Post on 14-Jan-2020
ii
The genetic and biochemical analysis of Drosophila Wwox
protein function
A thesis submitted for the degree of Doctor of Philosophy, August 2008
Alexander Colella, B. Sc. (Hons)
School of Molecular and Biomedical Science, Discipline of Genetics,
ARC Special Centre for the Molecular Genetics of Development,
The University of Adelaide
iii
iv
Table of contents
Index of Figures and Tables...........................................................................................................................x
Declaration ................................................................................................................................................. xiv
Acknowledgements...................................................................................................................................... xvi
Abbreviations ..............................................................................................................................................xviii
Abstract ................................................................................................................................................ xxii
1 Chapter 1: Introduction ................................................................................................4
1.1 Chromosomal fragile sites ....................................................................................................................4
1.1.1 Rare fragile sites.......................................................................................................................4
1.1.2 Common fragile sites................................................................................................................5
1.1.3 Fragile site FRA16D .................................................................................................................5
1.2 WW-domain containing oxidoreductase (WWOX) ..............................................................................6
1.2.1 WWOX – Genomic location and Structurte .............................................................................6
1.2.2 WWOX transcripts and protein products .................................................................................7
1.2.3 Wwox / WWOX localisation......................................................................................................8
1.2.4 WWOX protein structure / function ..........................................................................................9
1.2.4.1 Short chain dehydrogenase/reductase enzymes (SDRs) .............................................10
1.2.5 WWOX / Wwox binding proteins............................................................................................12
1.3 WWOX and cancer .............................................................................................................................12
1.3.1 WWOX expression profile and gene status in cancer cells ..................................................12
1.3.2 WWOX / Wwox proapoptotic activity .....................................................................................15
1.3.2.1 Wwox overexpresion enhances TNF killing...................................................................15
1.3.2.2 Wwox physically interacts with p53 and is required for p53 dependent killing.............16
1.3.2.3 Wwox and p73 induce apoptosis synergistically ...........................................................16
1.3.2.4 WWOX / Wwox enhances tumor necrosis factor (TNF) cytotoxicity.............................16
1.3.2.5 WWOX physically interacts with JNK1 which blocks WWOX mediated cell death......17
1.3.3 WWOX / Wwox as a tumor suppressor .................................................................................17
1.3.3.1 Ectopic expression of WWOX / Wwox suppresses cancer cell growth........................17
1.3.3.2 Wwox knockout and hypomorph mice exhibit increase in tumorigenesis ....................18
1.3.4 Drosophila Wwox....................................................................................................................18
1.3.4.1 Wwox null flies exhibit increased sensitivity to ionising radiation .................................18
1.3.5 Summary .................................................................................................................................20
1.4 Project aims and approaches.............................................................................................................20
v
1.4.1 Aim #1: To determine the functional domains / regions in the Wwox protein .....................20
1.4.2 Aim #2: To determine whether the various functional domains / regions of Wwox lead to
quantitative / qualitative changes in other proteins in vivo. ...............................................................21
2 Chapter 2: Materials & Methods............................................................................... 24
2.1 Oligonucleotide primers......................................................................................................................24
2.1.1 Cloning Primers......................................................................................................................24
2.1.1 Sequencing & Diagnostic Primers.........................................................................................25
2.2 Enzymes .............................................................................................................................................25
2.3 Antibiotics............................................................................................................................................25
2.4 Plasmids..............................................................................................................................................25
2.5 Bacterial strains .................................................................................................................................. 26
2.6 Kits 26
2.7 Molecular weight markers ..................................................................................................................26
2.8 Antibodies ...........................................................................................................................................26
2.9 Bacterial Media ................................................................................................................................... 27
2.10 Drosophila Media..............................................................................................................................27
2.11 Buffers and Solutions .......................................................................................................................27
2.12 PCR amplification of DNA................................................................................................................29
2.13 Generation of recombinant plasmids...............................................................................................29
2.14 Transformation of bacteria ...............................................................................................................29
2.15 Isolation of plasmid DNA..................................................................................................................29
2.16 Genomic DNA preparations .............................................................................................................29
2.17 Agarose gel electrophoresis ............................................................................................................30
2.18 Automated DNA sequencing............................................................................................................30
2.19 Generation of deletion constructs.................................................................................................... 30
2.20 In vitro site directed mutagenesis .................................................................................................... 31
2.21 P-element transformation of Drosophila..........................................................................................31
2.21.1 Fly strains .............................................................................................................................31
2.22 Irradiation of Drosophila ...................................................................................................................32
2.23 One-dimensional polyacrylamide gel electrophoresis .................................................................... 32
2.24 Two-dimensional electrophoresis .................................................................................................... 32
2.24.1 Drosophila protein preparations ..........................................................................................32
2.24.2 Cy Dye Labelling of proteins................................................................................................33
2.24.3 Rehydration loading isoelectric focusing.............................................................................33
2.24.4 Cup loading isoelectric focusing..........................................................................................33
vi
2.24.5 Second-dimension SDS-PAGE............................................................................................33
2.25 Protein visualisation on polyacrylamide gels...................................................................................34
2.25.1 Sypro Ruby Staining.............................................................................................................34
