f�y�k�i � d�h�x� y�� where the two con�gurations x
and y with normally distributed �tnesses f�x� and f�y�� respectively� are separated by a distance
d�x� y��
As a practical matter� the distance between con�gurations for any �nite con�guration space is
bounded by the diameter of the con�guration space diam C� so that Sorkin�s de�nition makes senseonly for distances small compared to this upper bound� Sorkin�s de�nition can be reformulated in
terms of autocorrelation functions�
�� &��d� � ��� r����d�h�
For simplicity we will assume in this section that the autocorrelation functions are given in terms of
distances� otherwise we may work with the corresponding random walk version� The details of this
step are explained in the following section ���� For distances d small compared to the correlation
length � almost all of the landscapes listed in table �� as well as most of the RNA landscapes
described in section � are of the form
��d� � �� d
� � � �
and therefore approximately satisfy Sorkin�s de�nition with h � � ��
������Classication by the Form� of the Correlation Functions
Since strictly speaking all landscapes are �nite object a classi�cation beyond the distinction
elementary6non�elementary seems to be hard to achieve� Instead of considering a single land�
scape� we assume therefore that we are given a family ffng of landscapes �or random �elds� on a
graphs #n� The index n � �� �� � � � is a �natural� measure of the size of the con�guration space� For
sequence spaces� for instance� n is simply the chain length� Now consider the correlation functions
��n��d� and r�n��s� of the landscape fn� We de�ne the scaled autocorrelation functions �h� and
z�h� for all rational numbers h by
�h� � limn
��n��nh� z�h� � limn
r�n��nh� �
respectively� Note that and z do not necessarily exist0 An example is the family of p�spin models
with p � n for which we �nd ��n��n �� � �� depending on whether n � � mod � or n � � mod ��Based on the �shape� of �h� or z�h�� which the same� Weinberger and Stadler ��� proposed
a classi�cation of landscapes� This work was motivated by the analogy to the classi�cation of
stationary continuous�time stochastic processes in terms of their autocorrelation functions�
I �h� is discontinuous for h � �� These landscapes are extremely rugged� �A continous time
stochastic process with an autocorrelation function of this type is not even continuous�� Two
subclasses can be distinguished�
� �
Stadler� Towards a Theory of Landscapes
Table ��Combinatorial optimization problems and their autocorrelation functions�
Name Metric ��d� r�s� � diam Ref�
REM any ��d see �� �� � n �
s�TSP Tr� � �e��s�n n�� n�� �����
�opt � �e��s�n n�� n�� n�� �����
c�Tr� � �e��s�n n�� n�n���� �����
a�TSP Tr� � �e��s�n n�� n�� �����
�opt � � �� ���s�e
��s�n� � � �����
c�Tr� � �e�s�n n�� n�n���� �����
GM Tr� � �e��s�n n�� n�� �����
GBP Ex� ��n��n�� ��
dn�� �
dn �
�� ��� �n�
�n�
�s �n����� n�� �����
LAS Ham� � �e��s�n n��� n �����
rnd�Nk Ham� ��� dn ����
kn�� �
d ����k��n �s n��k��� n ��������
p�r�Nk Ham� ���k��n �d ����k��
n �s n��k��� n
adj�Nk Ham� see ����� ����k��n �s n��k��� n ��������
p�Spin Ham� �� �
�np�
P� �dj��
n�dp�j � �e��ps�n n���p� n �����
SK Ham� �� nn�� ��
dn���
dn �
�� ��� �n �
s n�� n �����
P� for the p�spin model denotes the sum over all odd j subject to the restriction j�mind�p�
REM is Derrida�s random energy model� s�TSP and a�TSP denote symmetric and asymmetric travelling salesman
problems ����� GM is the graph matching problem ����� The corresponding metrics are transpositions �Tr��� �opt
moves and canonical transpositions �c�Tr�� GBP is the graph bipartitioning problem ����� its metric �Exc� is derived
from exchanging a pair of objects� LAS stands for the low autocorrelated string problem ���� ��� The Sherrington�
Kirkpatrick spinglass ��� is the special case p�� of the p�Spin model ��� ��� ��� introduced in ��� as a model for
a rugged landscape in evolutionary optimization� The abbreviations rnd�Nk� p�r�Nk� and adj�Nk refer to random
neighbour� purely random and adjecent neighbour Nk�model� resp� Here the canonical metric is the Hamming
metric�
Ia �h� � �h� �or more generally consists of a �nite sum of delta functions�� This subclass
may be divided further depending on the behaviour of the unscaled correlation function�
� The unscaled correlation length diverges when diam C ��� An example of thissubclass is the TSP with canonical transpositions de�ning the neighborhood� The
correlation length is O�n�� whereas the diameter of the landscape is O�n�� where n
is the number of cities� see table ��
� The unscaled correlation length is uniformly bounded from above� Examples of
this subclass are the random energy model and �probably� certain RNA landscapes
����
Ib �h� does not vanish in a neighbourhood of h � � but the autocorrelation function is
bounded from above by some constant ! � � for h � � in a neighborhood of h � �� i�e��
� � �
Stadler� Towards a Theory of Landscapes
ρ ρ ρ
ρ ρ ρ
1 1 1
1 1 1
0 0 0
0 0 0
d d d
d d d
Ia Ib IVa
IIIVb
III
Figure ��� Classi�cation of landscapes �and random �elds� according to the shape! of their correlation functions�For details see text�
there is a �nite size jump at h � �� but the landscape is not uncorrelated� An example
is provided by the asymmetric TSP with ��opt moves� see �gure ���
II �h� � ���h O�h��� with a constant � of order �� Examples are almost all entries in table ��Class II landscapes are �trivial� random fractals with h � �
� � Continuous�time stochastic
processes with an autocorrelation function of this type are continous but not di"erentiable�
hence these landscapes are �rugged��
III �h� � �� �h� o�h��� with some constant � of order �� In contrast to all previous cases the
autocorrelation function is di"erentiable at h � �� Correlation functions of this type belong
to di"erentiable stochastic processes in the continuous�time case� These landscapes form the
second class of trivial fractals� corresponding formally to Sorkin�s de�nition of fractals with
h � �� These are the smoothest possible landscapes� since any function f�x� � �� O�x��q�with q � � cannot be autocorrelation function of a stochastic process�
IV �h� � � � cphp o�hp�� with p � �� �� correspond to non�trivial random fractals� Such
landscapes have been constructed by Sorkin on fractal con�guration spaces� but have not
�yet!� been found in �real life� examples�
������Classication Based on the Characterization of Correlation Function
The characterization of autocorrelation functions has direct implications on the classi�cation of
autocorrelation function� We will now relate the classes de�ned in the previous subsection with
the spectral decomposition of the autocorrelation function described in section ����
� �
Stadler� Towards a Theory of Landscapes
On the sequence spaces we can investigate the behavior of �h� for small h explicitly� Consider
��
n� � �� �
n
�
�� �Xp��
3p � p �� �� �
n
�
�� � -� �
The parameter -� can be interpreted as the �average mode� of the landscape� We expect similar
relations on other con�guration spaces as well� The form of clearly depends on the scaling of
-� with the system size parameter �chain length� n� First we note that � � -� � n holds for all
landscapes on sequences spaces� If -� � O�n� then � �n � does not converge to � and hence cannot
be not continuous� The initial slope of can be estimated as � �hj�� � � ����-�� if it exists at
all� Hence we have an asymptotically �nite slope only if -� � O����Theorem� The smoothest landscape on a sequence space has autocorrelation function
���d� � �� �
�� �d
n�
Proof� See ������
Table �Tentative Classi�cation of Landscapes�
Class I rugged Class II smooth Class III�Fractals� �Fractals�
not � �� cjhj� � �� cjhj � �� cjhj� � �� cjhj�continuous � � ! � � � � ! � �
-� -� � O�n� -� � o�n�� -� �� -� � O��� do not exist on Qn�
Class A Class B Class C
This reasoning suggests that there should be three di"erent classes of landscapes�
A -� � O�n� implies limn � �n � � � and hence the asymptotic autocorrelation function is
discontinuous at the origin�
B -� �� but -� � o�n� allows to be continuous with in�nite initial slope�
C -� � O��� implies an autocorrelation function which decays continuously with �nite slope�We do not claim that there is one�to�one correspondence between the two classi�cation schemes�
which are compared in table � One of the reasons for this is that we have no general conditions
for the existence of �
� � �
Stadler� Towards a Theory of Landscapes
��� Landscapes on Irregular Graphs
�����Correlation Functions
Let us use the notation Dh�x�def��� jNh�x�j for the distance degrees� i�e�� for the number of vertices
in distance h from a vertex x� Suppose # be a graph with N vertices and Mh unordered pairs
of vertices with mutual distance h� Of course M� is the number of edges� Interpreting Dh as a
landscape we obtain immediately the balance equationXx
Dh�x� � hDhiN � �Mh�
On non�regular graphs we have essentially two ways of de�ning a correlation function�
De�nition� Let f � V # � IR be a non�constant landscape on a connected graph # with N � �
vertices� Then we de�ne
&��d� def���
hf�x�f�y�id�x�y��d � hfi�hf�i � hfi�
&���d�def��� �� h�f�x� � f�y���id�x�y��d
h�f�x� � f�y���i�x�y��V�VBoth de�nitions of correlations have their advantages in certain contexts� &� is the usual de�nition
which have already encountered for distance regular graphs� &�� on the other hand has the same
�avour as the usual correlation coe�cient� Since it depends only on squared di"erences it will
form the starting point for a generalization of correlation measures to non�numeric functions in
sect� ���� see also ���� ���� In fact� two de�nitions coincide provided the con�guration space is
su�ciently symmetric�
Theorem� Let # be distance degree regular� Then &� � &��Proof� See �����
De�nition� Let f and g be two landscapes on #� We de�ne the covariance of f and g by
cov�f� g� def��� hfgi � hfihgi�
Note that this conforms the usual de�nition of a covariance�
For each non�constant landscape on a connected graphs we de�ne the function
%�h� def���
cov�Dh� �f �
hDhih�f i where �f �x�def��� f��x� � hfi� �
With this de�nition we can prove an interested generalization of the above relation between &� and
&���
Theorem� ���h� � ��h� � �%�h� for all connected graphs and all non�constant landscapes�Proof� The proof proceeds by a straight forward �although rather tedious� direct evaluation of
both sides of the equation� We omit the details here�
Note that %��� � � for all graphs� and %��� � � holds for all landscapes on regular graphs� We
suspect that landscapes for which % vanishes for all distances h will play a special role on irregular
graphs� We propose to call such landscapes uniform� Note also that by replacing the landscape
averages by expectation values one obtains an analogous formula relating the correlation function
��d� on a random �eld and it �squared di"erence� counterpart ���d��
� � �
Stadler� Towards a Theory of Landscapes
�����An Upper Bound on the Nearest Neighbor Correlation
Theorem� Let (*� be the second eigenvector of the Laplacian � of #� let f be an arbitrary
landscape on # with correlation function &��� Then
&����� � �� �
hDi(*��
Proof� We start with an observation by Biggs ���� p� ��� namely
(*� �X
fx�yg�E
�f�x� � f�y���� X
x�V
f��x�
This can be rewritten as (*� � M
N��h�f�x��f�y���id�x�y���� Multiplying by �N M � � hDi yields
�� �(*�hDi �
h�f�x� � f�y���id�x�y������
� �� &������
A simple rearrangement completes the proof�
Corollary� If # is regular with vertex degree D� then we have
&���� � &����� � *�D� ���
where *� is the second largest eigenvector of the adjacency matrix A and �� is the second largest
eigenvector of the transition matrix of a simple random walk on # ���� �����
Proof� This follows immediately from the de�nition � � D�A and the fact that D is a multiple
of the identity matrix in case of regular graphs�
This theorem e"ectively gives an upper bound on the nearest neighbor correlation of arbitrary
landscapes on arbitrary con�guration spaces� It provides also an alternative proof for the theorem
in section �� ��
�� �Empirical Anisotropy
It is crucial for an understanding of the dynamics of a �heuristic� optimization procedure to know
whether the landscape looks like a typical instance of an isotropic random �eld or whether there
are signi�cant anisotropies� The great importance of the ridge�like anisotropies for the dynamics
of evolutionary adaptation� for instance� is discussed in �����
The random �eld de�nition of isotropy becomes useless if we are given only a single instance� It is
clear that we can only base our approach on a comparison of samples taken from di"erent regions
of the con�guration space C� One has to be careful when choosing these samples� however� since wehave to expect uncontrolled e"ects on the sample statistics if we average over set of con�gurations
with unequal geometries� For example� the mean �tness along a �straight line� in con�guration
space will in general be quite di"erent from the mean �tness of a con�guration and its neighbors�
Recently� a collection B of test sets with the following four properties has been proposed as asuitable sampling strategy �����
� � �
Stadler� Towards a Theory of Landscapes
Figure ��� Empirical coe"cient of anisotropy as a function of chain length for three model landscapes�� � � Sherrington�Kirkpatrik spin glass with �n spins� A reasonable collection of test sets is obtained by�xing one halve of the spins within each given test set� which is thus a hypercube of dimension n� Thecorresponding random �eld is is isotropic �see sect ������ The numerical data indicate that the instancesof the SK model are indeed empirically isotropic�In contrast the two examples of RNA free energy landscapes �see section � for details� exhibit anisotropies�The RNA free energy landscape of the natural four�letter alphabet GCAU and the landscape of thearti�cial GCXK alphabet di�er in the logic and strenght of the possible base pairs� In both cases thetest sets are constructed as follow� A� is the set of all sequences that have G or C at each position i
with �i � and A or U �or X or K� respectively� on the �i � � positions� The binary string � thuscharacterizes the slice! A� �which is a Boolean Hypercube of dimension n�� The data show that theanisotropies vanish asymptotically for the arti�cialGCXK alphabet � � which has two equivalent typesof base pairs �GC andXK�� In constrast� we �nd a large amount of anisotropy for the natural alphabet�for which the base pair AU is much weaker than GC and there is the possibility of forming GU pair����
�i� B is a partition of the con�guration space C��ii� A � B is a connected subgraph of C��iii� Any two subgraphs R�S � B are isomorphic� i�e�� they have the same geometry��iv� �� jAj � jCj� for all A � B�The �rst three requirements make sure that we take fair samples� Note that these conditions are
quite restrictive� The last condition ensures that we have enough samples� The basic de�nition in
����� is the following�
De�nition� A value landscape is empirically isotropic if for any family B of test sets holds�
f�x� � f�y���A
���
f�x� � f�y���
��
i�e�� the average of the squared �tness di"erence of pairs of con�gurations belonging to a given
symmetry class � will be the same whether it is measured in single test set or over the entire
con�guration space� By replacing the symmetry classes by distance classes one obtains a completely
analogous de�nition for empirically homogeneous landscapes�
� �
Stadler� Towards a Theory of Landscapes
The average correlation of pairs of con�gurations in a test set� -�B� will not vanish in general� This
re�ects that the test sets A are much smaller than the entire con�guration space C� It can becalculated from the empirical autocorrelation functions discussed earlier in this chapter�
-�B �X�
pA���&���� or -�B �Xd
pA�d�&�h�d�
where pA��� and pA�d� are the probability that a randomly chosen pair of con�gurations from the
test set A belongs to the symmetry class � and to the distance class d� respectively�
Now consider the variance varB�hfiA�� measured over all test sets A � B� of the average �tnessvalues hfiA within the test sets A� The main technical result in ����� is the following
Theorem� Let f be an empirically isotropic �empirically homogeneous� landscape� let B be acollection of test sets ful�lling �i� through �iv�� and let -�B be de�ned as above via the symmetry
classes �distance classes� of the con�guration space� Then
varB�hfiA� � ����� -�B� �
where �� is as usual the variance of all �tness values�
Proof� See ������
It seems natural to measure the anisotropy of a landscape by the extent to which this relation is
violated� We therefore call the dimensionless parameter
�B �varB�hfiA�
��� -�B
the coe�cient of anisotropy with respect to the partition B� From a theoretical point of view it
is tempting to de�ne the �true anisotropy� of a landscape as the maximum value of �B from all
partitions B� From a practical point of view� however� one would need prohibitively large computerresources to actually compute maxB �B� A simple application is shown as �gure ��
The main advantage of this approach is that it is as close as possible to the de�nitions for random
�elds� Moreover� all quantities have the �avor of second moments and can be computed quite
e�ciently� Its major disadvantages are the dependence of the numerical values on the choice of
the collection of test sets B� and the fact that it gives only global information� thereby neglectingthe overwhelming importance of the geometry of the anisotropies�
� �� �
Stadler� Towards a Theory of Landscapes
��Biological Landscape� RNA
���RNA Secondary Structures
������Structure Formation
RNA molecules spontaneously form three�dimensional structures by folding the sequences in aque�
ous solutions� which contain appropriate concentrations of structure stabilizing divalent cations like
Mg��� and have appropriate ionic strength� pH and temperature� The major driving force for struc�
ture formation is Watson�Crick base pairing �G�C� and A�U� mediated by partial intramolecularcomplementarity of sequences� as well as G�U base pair formation� Other intermolecular forces
and the interaction with the aqueous solvent shape the spatial structure of an RNA molecule�
Small and medium size RNA molecules �with chain lengths n� ���� form equilibrium structures
which are independent of the mechanism of folding and thus are completely determined by the
sequence and the environmental conditions� Structure formation of large RNA molecules appears
to be controlled at least in part by the kinetics of folding process�
GCGGGAAUAGCUCAGUUGGUAGAGCACGACCUUGCCAAGGUCGGGGUCGCGAGUUCGAGUCUCGUUUCCCGCUCCA
G C G G G A AUA GCUC
AGUU G
GUA
GAGC A
C G A C C U UG CCAAGGUCG
GG
GUCGC
GA
GUUCG
AGU C
UCGUUUCCCGC
UCCA
Figure ��� Folding of an RNA sequence into its spatial structure� The process is partitioned into two phases� inthe �rst phase only the Watson�Crick�type base pairs are formed �which constitute the major fraction ofthe free energy�� and in the second phase the actual spatial structure is built by folding the planar graphinto a three�dimensional object� The example shown here is phenylalanyl�transfer�RNA �t�RNA phe�whose spatial structure is known from X�ray crystallography�
� �� �
Stadler� Towards a Theory of Landscapes
Formation of spatial structures of RNA molecules is commonly partitioned into two steps �Fig�
ure ���� The �rst step comprises conventional base pair formation �AU� GC� GU� and yields the
so�called secondary structure of the RNA molecule� see below� In the second step the base pairing
pattern is converted into the d structure�
������Structure Prediction
Secondary structures are de�ned as listings of the Watson�Crick�type base pairs in the actual
structure which ful�ll the �no�knot condition� and may therefore be represented as planar graphs�
Two features of RNA secondary structures will be important later on� They are discrete byde�nition �two bases either form pair or they don�t�� and they are composed of largely independent
structural elements�
� stacks� i�e�� double�helical regions�
� loops� i�e�� unpaired regions enclosed by stacks �the degree of a loop is the number of stacks
attached to it� consequently� a hairpin loop has degree �� bulges and interior loops have degree
�� and all loops with degrees larger than � are multi�loops�� and� external elements are strains of unpaired bases that are not part of a loop �they are either
joints� which connect components� or free ends��
There are several reasons for considering the secondary structure as a crude �rst approximation to
the spatial structure of the RNA�� Conventional base pairing and base pair stacking cover the major part of the free energy offolding�
� Secondary structures are used successfully in the interpretation of RNA function and reactivity�� Secondary structures are conserved in evolutionary phylogeny�The statistical investigation of RNA based landscapes requires the knowledge of several hundred
thousand values derived from RNA structures� These data are not available at present� neither
through experimental measurement nor through computation of the d�structures �which are highly
time consuming and still unreliable�� Restriction to secondary structures as a crude approximation
to real structures� however� renders computation possible�
Table � Folding Algorithms�
Algorithm � Abbr� Remark Reference
deterministic
Minimum Free Energy � MFE fast ���� ���
Kinetic Folding KIN fast ����
����� Folding ��� fast ����
Partition Function � PF ensemble ����
Maximum Matching � MM unrealistic ����
stochastic
Simulated Annealing SA very slow ��� ���
� Pseudo�knots can be included� The major problem with the prediction of pseudo�knots is� however� the lack of
su"cient experimental energy parameters�
A variety of computer programs predicting RNA secondary structures have been published� A
very brief overview is given in Table �� Two public domain packages for RNA folding are currently
available by anonymous ftp� Zuker�s mfold ����� and the Vienna RNA Package ����� the latter
providing a variety of di"erent algorithms for structure prediction and structure comparison �����
� �� �
Stadler� Towards a Theory of Landscapes
���RNA Free Energy Landscapes
The most obvious biophysical quantity to investigate is simple the stability of a �secondary� struc�
ture� that is� its free energy of structure formation� The RNA free energy landscapes may serve as
a prototype for biophysically interesting landscapes despite that fact that there is not evolutionary
process that would optimize the free energy of structure formation� It is has been found recently�
for instance� that the landscapes of activation energies for the melting of secondary structure closely
resemble the corresponding minimum free energy landscapes ����� Free energy landscapes have
been computed with a variety of algorithms �see table �� for a number of di"erent alphabets �see
table ���
Table � Scaled correlation lenght � for RNA free energy landscapes�
�G �Gne ModelyAlphabet MFE MFE�s�
�PF KIN Melt� Rec� D A
GC ���� � ������ ����� ������ ��� ���� � � � � �AU ������GU ��� ��AUI ��� �AGC �����AUC ���� �AUG �����UGC ��� �GCAU ������ ����� ���� ����� ����� ��� ��� � � �GCAU� ������GCXK ������ ���� �����ABCDEF ������
All data refer to T����C�� �s� refers to Salser�s old parameter set ����� all other data have been obtained with a recently updated paramter
set ������ A linear dependence on the chain length could not be veri�ed� The bounds correspond to chainlenght n�����y These landscapes have been used to model replication and degradation in the computer simulations ���� �����GU pairs forbidden�
Correlation lengths of free energies are essentially linear functions of the chain length n� Numerical
data of scaled correlation lengths are compiled in table �� The base pairing alphabet has remarkably
strong in�uence on the correlation length� the correlation lenght for AUGC landscapes are much
longer than for pure GC or pure AU�sequences� Detailed information on the RNA free energy
landscapes can be found in ��� ��� ����
Table ��Decomposition of RNA Free Energy Landscapes�
n a a� a�GCAU GCXK GC GCAU GCXK GC
�� ���� ���� ��� ����� ��� ���� �� ���� � �� � �� ��� ��� ���� ������ �� � �� ��� ������� �� ��� ���� ����
� � �
Stadler� Towards a Theory of Landscapes
As an application of the Fourier�theory of landscapes we brie�y discuss here the decomposition
of RNA free energy landscapes into their modes� The correlation data are taken from ����� The
data are �tted reasonably well by by a two�mode model of the form &� � a�k �� � a��l� The
coe�cient � � a � � and the modes k and l cannot be computed directly due to the fairly large
amount of noise in the empirical correlation data� We therefore had to resort to a least square
�tting procedure that takes the non�negativity of the coe�cient�s� explicitly into account and uses
only a small number of non�zero coe�cients� We do not expect the RNA free energy landscapes
to be exactly superpositions of only two modes� we rather expect a broad peak of the spectrum
concentrated at about � � � ��� Using more than two modes increases the quality of the �ts
only slightly� Furthermore the �ts with more than two coe�cients do not compare well when
independent data sets are used� Numerical data are given in table �� We conclude hence that our
numerical estimates of the correlation functions &���� are not accurate enough �approximate noise