2.25.2 Coomassie brilliant blue staining (CBB) ..............................................................................34
2.25.3 Antibody detection (Western blotting)..................................................................................34
2.26 DIGE analysis ...................................................................................................................................34
2.27 Sample preparation for mass spectrometric analysis .....................................................................34
2.27.1 Excision and destaining........................................................................................................35
2.27.2 Reduction and alkylation ......................................................................................................35
2.27.3 Proteolytic digestion..............................................................................................................35
2.28 Mass spectrometry............................................................................................................................35
3 Chapter 3: Investigation of the radiation sensitivity of Wwox mutant flies ........40
3.1 Introduction..........................................................................................................................................40
3.1.1 Use of the Drosophila model system.....................................................................................40
3.1.2 Approach: Radiation sensitivity of various Wwox mutants ...................................................41
3.2 Materials and Methods .......................................................................................................................42
3.2.1 Wwox deletion construct generation......................................................................................42
3.2.2 Wwox enzyme mutant construct generation..........................................................................43
3.2.3 DNA sequencing of transformed Drosophila lines ................................................................43
3.2.4 Detection of mutant Wwox proteins .......................................................................................43
3.2.5 Irradiation of Drosophila .........................................................................................................43
3.3 Results.................................................................................................................................................44
3.3.1 Verification and detection of WW domain deleted Wwox fly lines........................................44
3.3.2 Flies expressing WW domain deleted Wwox proteins not sensitive to IR ...........................45
3.3.3 Wwox enzyme mutant Drosophila generation and verification.............................................46
3.3.4 DNA sequencing of enzyme mutant flies...............................................................................47
3.3.5 Detection of enzyme mutant proteins ....................................................................................48
3.3.6 Flies expressing enzyme mutant Wwox proteins not sensitive to IR ...................................49
3.4 Discussion ...........................................................................................................................................50
3.4.1 Lack of IR sensitivity in Wwox mutant fly lines generated ....................................................50
3.4.2 Inconsistencies observed in IR exposure experiments.........................................................51
3.4.3 Summary .................................................................................................................................51
vii
4 Chapter 4: Proteomic analysis of the consequences of Wwox gene mutations 56
4.1 Introduction ......................................................................................................................................... 56
4.1.1 Proteomic analysis of Wwox null mutant fly lines ................................................................. 56
4.1.2 Approach: 2D DIGE analysis of wildtype and Wwox null mutant adult fly proteomes. ....... 56
4.1.3 2D DIGE experimental design ...............................................................................................59
4.2 Materials and Methods.......................................................................................................................61
4.2.1 Sample preparation................................................................................................................61
4.2.2 DIGE labelling of protein samples .........................................................................................61
4.2.3 Electrophoretic separation of proteins...................................................................................61
4.2.4 Image analysis........................................................................................................................62
4.2.5 Protein identification...............................................................................................................62
4.3 Results ................................................................................................................................................64
4.3.1 Proteome changes detected by DIGE between w1118 and Wwox null mutants...................64
4.3.2 Multivariate statistical analysis of DIGE data ........................................................................ 67
4.3.3 Mass spectrometry identification of differentially expressed spots...................................... 70
4.4 Discussion...........................................................................................................................................72
4.4.1 Unexpected level of variation detected between Wwox mutant flies ................................... 72
4.4.2 Multivariate statistical analysis...............................................................................................72
4.4.3 Wwoxf04545 flies - the odd ones out ........................................................................................73
4.4.4 Background mutations detected in Wwox mutant fly lines ...................................................74
4.4.5 The significance of proteins identified in this study ..............................................................74
4.4.6 Conclusions ............................................................................................................................75
5 Chapter 5: Proteomic analysis of Wwox1 2-4 hour embryos................................ 78
5.1 Introduction ......................................................................................................................................... 78
5.1.1 Examination of backcrossed 2-4 hour Drosophila embryos.................................................78
5.2 Materials and Methods.......................................................................................................................78
5.2.1 Embryo collection ...................................................................................................................78
5.2.2 Sample preparation................................................................................................................79
5.2.3 DIGE labelling of protein samples .........................................................................................79
5.2.4 Electrophoretic separation of proteins...................................................................................79
5.2.5 Image analysis........................................................................................................................80
5.2.6 Protein identification...............................................................................................................80
5.3 Results ................................................................................................................................................81
5.3.1 Proteome changes detected by DIGE between w1118 and Wwox null mutants...................81
viii
5.3.2 Mass spectrometry identification of differentially expressed spots.......................................83
5.4 Discussion ...........................................................................................................................................84
5.4.1 Changes in Superoxide dismutase 1 abundance detected in both embryos and adults ....84
5.4.2 Possible links between Wwox and Sod .................................................................................85
5.4.3 Other proteins identified in this study.....................................................................................86
5.4.4 Summary .................................................................................................................................87
6 Chapter 6: The investigation of proteomic alterations resulting from changes in
Wwox protein levels in Drosophila........................................................90
6.1 Introduction..........................................................................................................................................90
6.1.1 2D DIGE experimental design................................................................................................90
6.2 Materials and Methods .......................................................................................................................93