level � 8� for obtaining a more detailed decomposition of the RNA free energy landscapes�We �nd a pronounced di"erence between the natural GCAU alphabet and an arti�cial alphabet
GCXK with two base pairs� GC and XK� of equal strength� While the latter is represented
very well by the � � mode� we obtain a superposition of the modes � � and � � in case of
the natural alphabet� This does not come as a surprise� however� There is an essentially linear
increase of the free energy with increasing GC content which accounts for the � � mode� �Recall
that � � corresponds to the additive �tness model� or 'Fujijama� landscape�� The order of
the dominating modes allows one to draw conclusions on the approximate size of the building
blocks underlying the landscape� in case of RNA free energies the data indicate that on average
a nucleotide interacts strongly with about other position� leading to a building block size of ��
This is a perfectly reasonable number given the energy model ����� for RNA secondary structure
formation� a major contribution of the energy comes from stacking of base pairs� hence we expect
at least the pairing partners and their neighbors to be important�
���Combinatory Maps
������The Metric Space of RNA Secondary Structures
The dichotomy between genotypes and phenotypes is basic to biological evolution� Molecular
biology has shown that the genetic information for the unfolding of organisms� which represent the
phenotypes� is contained in the DNA� which is the genotype� RNA molecules in cell�free evolution
experiments are both genotypes and phenotypes� Following Sol Spiegelman we consider the spatial
structure of the RNA molecule as its phenotype� Indeed� this structure is evaluated by the selection
process� The structure of the RNA molecule acts thus as mediator between the sequence and the
scalar property that is considered in the ��tness� landscape� The relation between sequences and
structures thus seems to be basic to all landscapes of biopolymers�
The shape space Y is de�ned as the set of all possible RNA secondary structures� The notion of ashape space was used previously in theoretical immunology for the set of all structures presented
by all possible antigens �� ����� Structures are non scalar objects� and there is no �structure
landscape�� In particular� the notion of a �local� optimum does not make sense in this context�
since the structures do not admit an order�
� �� �
Stadler� Towards a Theory of Landscapes
On the other hand� we can at least de�ne a notion of similarity between secondary structures�
RNA secondary structures can be represented uniquely as rooted planar trees ����� �� � ���� The
conversion assigns an internal node to each base pair and a leaf to each unpaired digit� �An ex�
tra root is conveniently added in order to prevent the formation of a forest�� An alternative tree
representation� known as homeomorphically irreducible trees� is obtained by converting connected
unpaired regions and connected stacked regions� respectively� into single nodes� that can addition�
ally be given a weight corresponding to the size of the structural element� Comparison of trees
by means of edit distances is a well known technique in computer science ��� �� This method
provides a metric distance measure between trees� and thus also between secondary structures�
An alternative method for the comparison of RNA secondary structures is based on the so�called
mountain representation ���� The secondary structures are encoded as linear strings with balanced
parentheses representing the base pairs� and some other symbol coding for unpaired positions� Dis�
tances are computed by direct end�to�end alignment of these strings� It has been shown that the
results reported in this contribution are almost independent of the actual choice of the folding
algorithm� the parameter set for the folding and the distance measures for secondary structures
����� In this section we will use the notation D�a� b� for a distance between secondary structures�
thus �Y� D� is a metric space�
De�nition� A map f � C � Y from the con�guration space C into another metric space Y is
called a combinatory map� A landscape is special combinatory map with Y � IR� The conceptualdi"erence is that landscapes have the order of the ��tness� values as an additional feature�
������Correlation in Combinatory Maps
A theory of combinatory maps analogous to the theory of landscapes discussed in the previous
sections can be constructed based on based on the de�nition of �� in sect� ����� by replacing the
squared di"erences by squared distances in Y� It has been proposed in ���� ���De�nition� The correlation function of a combinatorial map and a �combinatorial random �eld��
respectively� are given by
&���� � �� hD��f�x�� f�y��i�x�y���hD��f�p�� f�q��i
���� � �� E �D��f�x�� f�y���
E �D��f�p�� f�q���for �x� y� � �� and �p� q� � v � V
The fact that there are no mean values suggests that we say a combinatorial random �eld is isotropic
if E �D��f�x�� f�y��� is constant on a symmetry class �� The notion of empirical isotropy also carries
over� the squared di"erences are simply replaced by the corresponding squared distances in sect�
���� In the same spirit we may de�ne the unscaled and scaled structure correlation lengths and
�� respectively�
The correlation length may serve as a statistical measure of the hardness of optimization problems
for a particular heuristic algorithm� The structure correlation length allows for a similar interpre�
tation� The shorter the correlation length� the more likely is a structural change occurring as a
consequence of mutation� The correlation length thus measures stability against mutation�
More detailed information on a combinatorymap can be obtained from the conditional probabilities
P �D��� � Prob�D�f�x�� f�y� � D
�� �x� y� � ���
� � �
Stadler� Towards a Theory of Landscapes
that the images of two randomly chosen con�guration have a distance D in shape space given that
the pair of con�gurations �x� y� belongs to the symmetry class � in con�guration space� We call
P �Dj�� a density surface� The autocorrelation function can be calculated from a density surface
using
hD��f�x�� f�y��i�x�y��� �XD
D� P �Dj���
hD��f�p�� f�q��ip�q�V �X�
p���hD��f�x�� f�y��i�x�y���� �
The density surfaces contain of course more information than the autocorrelation function� For
instance� the probability for �nding a neutral neighbor� i�e�� for �nding a mutant that folds into
the same structure� is given by pNN � P ��j���
������The Combinatory Maps of RNA Secondary Structures
The number of secondary structures which are acceptable as minimum free energy structures of
RNA molecules can be computed from combinatorics of structural elements ���� ��� ���� ���� It
is much smaller than the number of di"erent sequences� since we have
Sn � ���� � n����������n
di"erent secondary structures for �n sequences� i�e�� there are even less structures than there are
binary sequences�
The mapping from sequence space into shape space cannot be inverted� many sequences have
to fold into the same secondary structure� We �nd that the frequency distribution of sequences
folding into a common structure follows a generalized Zipf�s law
��r� � a�r b��c
where r is the rank of a secondary structure S by the number of sequences folding into this
particular structure and ��r� is the fraction of sequences folding into S� The parameters b and c
describe the number of very frequent structures and the fall�o" of the tail of very rare structures�
respectively� a is a normalization factor� The frequency distribution of structures has a very sharp
peak� relatively few structures are very common� many structures are rare and play no statistically
signi�cant role�
An almost linear increase of the strucure correlation length with chain length is observed for
RNA sequences� Substantial di"erences are found in the correlation lengths derived from di"erent
base pairing alphabets� In particular� the structures of natural AUGC sequences are much more
stable against mutation than pure GC�sequences or pure AU�sequences�
It provides a plausible explanation for the use of two base pairs in nature� optimization in an RNA
world with only one base pair would be very hard� and the base pairing probability in sequences
with three base pairs is rather low and hence most random sequences of short chain lengths �n� ��
do not form thermodynamically stable structures� The choice of two base pairs thus appears to
be a compromise between stability against mutation and thermodynamic stability� An alternative