6.2.1 Sample preparation ................................................................................................................93
6.2.2 DIGE labelling of protein samples..........................................................................................93
6.2.3 Electrophoretic separation of proteins ...................................................................................94
6.2.4 Antibody detection (Western blotting)....................................................................................94
6.2.5 Image analysis ........................................................................................................................94
6.2.6 Protein identification ...............................................................................................................94
6.2.6.1 Nano-flow-Liquid chromatography-Electro Spray Ionisation-Ion Trap-Mass
Spectrometry (LC-ESI-IT-MS) ........................................................................................................94
6.2.6.2 MALDI-TOF/TOF MS ......................................................................................................95
6.2.6.3 Estimating protein abundance from LC-ESI-IT-MS data using emPAI values.............96
6.3 Results.................................................................................................................................................98
6.3.1 Proteome changes detected by DIGE ...................................................................................98
6.3.2 Spot changes resulting from null Wwox expression..............................................................98
6.3.3 Spot changes resulting from ectopic Wwox expression......................................................101
6.3.4 Detection of Wwox protein in lines over-expressing Wwox ................................................104
6.3.5 Mass spectrometry detection of protein spots.....................................................................106
6.3.6 LC-ESI-IT-MS protein identification results .........................................................................107
6.3.7 An explanation of the MS/MS data presented.....................................................................107
6.3.8 Protein IDs for spots that contained single proteins and exhibited changes between
endogenous and Wwox null flies ......................................................................................................109
6.3.9 Proteins identified in spots that contained single proteins and exhibited changes between
endogenous-GAL4 and endogenous-ectopic genotypes ................................................................111
6.3.10 Examination of spots in which multiple proteins were detected .......................................112
ix
6.3.11 Protein abundance estimation using MALDI peptide intensity coverage values.............115
6.3.12 MALDI-TOF/TOF-MS estimation of protein abundances in endogenous and null 2D gel
spot samples......................................................................................................................................116
6.3.13 MALDI-TOF/TOF-MS estimation of protein abundances in Endogenous-GAL4 and
Endogenous-ectopic 2D gel spot samples.......................................................................................118
6.3.14 Comparison of protein identifications from spots obtained from DIGE gels and gels
containing single fly line proteins......................................................................................................120
6.3.15 Protein Identification summary...........................................................................................124
6.4 Discussion..........................................................................................................................................128
6.4.1 2D DIGE analysis of proteomic changes.............................................................................128
6.4.2 A Wwox ‘rescue’ profile not identified..................................................................................130
6.4.3 Mass spectrometry analysis of 2D gel protein spots...........................................................131
6.4.4 Summary...............................................................................................................................133
7 Chapter 7: Final Discussion ....................................................................................138
7.1 Introduction ........................................................................................................................................138
7.2 The impact of background mutations ...............................................................................................138
7.3 Summary of proteomic studies conducted.......................................................................................139
7.4 Biological significance of proteins identified by proteomic analysis................................................140
7.5 Future Directions ...............................................................................................................................144
7.6 Conclusion .........................................................................................................................................145
8 Appendix ..................................................................................................................146
9 References.................................................................................................................159
x
Index of Figures and Tables
Chapter 1
Figure 1.1 Map of the WWOX transcripts and deletion breakpoints at 16q23.2 with respect to FRA16D
....................................................................................................................................................7
Figure 1.2 The WWOX gene and spliced variants .....................................................................................8
Figure 1.3 The two levels of classification within the SDR superfamily...................................................11
Figure 1.4 Key positions for assignments of coenzyme specificity of classical SDRs (A) and extended
SDRs (B)...................................................................................................................................11
Figure 1.5 Dendrogram demonstrating the similarity relationships among WWOX orthologues and six
closest known Drosophila oxidoreductase enzymes..............................................................19
Chapter 3
Figure 3.1 The Drosophila GAL4>UAS system of gene expression .......................................................40
Figure 3.2 Schematic representation of mutant Wwox proteins ..............................................................41
Figure 3.3 WW domain deleted proteins are expressed..........................................................................45
Figure 3.4 Effect of ionising radiation on WW domain deleted Wwox expressing flies ..........................46
Figure 3.5 Sequence alignments obtained from Wwox enzyme mutant fly lines....................................47
Figure 3.6 Wwox enzyme mutant proteins are expressed.......................................................................48
Figure 3.7 Effect of ionising radiation on Wwox enzyme mutant flies .....................................................49
Chapter 4
Figure 4.1 The DIGE pooled internal standard.........................................................................................57
Figure 4.2 Function of the DIGE Cy2 pooled internal standard...............................................................58
Figure 4.3 Normalisation of spot data using the internal standard ..........................................................59
Table 4.1 DIGE experimental design for comparison of w1118 flies with three different Wwox mutants
..................................................................................................................................................61
Figure 4.4 Summary of proteomic changes detected by DIGE analysis between Wwox1 (red), Wwox1-2
(yellow), Wwoxf04545 (blue) and w1118 adult flies.......................................................................65
Figure 4.5 Spot map of proteins exhibiting significant changes in protein abundance between three
different Wwox null mutant lines and w1118 adult flies.............................................................66
Table 4.2 Quantitative 2D-DIGE data for the 26 spots shown in Figure 4.5..........................................67
Figure 4.6 Principal component analysis (PCA) plots of DIGE data........................................................68
Figure 4.7 Unsupervised hierarchical clustering of the 12 independent samples based on the global
expression patterns of the 26 proteins detailed in Table 4.2 .................................................69
xi
Table 4.3. MS Identification of proteins exhibiting a significant change in abundance between w1118 &
Wwox mutant flies....................................................................................................................71
Chapter 5
Table 5.1 DIGE experimental design for comparison of backcrossed 2-4 hour Wwox1 embryos with
w1118 embryos ..........................................................................................................................79
Table 5.2 Spots exhibiting a significant change in protein abundance between w1118 & Wwox1 ......... 81
Figure 5.1 Spot map of proteins differentially expressed between Wwox1 and w1118 2-4 hour embryos..
..................................................................................................................................................82
Table 5.3 MS Identification of proteins exhibiting a significant change in abundance between w1118 &
Wwox1 2-4 hour embryos ........................................................................................................ 83
Chapter 6
Figure 6.1 The classification of Drosophila genotypes examined...........................................................92
Table 6.1 DIGE experimental design for comparison of w1118 flies with three different Wwox mutants
..................................................................................................................................................93
Figure 6.2 Summary of the 2D-DIGE analysis conducted comparing endogenous and null fly
genotypes................................................................................................................................. 98
Table 6.2 Spots exhibiting significant changes between endogenous (w1118) and null (Wwox1 &
Wwoxf04545) genotypes.............................................................................................................99
Table 6.3 Spots exhibiting significant changes between ectopic-GAL4 (w1118; da>GAL4) and null-
GAL4 (Wwox1; da>GAL4 and Wwoxf04545; da>GAL4) genotypes ......................................... 99
Figure 6.3 Summary of the 2D-DIGE analysis conducted that identified spot changes resulting from
ectopic Wwox expression......................................................................................................101
Table 6.4 Spots that exhibited significant changes between endogenous-GAL4 and endogenous-
ectopic genotypes..................................................................................................................102
Table 6.5 Spots that exhibited significant changes between null-GAL4 flies (Wwox1 ; da>GAL4) and
null-ectopic (Wwox1 ; da>Wwox) flies ...................................................................................102
Table 6.6 Spots that exhibited significant changes between null-GAL4 flies (Wwoxf04545; da>GAL4)
and null-ectopic (Wwoxf04545; da>Wwox) flies ......................................................................103
Figure 6.4 Antibody detection of Wwox in protein preparations from ectopic genotypes analysed in the
DIGE experiment ...................................................................................................................104
Figure 6.5 Summary of the MS analysis workflow and outcomes in the identification of proteins from
spots that exhibited changes resulting from null Wwox expression and ectopic Wwox
expression..............................................................................................................................106
xii
Table 6.7 MS Identification of proteins from spots that exhibited changes between endogenous and
Wwox null flies by LC-ESI-IT-MS ..........................................................................................109
Figure 6.6 Map of the 2D gel spots excised for MS analysis that exhibited changes between Wwox null
and endogenous genotypes ..................................................................................................110
Table 6.8 MS Identification of proteins from spots that exhibited changes between endogenous-
ectopic and endogenous-GAL4 genotypes...........................................................................111
Figure 6.7 Map of the 2D gel spots excised for MS analysis that exhibited changes between
endogenous-GAL4 and endogenous-ectopic genotypes .....................................................112
Figure 6.8 Summary of the quantitative MS analysis workflow employed in the identification of proteins
responsible for the 2D gel spot changes detected via DIGE................................................113
Figure 6.9 The experimental workflow for the examination of spots containing multiple proteins .......114
Table 6.9 Protein identifications for spots in which multiple proteins were detected by LC-ESI-IT-MS
using MALDI-TOF/TOF..........................................................................................................117
Table 6.10 Protein identifications for spots in which multiple proteins were detected by LC-ESI-IT-MS
using MALDI-TOF/TOF..........................................................................................................119
Figure 6.10 Comparison of percent protein content for each protein in 6 different spots (A-F) containing
multiple proteins obtained from DIGE gels and gels containing proteins from single fly lines .
................................................................................................................................................121
Table 6.11 Summary of biological functions for proteins that displayed changes in abundance between
w1118 and Wwox null flies .......................................................................................................125
Table 6.12 Summary of biological functions for proteins that displayed changes in abundance between
w1118; da>GAL4 flies and w1118; da>Wwox flies....................................................................126
Figure 6.11 Theoretical plot of log standard abundance values for proteins in a spot displaying a Wwox
‘rescue’ expression profile .....................................................................................................130
xiii
xiv
Declaration
This work contains no material that has been accepted for the award of any other degree or diploma in
any university or other tertiary institution and, to the best of my knowledge and belief, contains no
material previously published or written by another person, except where due reference has been made
in the text.
I give consent to this copy of my thesis, when deposited in the University Library, being available for
loan and photocopying.
Alexander Colella
xv
xvi
Acknowledgements
I would sincerely like to thank all those people who made this thesis possible particularly the University
of Adelaide and the CMGD for providing me with my scholarship. Firstly, I would like to thank my
supervisor Rob Richards for taking me on and giving me enough rope with my project, even though it
meant getting myself into trouble on occasions. Big thanks to Louise O’Keefe for her invaluable help
with all aspects of Drosophila genetics, without your help none of this work would have been possible.
Special thanks to Tim Chataway (my unofficial co-supervisor), for kindly taking me under his wing and
introducing me to the world of ‘Proteomics’ and the TV show ‘Double the Fist’. Thanks to everyone at
the Adelaide Proteomics Centre for their invaluable assistance with much of the mass spectrometry
work conducted in this thesis and especially to Peter Hoffmann for giving me a job at the APC when my
scholarship ran out. I would also like to thank all members of the Richards lab, both past and present,
for being a such great group of people to work with over the years. In particular I would like to give
special thanks to Sonia Dayan (the mother of the lab) for always making time to assist me whenever I
was in need and for her endless patience and also to Amanda Lumsden and Sunita Biswas for their
close friendship over the years. Without friends like you this PhD would have been a hell of a lot more
difficult! Lastly, I would like to thank all my friends and family for their endless support over the years,
without them there is no way I could have ever got this far.