explanation for the usage of two base pairs in nature was published recently ����� the current
alphabet is understood to be optimal in an RNA world where replication �delity decreases and
� �� �
Stadler� Towards a Theory of Landscapes
Table �� Asymptotic behaviour of correlation lenght for RNA secondary structurs�
�G
Alphabet MFE MFE�s��
PF KIN
GC ������ ����� � ���� ������AU �����GU �����AUI ����AGC ������AUC �����AUG ������UGC ��� GCAU ��� �� ������ � ��� ������GCAU� ���� GCXK �����ABCDEF ����
� See table ���GU pairs forbidden�
catalytic e�ciency increases with alphabet size� Both hypothesis are experimentally testable and
hence we may expect a decision in favor of one of the two alternatives in the future�
In order to gain more information on the relation between RNA sequences and structures an
inverse folding algorithmwhich determines the sequences that share the same minimumfree energy
secondary structure was conceived and applied to a variety of di"erent structures ����� One �nds
that sequences folding into the same secondary structure are� in essence� randomly distributed�
Since there are relatively few common structures and the sequences folding into the same structure
are randomly distributed in sequence space� all common structrues are found in relatively small
patches of sequence space� For natural AUGC�sequences of chain length n����� for instance� we
can expect all common structures to be found in a sphere of radius h��� in Hamming distance�
There are as many as ��� � ���� sequences in such a ball� Although this number is large� it isnothing compared to the total number of sequences of this chain length� ��������� �� ��On the other hand there is a high probability for �nding neutral neighbors� For the biophysical
alphabet one �nds� for instance� pNN � ��� for long enough chains� Hence the sequences folding intoa given target structure are not isolated in sequence space� In order to re�ne our understanding of
their geometrical arrangement in sequence space a computer experiment was carried out allowing
for an estimate of the diameter of connected sets of neutral sequences� We search for �neutral
paths� through sequence space� The Hamming distance from the reference increases monotonously
along such a neutral path but the structure remains unchanged� A neutral path ends when no
further neutral sequence is found in the neighbourhood of the last sequence� Biophysics forces us
to allow for a modi�cation of the notion of neighborhood� we allow point mutations as well as the
replacement of a base pair by another type of base pair� The length L of a path is the Hammingdistance between the reference sequence and the last sequence� and hence a lower bound on the
diameter of the connected �neutral network�� Clearly� a neutral path cannot be longer than the
chain length� L�n� It turns out that a fraction of as many as ��8 of all neutral walks have length
L � n for AUGC sequences for length n � ���� They lead through the entire sequence space
to a sequence di"ering in all positions from the reference but still sharing its structure� In shape
spaces derived from binary sequences almost no neutral path reaches the complementary sequence�
� �� �
Stadler� Towards a Theory of Landscapes
This is certainly a consequence of the symmetry of the binomial distribution� there are very few
sequences in the error classes n��� n��� etc�� and it is unlikely that we �nd one among themwhich folds precisely into the same structure as the reference sequence� Still the average lenght Lis much larger than the average distance of two randomly chosen sequences� L � n �� For details
see �����
The union of all neutral paths forms a dense neutral network in the example considered here�
This� of course� need not be the case in general� we may have short neutral paths con�ned to
small disjoint regions in sequence space� We may expect a chracteristic change in the hardness of
the optimization problem depending on whether the network of neutral paths is below or above a
percolation threshold� It is worth noting that neutral nets are not a peculiarity of the few most
frequent structures� Even the rarest structures we were able to �nd give rise to networks that reach
way beyond the average distance of random sequences ������
Random combinatory maps with prescribed correlation structure are not as easy to construct as
random �elds� As a �rst step one considers only the pre�image of a certain structure� i�e�� the
set of all sequences folding into the same secondary structure� This set forms a sub�graph of the
con�guration space� The structure of such random sub�graphs with a prescribed probability for
neutral neighbors� that is� with a prescribed vertex degree has been investigated in detail ������
In particular� explicit expressions for the fraction of neutral mutations such that the subgraph is
dense and connected have been obtained for Hamming graphs� A random sub�graph of a Hamming
graph with a alphabet of size � is dense and connected in the limit of large systemsize n if and
only if
pNN � �� ���p��� �
� �� �
Stadler� Towards a Theory of Landscapes
�Conclusions
The basic ingredient of the theory of landscapes presented in this contribution is the notion ofFourier series de�ned on arbitrary graphs� The detailed mathematical form of these series dependscrucially on the geometry of the con�guration space on which the landscape� or a random �eldmodel of a landscape� is de�ned in that the basis functions are eigenvectors of the graphs Laplacian�Landscapes which are such eigenvectors are termed elementary as they play a special role in thetheory� Surprisingly� we �nd that almost all the well known combinatorial optimization problems�with the exception of the asymmetric TSP� are elementary� The main subject of this contributionis therefore a theory of elementary landscapes and random �elds�
It turns out the correlation structure of landscapes and random �elds is closely linked to thesegeneralized Fourier series� and therefore to the spectrum of the graph Laplacian� In particularthe geometry of local optima can be linked to the graph Laplacian� Isotropic random �elds arecharacterized in terms of their Fourier coe�cients� All landscapes on the Boolean hypercubecan be represented as a superposition of p�spin Hamiltonians� and isotropic Gaussian landscapescorrespond exactly to a superposition of Derrida�s version of p�spin models� the coupling coe�cientsare uncorrelated and the variance of the coe�cients depends only on the order p of the coupling�The Fourier expansion of ��tness� landscapes can be used to �nd the set of all possible correlationfunctions� more precisely� the set of all autocorrelation functions forms a simplex spanned bysuitably normalized left eigenvectors of the collapsed adjacency matrix of the con�guration space�The corresponding eigenvalue determines the decay of the correlation function along a simplerandom walk on the landscape�
The formalism derived in this contribution suggests to approximate a given landscape by a su�perposition of statistical models that are elementary landscapes �which are hopefully easier tounderstand�� The coe�cients of such a superposition can be obtained by observing that the corre�lation function is a superposition of the correlation functions of the elementary landscapes underconsideration� The latter can be computed analytically for a number of problems� since theyare the left eigenvectors of the collapsed adjacency matrix of the underlying con�guration space�Instead of the correlation function we can then use the coe�cients of this decomposition as ameans of characterizing a landscape� On a Boolean hypercube� for instance� this spectrum can beinterpreted directly as the relative importance of p�ary �spin� interactions�
As a biological application we have studied RNA free energy landscapes� It turns out that thenatural GCAU landscape can be �tted reasonably well by a superposition of a ��spin and a ��spin model with equal amplitude� while the GC and GCXK landscapes can be approximatedby a ��spin model� We do not expect that RNA landscapes are elementary� we rather expect adistribution of p�spin models centered around p � �� The numerical correlation data are to noisy�however� to permit a higher resolution� and we have to be content with the approximate locationof the peak�
An extension of the notion of �tness landscapes to general sequence structure relations is outlinedvery brie�y in the last sections� Based on an alternative form the autocorrelation one de�nes ageneralized correlation function for mappings from one metric space into another one� Whether ananlogy of the Fourier theory of landscapes is possible also for such �combinatory maps� and theirrandom �eld models is unknown at present�
Acknowledgements
Fruitful discussions with Andreas Dress� Walter Fontana� Ivo Hofacker� Stuart Kau"man� ChristianReidys� Peter Schuster� and G�unter Wagner are gratefully acknowledged�
� � �
Stadler� Towards a Theory of Landscapes
References
��� E� Aarts and J� Korst� Simulated Annealing and Boltzman Machines� J� Wiley 7 Sons� New
York� ���
��� C� Amitrano� L� Peliti� and M� Saber� Population dynamics in a spin�glass model of chemical
evolution� J� Mol� Evol�� �� �� � � ���
�� M� Averintsev� On a method of describing complete parameter �elds� Problemy Peredaci
Informatsii� ��������� ����
��� P� Bak� H� Flyvbjerg� and B� Lautrup� Coevolution in a rugged �tness landscape� Phys�Rev�
A��� ������������ ���
� � G� Baker� Drum shapes and isospectral graphs� J�Math�Phys�� ������ ����
��� M� Bartlett� An Introduction to Stochastic Processes� Cambridge University Press� Cambridge
UK� � �
��� C� Benson and J� Jacobs� On hearing the shape of combinatorial drums� J�Comb�Theory�B��
���������� ����
��� J� Bernasconi� Low autocorrelation binary sequences� statistical mechanics and con�guration
space analysis� J�Physique� ��� � ��� ����
�� J� Besag� Spatial interactions and the statistical analysis of lattice systems� Amer� Math�
Monthly� ��������� ����
���� N� Biggs� Finite Groups of Automorphisms� volume � of London Mathematical Society Lecture
Notes� Cambridge University Press� Cambridge UK� ����
���� N� Biggs� Algebraic Graph Theory� Cambridge University Press� Cambridge UK� �st edition�
����
���� N� L� Biggs� Algebraic Graph Theory� Cambridge University Press� Cambridge UK� �nd
edition� ���
��� N� L� Biggs and A� White� Permutation Groups and Combinatorial Structures� Cambridge
University Press� Cambridge UK� ���
���� K� Binder and A� P� Young� Spin glasses� Experimental facts� theoretical concepts� and open
questions� Rev�Mod�Phys�� ��������� ����
�� � R� G� Bland and D� F� Shallcross� Large traveling salesmen problems arising from experiments
in x�ray crystallography� Oper�Res�Lett�� ���� ����� ����
���� H� Bohr and S� Brunak� Travelling salesman approach to protein conformation� Complex
Systems� ����� ���
���� B� Bollob/as� Graph Theory An Introductory Course� Springer�Verlag� New York� ���
���� S� Bonhoe"er and P� F� Stadler� Errortreshold on complex �tness landscapes� J� Theor�
Biol�� ���� ���� ��
� �� �
Stadler� Towards a Theory of Landscapes
��� A� Bray and M� Moore� Metastable states in spin glasses� J�Phys�C�Solid St�Phys�� ��L���
L���� ����
���� A� Bray and M� Moore� Metastable states in spin glasses with short�ranged interactions�
J�Phys�C�Solid St�Phys�� ���������� ����
���� A� Brouwer� A� Cohen� and A� Neumaier� Distance�regular Graphs� Springer Verlag� Berlin�
New York� ���
���� R� Brualdi and H� Ryser� Combinatorial Matrix Theory� Cambridge Univ� Press� Cambridge
UK� ���
��� P� Cameron and J� vanLint� Designs� Graphs� Codes� and their Links� volume �� of London
Math� Soc� Student Texts� Cambridge University Press� Cambridge UK� ���
���� D� Chan and D� Mercier� IC insertion� An application of the TSP� Int�J�Prod�Res�� �����
���
�� � I� Chavel� Eigenvalues in Riemannian Geometry� Academic Press� Orlando Fl�� ����
���� D� Cvetkovi/c� M� Doob� and H� Sachs� Spectra of Graphs Theory and Applications� Aca�
demic Press� New York� ����
���� D� Cvetkovi/c� M� Doob� and H� Sachs� Spectra of Graphs Theory and Applications� volume
New York� Academic Press� ����
���� C� De Dominicis� M� Gabay� T� Garel� and H� Orland� White and weighted averages over
solutions of the Thouless Anderson Palmer equations for the Sherrington Kirkpatrick spin
glass� J�Physique� ������� ����
��� P� Delsarte� An algebraic approach to association schemes of coding theory� volume �� of
Phillips Research Reports Supplements� Phillips� ���
��� B� Derrida� The random energy model� Phys�Rep�� ����� � ����
��� B� Derrida� Random energy model� Limit of a family of disordered models� Phys�Rev�Lett��
� ������ ����
��� B� Derrida� Random�energy model� An exactly solvable model of disorderes systems� Phys�
Rev� B� ��� ����������� ����
�� B� Derrida and E� Gardner� Metastable states of a spin glass chain at � temperature�
J�Physique� ��� �� � ����
��� P� Diaconis and M� Shahshahani� Generating a random permutation with random transpo�
sitions� Z� Wahrscheinlichkeitsth� verw� Gebiete� ��� ���� ����
� � R� Dobrushin� The description of a random �eld by means of its conditional probabilities�
and conditions of its regularities� Th� Prob� � Appl�� ��������� ����
��� A� Dress and D� Rumschitzki� Evolution on sequence space and tensor products of represen�
tation spaces� Acta Appl�Math�� ���������� ����
��� C� Dunkl� A Krawtchouk polynomial addition theorem and wreath products of symmetric
groups� Indiana Univ�Math�J�� � � � �� ����
� �� �
Stadler� Towards a Theory of Landscapes
��� C� Dunkl� Orthogonal functions on some permutation groups� In D� Ray�Chaudhuri� editor�
Proceeding of Symposia in Pure Mathematic Vol� ��� New York� ��� American Mathemat�
ical Society�
�� M� Eigen� Selforganization of matter and the evolution of biological macromolecules� Die
Naturwissenschaften� ����� � �� ����
���� M� Eigen� J� McCaskill� and P� Schuster� The molecular Quasispecies� Adv� Chem� Phys��
� ��� � ��� ���
���� M� Fisher� On hearing the shape of a drum� J�Comb�Theory� ���� ��� � ����
���� H� Flyvbjerg and B� Lautrup� Evolution in a rugged �tness landscape� Phys� Rev� A�
������������ ���
��� W� Fontana� T� Griesmacher� W� Schnabl� P� Stadler� and P� Schuster� Statistics of land�
scapes based on free energies� replication and degredation rate constants of RNA secondary
structures� Monatsh� Chemie� ����� ���� ���
���� W� Fontana� D� A� M� Konings� P� F� Stadler� and P� Schuster� Statistics of rna secondary
structures� Biochemistry� ��������� ��
�� � W� Fontana� W� Schnabl� and P� Schuster� Physical aspects of evolutionary optimization and
adaption� Physical Review A� ������������ ���
���� W� Fontana and P� Schuster� A computer model of evolutionary optimization� Biophysical
Chemistry� ���������� ����
���� W� Fontana� P� F� Stadler� E� G� Bornberg�Bauer� T� Griesmacher� I� L� Hofacker� M� Tacker�
P� Tarazona� E� D� Weinberger� and P� Schuster� RNA folding and combinatory landscapes�
Phys� Rev� E� �������� � ��� ��
���� S� M� Freier� R� Kierzek� J� A� Jaeger� N� Sugimoto� M� H� Caruthers� T� Neilson� and D� H�
Turner� Improved free�energy parameters for predictions of RNA duplex stability� Proc� Natl�
Acad� Sci�� USA� ������� ����
��� Y� Fu and P� W� Anderson� Application of statistical mechanics to NP�complete problems
in combinatorial optimization� J�Phys�A�Math�Gen�� ����� ������ ����
� �� C� Gardiner� Handbook of Stochastic Methods� Springer�Verlag� Berlin� �nd edition� ���
� �� E� Gardner and B� Derrida� The probability distribution of the partition function of the
random energy model� J�Phys� A� ����� ����� ���
� �� M� Garey and D� Johnson� Computers and Intractability� A Guide to the Theory of NPCompleteness� Freeman� San Francisco� ���
� � G�M� Adel�son�Velskii et al� Example of a graph without a transitive automorphism group�
Soviet� Math� Dokl�� ����������� ��� Russian�
� �� C� D� Godsil� Algebraic Combinatorics� Chapman 7 Hall� New York� ��
� � M� Golay� Sieves for low�autocorrelation binary sequences� IEEE Trans�Inform�Th�� IT�
���� �� ����
� �� �
Stadler� Towards a Theory of Landscapes
� �� G� Grimmet� A theorem about random �elds� Bull� London Math� Soc�� ����� � ���
� �� L� Grover� Local search and the local structure of NP�complete problems� Oper�Res�Lett��
���� ���� ���
� �� R� W� Hamming� Error detecting and error correcting codes� Bell Syst�Tech�J�� ����������
� ��
� � D� G� Higman� Intersection matrices for �nite permutation groups� J� Algebra� �������� ����
���� I� Hofacker� P� Schuster� and P� Stadler� Combinatorics of secondary structures� submitted
to SIAM J� Disc� Math�� ��
���� I� L� Hofacker� W� Fontana� P� F� Stadler� L� S� Bonhoe"er� M� Tacker� and P� Schuster�
Vienna RNA Package� pub�RNA�ViennaRNA����� � ftp�itc�univie�ac�at� �Public Do�
main Software��
���� I� L� Hofacker� W� Fontana� P� F� Stadler� S� Bonhoe"er� M� Tacker� and P� Schuster� Fast
folding and comparison of RNA secondary structures� Monatsh� Chemie� �� ������������
���
��� P� Hogeweg and B� Hesper� Energy directed folding of RNA sequences� Nucleic acids research�
��������� ����
���� H� Hotelling� Analysis of a complex of statistical variables into principal components�
J�Educ�Psych�� ���������� and ��� ��� ��
�� � M� Huynen and P� Hogeweg� Pattern generation in molecular evolution� Exploitation of the
variation in RNA landscapes� J�Mol�Evol�� ������ ���
���� M� A� Huynen� P� F� Stadler� and W� Fontana� Evolution of RNA and the Neutral Theory�
SFI Preprint 9 �������� � �
���� R� Ingram� Some characters of the symmetric group� Proc�Amer�Math�Soc�� �� ���� � ��
���� M� Kac� Can you hear the shape of a drum� Am�Math�Monthly� ��������� ����
��� S� Karlin and H� Taylor� A �rst course in stochastic processes� Academic Press� New York�
�� �
���� S� Kau"man� The Origin of Order� Oxford University Press� New York� Oxford� ��
���� S� A� Kau"man and S� Levin� Towards a general theory of adaptive walks on rugged land�
scapes� J� Theor� Biol�� ������� ����
���� S� A� Kau"man and E� D� Weinberger� The n�k model of rugged �tness landscapes and its
application to maturation of the immune response� J� Theor� Biol�� �������� ���
��� T� Koornwinder� Krawtchouk polynomials� A uni�cation of two di"erent group theoretic
interpretations� SIAM J�Math�Anal�� ����������� ����
���� B� Krakhofer� Local optima in landscapes of combinatorial optimization problems� Master�s
thesis� University of Vienna� Dept� of Theoretical Chemistry� � �
�� � M� Krawtchouk� Sur une g2en2eralisation des polynomes d�Hermite� Comptes Rendus� �������
���� ���
� � �
Stadler� Towards a Theory of Landscapes
���� K� Laidler� Chemical Kinetics� Harper� New York� rd edition� ���
���� E� L� Lawler� J� K� Lenstra� A� H� G� R� Kan� and D� B� Shmoys� The Traveling Salesman
Problem� A Guided Tour of Combinatorial Optimization� John Wiley 7 Sons� �� �
���� S� Lin and B� Kernighan� An e"ective heuristic algorithm for the traveling salesman problem�
Oper�Res�� ������ ��� �� �
��� L� Lov/asz� Spectra of graphs with transitive groups� Periodica Math�Hung�� ������ � �� �
���� I� MacDonald� Symmetric Functions and Hall Polynomials� Oxford Univ� Press� Oxford UK�
���
���� C� Macken� P� Hagan� and A� Perelson� Evolutionary walks on rugged landscapes� SIAM
J�Appl�Math�� �������� ���
���� C� A� Macken and A� S� Perelson� Protein evolution on rugged landscapes�
Proc�Natl�Acad�Sci�USA� ��������� � ���
��� C� A� Macken and P� F� Stadler� Rugged landscapes� To appear in SFI summerschool volume
�� � �
���� F� MacWilliams and N� Sloane� The Theory of Error�Correcting Codes� North�Holland�
Amsterdam� New York� Oxford� Tokyo� ���
�� � H� M� Martinez� An RNA folding rule� Nucl�Acid�Res�� ����� � ����
���� J� S� McCaskill� The equilibrium partition function and base pair binding probabilities for
RNA secondary structure� Biopolymers� ����� ����� ���
���� M� M/ezard and G� Parisi� Replicas and optimization� J�Physique Lett�� ���L����L���� ����
���� M� M/ezard� G� Parisi� and M� Virasoro� Spin Glass Theory and Beyond� World Scienti�c�
Singapore� ����
��� D� Miller and J� F� Pekny� Exact solution of large asymmetric traveling salesman problems�
Science� � ��� ������ ���
��� W� Miller Jr� Symmetry and Separation of Variable� volume � of Enceyclopedia of Mathe�
matics and its Applications� Cambridge Univ� Press� Cambridge� UK� ����
��� A� A� Mironov� L� P� Dyakonova� and A� E� Kister� A kinetic approach to the prediction
of RNA secondary structures� Journal of Biomolecular Structure and Dynamics� �� �� �
�� �
��� A� A� Mironov and A� E� Kister� RNA secondary structure formation during transcription�
J� of Biomolecular Structure and Dynamics� ����� ����
�� J� Moussouris� Gibbs and Markov systems with constraints� J� Stat� Phys�� ������� ����
��� R� Nussinov� G� Piecznik� J� R� Griggs� and D� J� Kleitman� Algorithms for loop matching�
SIAM J� Appl� Math�� ���������� ����
� � K� Ohmori and E� Tanaka� A uni�ed view on tree metrics� In G� Ferrate� editor� Syntactic
and Structural Pattern Recognition� pages � ����� Berlin� Heidelberg� ���� Springer�Verlag�
� �� �
Stadler� Towards a Theory of Landscapes
��� R� Otten and L� vanGinneken� The Annealing Algorith� Kluwer Acad�Publ�� Boston� ���
��� R� Palmer� Optimization on rugged landscapes� In A� S� Perelson and S� A� Kau"man� editors�
Molecular Evolution on Rugged Landscapes� Proteins� RNA� and the Immune System� pages
�� � Addison Wesley� Redwood City� CA� ���
��� A� S� Perelson and C� A� Macken� Protein evolution on partially correlated landscapes� Santa
Fe Institute Preprint ���������
�� A� S� Perelson and G� Oster� Theoretical studies of clonal selection� Minimal antibody
repertoire size and reliability of self6 non�self discrimination� Journal of Theoretical Biology�
����� ����� ���
����� D� Powers� Eigenvectors of distance�regular graphs� SIAM J� Matrix Anal� Appl�� ������
����
����� D� Powers and M� Sulaiman� The walk partition and colorations of a graph� Linear Algebra
Appl�� ����� �� � ����
����� C� Rao� Linear Statistical Interference and Its Applications� Wiley� New York� �nd edition�
���
���� C� Reidys and C� Forst� Replication on neutral networks in rna induced by rna secondary
structures� Preprint� ���
����� C� Reidys� P� Schuster� and P� F� Stadler� Generic properties of combinatory maps and
application on RNA secondary structures� Preprint� � �
��� � D� Rumschitzky� Spectral properties of eigen�s evolution matrices� J�Math�Biol�� �����������
����
����� G� Sabidussi� Vertex transitive graphs� Mh� Math� ���������� ����
����� W� Salser� Globin messenger RNA sequences ) analysis of base�pairing and evolutionary
implications� Cold Spring Harbour Symp� Quant� Biol�� ���� � ����
����� P� Schuster� Complex optimization in an arti�cial RNA world� In D� Farmer� C� Langton�
S� Rasmussen� and C� Taylor� editors� Arti�cial Life II� volume XII of SFI Studies in the
Science of Complexity� pages ������� Addison�Wesley� ���
���� P� Schuster� W� Fontana� P� F� Stadler� and I� L� Hofacker� From sequences to shapes and
back� A case study in RNA secondary structures� Proc�Roy�Soc�Lond�B� � �������� ���
����� P� Schuster and P� F� Stadler� Landscapes� Complex optimization problems and biopolymer
structures� Computers Chem�� ���� ���� ���
����� A� Schwenk� Computing the characteristic polynomial of a graph� In Graphs and Combina�
torics� volume ��� of Lecture Notes in Mathematics� pages � ����� Springer�Verlag� Berlin�
����
����� L� A� Segel and A� P� Perelson� Computations in shape space� a new approach to immune
network theory� In Theoretical Immunology� Part Two� pages �� � �� Addison�Wesley�
Redwood City �Cal��� ����
� � �
Stadler� Towards a Theory of Landscapes
���� J��P� Serre� Linear Representations of Finite Groups� Springer�Verlag� New York� Heidelberg�
Berlin� ����
����� B� A� Shapiro� An algorithm for comparing multiple RNA secondary stuctures� CABIOS�
�������� ����
��� � B� A� Shapiro and K� Zhang� Comparing multiple RNA secondary structures using tree
comparisons� CABIOS� ������� ���
����� D� Sherrington and S� Kirkpatrick� Solvable model of a spin�glass� Physical Review Letters�
�������� � �� � �� �
����� P� M� Soardi� Potential Theory on In�nite Networks� volume � � of Lecture Notes in Math�
ematics� Springer�Verlag� Berlin� ���
����� G� B� Sorkin� Combinatorial optimization� simulated annealing� and fractals� Technical
Report RC���� �No���� �� IBM Research Report� ����
���� F� Spitzer� Markov random �elds and gibbs ensembles� Amer� Math� Monthly� �������� ��
����
����� F� Spitzer� Principles of Random Walks� Springer�Verlag� New York� ����
����� P� F� Stadler� Correlation in landscapes of combinatorial optimization problems� Europhys�
Lett�� ���������� ���
����� P� F� Stadler� Linear operators on correlated landscapes� J�Physique� ��������� ���
���� P� F� Stadler� Random walks and orthogonal functions associated with highly symmetric
graphs� Disc� Math�� ��� in press�
����� P� F� Stadler and W� Gr�uner� Anisotropy in �tness landscapes� J� Theor� Biol�� �� ������
��
��� � P� F� Stadler and R� Happel� Correlation structure of the landscape of the graph�
bipartitioning�problem� J� Phys� A�� Math� Gen�� � �������� ���
����� P� F� Stadler and R� Happel� Canonical approximation of landscapes� Submitted to
J�Stat�Phys�� ���
����� P� F� Stadler and W� Schnabl� The landscape of the traveling salesman problem� Phys�
Letters A� ��������� ���
����� P� Stein and M� Waterman� On some new sequences generalizing the Catalan and Motzkin
numbers� Discrete Mathematics� ����������� ����
���� E� Szathm/ary� Four letters in the genetic alphabet� a frozen evolutionary optimum!