xvii
xviii
Abbreviations
%: percentage
°C: degrees celsius
μg: microgram
μl: microliter
μM: micromolar
1°: primary
1-DE: one-dimensional electrophoresis
2°: secondary
2-DE: two-dimensional electrophoresis
2D: two dimensional
3D: three dimensional
aa: amino acid
ACN: acetonitrile
ATP: adenosine triphosphate
bp: base pair
BSA: bovine serum albumin
BVA: biological variation module
CHAPS: 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate
CID: collision-induced dissociation
cM centimetre
Cy: Cyanine
Da: Dalton
da: daughterless
DIGE: direct in gel analysis
DNA: deoxyribonucleic acid
dNTP: deoxynucleoside triphosphate
DTT: dithiothreitol
EDA: extended data analysis
EDTA: ethylenediaminetetraacetic acid
ELISA: enzyme-linked immunosorbent assay
emPAI: exponentially modified protein abundance index
ESI: electro spray ionisation
EtOH: ethanol
xix
FA: formic acid
GE: General Electric
H2O: water
HCA: hierarchical clustering analysis
HCCA: �-cyano-4-hydroxycinnamic acid
HPLC: high performance liquid chromatography
IEF: isoelectric focusing
IMVS: Institute of Medical and Vetenary Science
IPG: immobilised pH gradient
KCl: potassium chloride
kDa: kilodalton
LC: liquid chromatography
M: molar
mA: milliampere
MALDI: matrix assisted laser desorption ionisation
ml: millilitre
mm: millimetre
mM: millimolar
MQ: MilliQ
mRNA: messenger RNA
MS: mass spectrometry
MS/MS: tandem mass spectrometry
m/z: mass-to-charge
N: number of replicates
NaC:l sodium chloride
NaPO4: sodium phosphate
NCBI: National Centre for Biotechnology Information
ng: nanogram
nl: nanolitre
ORF: open reading frame
p: pico
PAGE: polyacrylamide gel electrophoresis
PAI: protein abundance index
PBS: phosphate buffered saline
PC1: first principal component
PC2: second principal component
xx
PCA: principal component analysis
PCR: polymerase chain reaction
pH: hydrogen ion concentration
pI: isoelectric point
ppm: parts per million
PTM post-translational modification
RNA: ribonucleic acid
RO: reverse osmosis
rpm: revolutions per minute
SDS: sodium dodecyl sulfate
SDR: short-chain dehydrogenase reductase
S/N: signal to noise
SOC: Super Optimal broth plus glucose (originally for Catabolite repression
TBE: Tris/boric acid / EDTA buffer
TBST: Tris-buffered saline Tween-20
TFA: trifluoroacetic acid
TOF: time of flight
Tris: Tris (hydroxymethyl) aminomethane
U: units
UAST: upstream activation sequence
UV: ultraviolet
V: volts
v/v: volume per volume
w/v: weight per volume
w/w: weight per weight
WWOX / Wwox: WW domain containing oxidoreductase
X-Gal X-galactoside (5-bromo-4-chloro-3-indolyl-�-D-galactoside; BCIG)
xxi
xxii
Abstract
WWOX (WW domain-containing oxidoreductase) is a candidate tumor suppressor gene that has been
shown to be involved in various cancers including breast, lung, prostate, gastric and hepatic. The
Drosophila ortholog Wwox was identified and subjected to targeted ‘loss of function’ mutagenesis. The
resulting mutants were found to be viable when homozygous with no obvious defects in the adult fly. As
Wwox mutant flies were found to exhibit an increased sensitivity to ionising radiation (IR), a number of
Wwox proteins specifically deleted or mutated at positions consisting of conserved functional protein
motifs, or regions that are highly conserved among WWOX / Wwox homologs. The Wwox variants were
tested for their ability to modify the IR sensitivity phenotype. In the course of this study, it was found that
background mutations introduced during the generation of the mutant flies was responsible for the IR
sensitivity phenotype. As a result, proteomic alterations resulting from changes in Wwox protein levels in
Drosophila were investigated in order to ascertain the possible molecular functions of the Wwox protein.
2D-DIGE analysis was conducted on a number of different fly genotypes expressing differing levels of
Wwox protein in both adult and embryonic flies. The proteomic changes resulting from lack of Wwox
function as well as Wwox over-expression were detected with the proteins of interest identified by mass
spectrometry (MS) using both MALDI-TOF/TOF-MS and LC-ESI-MS/MS. Label free quantitative MS
analysis was also performed in order to determine the most abundant protein(s) in those spots found to
contain multiple proteins. These proteomic studies identified changes in a wide variety of proteins with a
significant number of metabolic proteins as well as proteins involved in oxidative stress response as a
result of different levels of Wwox expression. Of particular interest, consistent changes in different
isoforms of superoxide dismutase 1 (Sod1) were identified. Due to the known roles these proteins play
in pro and anti-apoptotic pathways, it is possible that Sod1 and Wwox may work in concert to regulate
the delicate balance of defence mechanisms in response to environmental stresses, particularly
oxidative stress. The protein/gene targets identified in this work therefore offer some insights into normal
Wwox function.
1
“Man is a rational animal who always loses his temper when called upon to act in
accordance with the dictates of reason.”
Orson Welles
2
Chapter 1:
Introduction
3
4
Chapter 1: Introduction
1.1 Chromosomal fragile sites
A common feature observed in many types of cancers is DNA instability. The extent to which instability
is a cause rather than a consequence in cancer is unclear. Various forms of genomic instability are
known to have a causative effect in a number of human diseases. Chromosomal fragile sites represent
a specific form of DNA instability that have been demonstrated as having a causative role in a number
of different human diseases. Fragile sites are chromosomal regions that appear as cytogenetically
detectable gaps or breaks in metaphase chromosomes following exposure to specific chemical
conditions (1). Homozygous deletions, translocations and aneuploidy are often observed under
conditions that induce fragile site cytogenetic expression (2). There are two distinct forms of fragile sites
that have been categorized according to the compounds required for their induction and by the
frequency with which they are present in the population. Rare fragile sites, which are present in <5% of
the population, were the first to be characterized and can be cytogenetically induced to appear by
exposure to folate, distamycin A or bromodeoxyuridine (3). Common fragile sites (also known as
constitutive fragile sites) are present on the chromosomes of all individuals and are induced by
aphidicolin, bromodeoxyuridine or 5-azacytidine (4). As fragile sites represent regions of chromosomal
instability and such instability is a common characteristic among cancer cells, fragile sites and
furthermore, the genes situated at these sites are recognised as potentially having some role in the
biology of cancer.
1.1.1 Rare fragile sites
DNA instability associated with rare fragile sites has been known for some time and has been shown to
be the basis of diseases such as fragile-X syndrome (FRAXA) and non-specific mild X-linked mental
retardation (FRAXE) (5, 6). Instability associated with all known rare folate sensitive fragile sites has
been shown to be due in part to a dynamic mutation mechanism associated with expansion of CCG
repeats (7) while expansion of AT rich minisatellite repeats occurs in the non folate sensitive rare fragile
sites that have been characterized (8, 9).
5
1.1.2 Common fragile sites
Studies examining the association between fragile sites and a number of human diseases have begun
to focus increasingly on the common fragile sites in recent times. The suggestion that common fragile
sites may play a role in disease was supported when an association between chromosomal instability at
constitutive fragile sites and cancer was reported (1). The link between common fragile sites and cancer
has been strengthened by numerous studies (10-13) that have detected various forms of chromosomal
instability such as, homozygous deletions and chromosomal rearrangements at constitutive fragile sites
in various forms of cancer (14-17). The strongest evidence for such a role has come from the study of
the FRA3B fragile site at 3p14.2 that exhibits fragility or gaps over a broad region of the chromosome
(18). The FHIT (fragile histidine triad) gene was discovered that spans the FRA3B fragile site (19). Viral
integration sites as well as cancer specific deletions and translocations have been mapped to the
FRA3B site (14, 19-21) and aberrant FHIT alleles have subsequently been discovered in many human
cancer cell lines (22). Tumorigenicity has been found to be reduced in cancer cells by the restoration of
functional FHIT expression (22, 23) suggesting that the FHIT protein acts as a tumor suppressor. Thus
instability at FRA3B resulting in FHIT loss of function is likely to result in a greater susceptibility to
carcinogens leading to a high incidence of cancer (15).
A similar association between a common fragile site and a candidate tumor suppressor gene has been
proposed for the FRA6E fragile site (located at 6q25-q26) and the gene Parkin. Physical mapping and
loss of heterozygosity analysis of the FRA6E region led to the identification the Parkin gene in the
region. Like FHIT, Parkin is a large gene spanning a ~1.5 Mb genomic region that includes the fragile
site, and is frequently observed to be inactivated and hemizygously and homozygously deleted in a
number of primary tumors and cancer cell lines (24).
1.1.3 Fragile site FRA16D
The FRA16D fragile site is predisposed to various forms of instability in cancer. Mangelsdorf et al. (16)
found homozygous deletions spanning FRA16D in a gastric adenocarcinoma cell line, while a second
group (17) identified homozygous deletions in colon, lung and ovary adenocarcinoma cell lines that
mapped to the FRA16D fragile site region. In addition, a common t(14q32;16q23) translocation is
observed in up to 25% of all multiple myelomas (MM) and four t(14;16) MM breakpoints have been
located within the FRA16D region (25). Mapping studies of this region revealed a gene designated
WWOX (WW domain containing oxidoreductase) also named FOR (fragile site FRA16D
oxidoreductase) (26, 27) that was found to span the FRA16D region. The frequent incidence of
chromosomal instability in ovarian, prostate, colon, breast and other cancers at the FRA16D region
established WWOX as a candidate tumor suppressor gene (13, 16, 17, 25, 28).
6
1.2 WW-domain containing oxidoreductase (WWOX)
1.2.1 WWOX – Genomic location and Structurte
In a study conducted to identify genes mapping to the 16q23.3-24.1 region, containing the FRA16D
fragile site, Bednarek et al. (26), generated a detailed genetic map of the region spanning the STS
markers D16S518 and D16S516. Using shotgun genomic sequencing as well as isolation and analysis
of transcripts mapping to the region of interest, the WWOX gene was cloned. This new gene was found
to possess an ORF of 1245 bp composed of 9 exons ranging in size from 58 to 1060 bp, a 125 bp long
5’ UTR, and a 870 bp long 3’ UTR with a polyadenylation signal AATAAA starting at position 2091. The
WWOX gene spans a large genomic region of ~1.2 kb spanning bases 76,691,052 - 77,803,532 with
the FRA16D fragile site and the minimal homozygously deleted region observed in tumour cells located
within the 260 kb 8th intron of the gene (Figure 1.1) (26, 27).
7
Figure 1.1. Map of the WWOX transcripts and deletion breakpoints at 16q23.2 with
respect to FRA16D. A. The regions of loss of heterozygosity in prostate (red) and breast
cancer (blue). B. The approximate positions of multiple myeloma breakpoints. C. The location of
homozygously deleted regions in CO115, AGS, KM12C/SM and HCT116 tumour cell lines. D.
The location of the exons of the major WWOX gene transcript (spanning base pairs 76,691,052
- 77,803,532).