Proc�Roy�Soc� London B� �� ���� ���
���� M� Tacker� Robust Properties of RNA Secondary Structure Folding Algorithms� PhD thesis�
University of Vienna� ��
���� M� Tacker� W� Fontana� P� Stadler� and P� Schuster� Statistics of RNA melting kinetics� Eur�
J� Biophys�� ������ ���
� �� �
Stadler� Towards a Theory of Landscapes
���� M� Tacker� P� F� Stadler� E� G� Bornberg�Bauer� I� L� Hofacker� and P� Schuster� Robust
properties of RNA secondary structure folding algorithms� In preparation� � �
��� K� Tai� The tree�to�tree correction problem� J� ACM� ��������� ���
���� F� Tanaka and S� Edwards� Analytic theory of the ground state properties of a spin glass� I�
Ising spin glass� J�Phys�F�Metal Phys�� ������������ ����
�� � D� Thouless� P� Anderson� and R� Palmer� Phil�Mag�� � � ����
���� J� vanLint� Introduction to Coding Theory� Springer�Verlag� New York� ����
���� R� Voss� Characterization and measurement of random fractals� Physical Scripta� T��� ��
���� ����
���� M� S� Waterman� Secondary structure of single � stranded nucleic acids� Studies on founda�
tions and combinatorics� Advances in mathematics supplementary studies� Academic Press
N�Y�� ����� � ���� ����
��� E� Weinberger and P� Stadler� Why some �tness landscapes are fractal� J� Theor� Biol��
���� ��� � ��
����� E� D� Weinberger� Correlated and uncorrelated �tness landscapes and how to tell the di"er�
ence� Biol�Cybern�� ��� ��� ���
����� E� D� Weinberger� Fourier and Taylor series on �tness landscapes� Biological Cybernetics�
� ������ ���
����� E� D� Weinberger� Local properties of Kau"man�s N�k model� A tunably rugged energy
landscape� Phys� Rev� A� ������������� ���
���� P� Whittle� Stochastic processes in several dimensions� Bull� Int� Statist� Inst�� ��������
���
����� H� Wielandt� Finite Permutation Groups� Academic Press� New York� ����
��� � S� Wright� The roles of mutation� inbreeding� crossbreeeding and selection in evolution�
In D� F� Jones� editor� Int� Proceedings of the Sixth International Congress on Genetics�
volume �� pages ����� ���
����� M� Zuker� mfold���� pub�mfold�tar�Z � nrcbsa�bio�nrc�ca� �Public DomainSoftware��
����� M� Zuker� The use of dynamic programming algorithms in RNA secondary structure predic�
tion� In M� S� Waterman� editor� Mathematical Methods for DNA Sequences� pages � �����
CRC Press� ���
����� M� Zuker and D� Sanko"� RNA secondary structures and their prediction� Bull�Math�Biol��
������ ������ ����
� �� �
Stadler� Towards a Theory of Landscapes
Table of Contents
�� Introduction �
�� Con�guration Spaces �
���� An Example ) TSP �
���� Groups
������ Permutation Groups
������ Orbits� Orbitals� and Symmetry Classes �
����� Incidence Matrices �
������ Intersection Numbers and Collapsed Matrices
���� � Association Schemes �
��� Graphs �
����� Graphs and Their Associated Matrices �
����� Symmetry and Regularity of Graphs
���� Vertex�Transitive Graphs ��
����� Cayley Graphs ��
��� � Distance Regular Graphs �
���� Fourier Series on Graphs �
�� � Spectral Properties of the Adjacency Matrix �
�� ��� Equitable Partitions �
�� ��� Equitable Partitions with a Reference Vertex ��
�� �� The Adjacency Algebra ��
���� Examples of Con�guration Spaces �
������ Sequence Spaces �
������ Generalized Hamming Graphs ��
����� Johnson Graphs ��
������ Odd Graphs ��
���� � Cayley Graphs of the Symmetric Group ��
������ A Concluding Remark ��
� Random Fields �
��� Preliminaries �
����� De�nition �
����� Gaussian Random Fields �
� i �
Stadler� Towards a Theory of Landscapes
���� Averages �
��� Karhunen�Lo2eve Decomposition ��
�� The Markov Property ��
��� Isotropy ��
����� Characterization of Isotropic Random Fields ��
����� Landscapes on the Hypercube and the p�Spin Models �
���� Autocorrelation Functions of Isotropic Random Fields �
����� Gaussian Markovian Isotropic Random Fields �
� � Homogeneity �
��� Superpositions of Random Fields �
����� De�nition �
����� The Random Energy Model �
���� Nk Models �
����� Superposition of Nk Models �
��� Transformations
����� Operators on Landscapes and Random Fields
����� Averaging and Iterated Smoothing Landscapes
���� Non�Linear Transformations �
�� Landscapes
���� Empirical Correlation Functions
������ Characterization of Empirical Correlation Functions
������ Simple Random Walks on Landscapes
����� General Vertex Transitive Graphs ��
������ Correlation Length ��
���� Elementary Landscapes ��
��� Local Optima �
����� Local Optima and the Eigenstructure of the Laplacian ��
����� The Number of Local Optima ��
���� Some Example Landscapes ��
������ Traveling Salesman Problems ��
������ Graph Bipartitioning Problem �
����� The Low Autocorrelated Binary String Problem �
������ Not�All�Equal�Satis�ability �
� ii �
Stadler� Towards a Theory of Landscapes
���� � Graph Coloring �
������ Weight Partition �
������ Graph Matching Problem �
�� � Classi�cation of Landscapes
�� ��� Fractal Landscapes
�� ��� Classi�cation by the �Form� of the Correlation Functions
�� �� Classi�cation Based on the Characterization of Correlation Function
���� Landscapes on Irregular Graphs �
������ Correlation Functions �
������ An Upper Bound on the Nearest Neighbor Correlation �
���� Empirical Anisotropy �
� Biological Landscape� RNA ��
��� RNA Secondary Structures ��
����� Structure Formation ��
����� Structure Prediction ��
��� RNA Free Energy Landscapes ��
�� Combinatory Maps ��
���� The Metric Space of RNA Secondary Structures ��
���� Correlation in Combinatory Maps �
��� The Combinatory Maps of RNA Secondary Structures ��
�� Conclusions �
Acknowledgements �
References ��
� iii �