1.2.2 WWOX transcripts and protein products
The human WWOX gene contains 9 exons for which exons 1-4 encode the proteins two WW domains
and exons 5-8 encode a short chain dehydrogenase/reductase (SDR) enzyme. At least 8 different
WWOX transcripts are produced that all contain truncations of the 3’ region of the gene by alternative
splicing (Figure 1.2). It is not known whether all these transcripts are translated, however the presence
of low molecular weight WWOX corresponding to 35 kDa WWOX�5-8 (transcript variant 3), 26 kDa
WWOX�6-8 (transcript variant 4) and 35.2 kDa WWOX�7-8 have been detected in HCT116 colon cells
(29). The presence of transcript variant 3 (WWOX�5-8) has been confirmed in LNCaP prostate cells
and furthermore, this protein is stable unlike WWOX (v1). The presence of isoform 2 (v2; 41 kDa) has
been detected in human breast and prostate tissues (30), hippocampal neurons of human brains (31),
and in human prostate DU145 cells (32). It has also been reported that most WWOX proteins appear to
be highly turned over or highly unstable (29) which, coupled with the extremely low levels of expression
in most tissues, may explain why most of the low molecular weight forms of WWOX have not been
detected thus far. For a more detailed description of each splice variant, please refer to Figure 1.2.
DISTAL
Breast Ca LOH
Prostate Ca LOH Heterozygous deletions
MM.1 JJN3 ANBL6 KMS12 Translocations Multiple myeloma
HCT116
KM12C / SM
CO115
Homozygous deletions
Cancer cell lines
16q16q16q16q16qqTELTELTELTELTELO MEO MEO MEO MEO ME RERERERERE16qTELO ME RE CENC TROO MEREEEECENCENCENCENTROTROTROTRO MERMERMERMEREEEECENTRO MERE
PROXIMAL FRA16D
(A)
260 kb
780kb WWOX transcript
AF227527 Variant 1
AGS
A
B
C
D
8
Figure 1.2. The WWOX gene and spliced variants and proteins encoded. v1 is the predominant
WWOX protein (46 kDa). v2 contains a partial deletion of exon 9 with a unique C-terminus (orange)
(41 kDa). v3 contains an out-of-frame deletion of exon 5–8 and frame-shift at the C-terminus (35 kDa).
v4 contains an in-frame deletion of exon 6–8 (26 kDa). v5 contains an exon 5–9 deletion (24 kDa). v6
has an amino acid sequence from the first five exons and an alternative exon 6 (22 kDa). v7 contains
an exon 2–9 deletion (4 kDa). v8 contains a TG-deletion at exon 9 (red star), which results in the
frame-shift at the C-terminus (59 kDa). Two protein pairs possess an identical C-terminus: v1 and v4
(last 15 amino acids, LSERLIQERLGSQSG); v3 and v8 (last 15 amino acids, EKHQQFSFFYCYRIA).
The predicted hormone- or substrate-binding motif within Drosophila WWOX protein is indicated (S231,
S276, Y288 and K292). (Figure taken from (33))
1.2.3 Wwox / WWOX localisation
Immunostaining of a number of cell lines with anti-WWOX and anti-cytochrome c antibodies, and
expression of GFP-Wwox revealed that Wwox localises mainly to the mitochondria (34) although
WWOX has also been reported in the Golgi complex (35). The expression of a number of successive
deletion constructs identified an area within the SDR region required for mitochondrial targeting, while
constructs lacking this region were localised in the nucleus. In addition, co-localisation of Wwox and p53
9
to the mitochondria has been reported in p53 deficient cells ectopically expressing the two proteins (36).
Time dependant nuclear translocation of endogenous and GFP labelled Wwox have also been
observed in several cell lines following exposure to tumour necrosis factor (TNF) (34). Depending on
cell types, tissues and exogenous stimuli, WWOX/Wwox has been shown to localise to the mitochondria
(34, 37), nucleus (30), Golgi complex (35), rough ER (38), and plasma membrane. Normal human
organs and tissues express variable levels of WWOX as determined by immunohistochemistry studies
with the overall consensus from these studies being that WWOX is mainly expressed in epithelial cells,
particularly in hormonally regulated organs such as the prostate, thyroid, testes and mammary glands.
1.2.4 WWOX protein structure / function
The 1245 bp ORF of the WWOX gene encodes a 414 amino acid protein that contains two N-terminal
WW domains (amino acids 17-47 and 58-87) (Figure 1.2). The most N-terminal domain exhibits the
typical features of a WW domain that derive their name from two conserved tryptophan (W) residues
which are separated by 20-22 amino acids and interact with proline rich regions of other proteins
through a small hydrophobic pocket formed by three antiparallel �-sheets. The second domain contains
a functional replacement of the C-terminal tryptophan with a tyrosine residue, a feature common in a
number of other WW domains. In addition, a nuclear localisation signal (NLS) is present in the amino
acid sequence that separates the two WW domains (amino acids 50-55) (34). The N-terminus of the
protein also contains a PEST sequence (amino acids 12-27) (Figure 1.2). PEST sequences are
polypeptide stretches, rich in proline (P), glutamate (E), serine (S) and threonine (T) that are commonly
found in rapidly degraded enzymes, transcriptional factors and components of receptor signalling
pathways and are, by contrast, rarely present among long-lived cellular proteins (39, 40). In addition, a
predicted conserved catalytic tetrad NSYK motif for hormone or substrate binding is found in the SDR
enzyme region of the protein (26).
Amino acid sequence comparisons conducted by Bednarek et al. (26) and Ried et al. (27) revealed
homology between WWOX and proteins of the short-chain dehydrogenase reductase (SDR) family of
enzymes. The SDR superfamily is a large class of enzymes with >3000 primary structures from a wide
range of organisms having been identified to date (41). SDR enzymes typically display low sequence
identities between different forms (~15-30%) but 3D structures of these enzymes show highly similar
�/� folding patterns (41). The majority of SDR enzymes have a core structure of 250-350 residues with
N or C-terminal signal peptides, transmembrane domains or form part of multi enzyme complexes.
Based on their functional characteristics SDR enzymes can be grouped into three main categories: i)
enzymes involved in hormone, mediator and xenobiotic metabolism, ii) enzymes involved in
intermediary metabolism and iii) SDR containing proteins identified as ORFs with no known enzymatic
10
function (41). Bednarek et al. (26) performed northern blot analysis using a probe derived from the 5’
end of WWOX and analysis of the expression pattern in normal human tissues revealed that WWOX
transcripts are highly represented in hormonally active tissues such as the testis, prostate and ovary
and lower in other tissues examined. This led the authors to speculate that steroid compounds may be
the target substrate of the dehydrogenase / reductase activity of WWOX that may be involved in the
regulation of a putative steroid receptor interaction in their phylogenetic analysis of the murine prostate
dehydrogenase / reductase 1 (Psdr1) gene, performed an amino acid sequence alignment of the mouse
and human Psdr1 sequences along with 12 other members of the mouse and human SDR family (42).
The mouse WWOX sequence grouped closest to both Psdr1 sequences, further strengthening the idea
that WWOX may indeed play some role in steroid metabolism.
1.2.4.1 Short chain dehydrogenase/reductase enzymes (SDRs)
Initially the SDR superfamily was divided into two large families; the ‘classical’ family having a chain
length around 250 residues and the ‘extended’ family of about 350 residues with each family containing
different glycine motifs in the coenzyme binding region (43, 44). Later Kallberg et al. (45, 46) developed
an assignment scheme based upon sequence characteristics for classifying SDR enzymes into five
families. Three sequence motifs, with a total of 40 preserved positions extending over the active site
and coenzyme-binding regions were identified from the analysis of 95 SDR enzymes that when aligned
separated into five clusters. Two of the clusters identified comprised the classical and extended families,
while the three novel families discovered were named the ‘divergent’, ‘intermediate’ and ‘complex’
families. Kallberg et al. (45, 46) further divided the classical and extended families into seven and three
coenzyme-binding subfamilies respectively according to the presence of specific residues at a number
of key positions (Figures 1.3 and 1.4) (47). At present the enzyme function of WWOX is unknown but
analysis of consensus sequences, group it within the cP3 subfamily of the classical SDR enzymes
which are NADP(H)-binding proteins. Members of the cP3 subfamily include the human Carbonyl
reductase 3, 11-�-hydroxysteroid dehydrogenase type 1 and Sepiapterin reductase (48).
11
Figure 1.3 The two levels of classification within the SDR superfamily. Members of
the SDR superfamily are separated into five groups at the first level. At the second level,
members of the classical and extended families are separated into seven and three
subfamilies respectively based upon coenzyme binding residue patterns (48). Based on
sequence homology, WQWOX falls into the cP3 subgroup of ‘classical’ SDR enzymes.
(Figure taken from (48))
Figure 1.4 Key positions for assignments of coenzyme specificity of
classical SDRs (A) and extended SDRs (B). (Figure taken from (48))
12
Amino acid sequence alignments of a number of WWOX orthologues including chicken, zebra fish and
Drosophila, reveal a highly conserved region C-terminal to the SDR region. Such high sequence
conservation among organisms as diverse as these, suggests that this region of the protein may also
contribute some important functional property to the WWOX protein. Interestingly, as WWOX v3 protein
lacks both the SDR and C-terminal conserved regions, but possesses intact N-terminal WW domains, it
has been suggested that this variant may act as a competitive inhibitor of the 46 kDa v1 form of WWOX
(27).
1.2.5 WWOX / Wwox binding proteins
The WW domains and SDR enzyme of WWOX / Wwox have both been shown to bind a number of
different proteins. Several proteins possessing a PPxY amino acid motif are known to bind the N-
terminal WW domain, these include the transcription factors v-erb-a erythroblastic leukemia viral
oncogene homolog 4 (ERBB4) (49), activator protein-2� (AP-2�) (50) and the p53 homolog p73 (51) as
well as the signal transduction protein ezrin (52) and the small integral membrane protein of the
lysosome/late endosome (SIMPLE) (53). The Tyrosine 33 phosphorylated N-terminal WW domain also
binds with c-Jun N-terminal kinase 1 (JNK1) (54) as well as p53 via by its phosph-Serine46 and
Proline47 and an adjacent N-terminal proline rich region of p53 (34, 55). Specific details of many of the
interactions described here are discussed further in the following sections. The physical interactions of
WWOX with transcription factors, signal transduction proteins as well as proteins with known roles in
cancer biology point to WWOX itself being involved in the biology of cancer. Consequently, a large
proportion WWOX research conducted has focussed on what role WWOX may play in regards to
cancer.
1.3 WWOX and cancer
1.3.1 WWOX expression profile and gene status in cancer cells
As the WWOX gene was discovered through efforts to map the extent of deletions at the FRA16D
fragile site, there was the strong possibility that the genomic instability of the fragile site might extend to
the coding regions of the gene. As there were already strong links between fragile site instability and
cancer, a number of studies then focused on whether there were links between instability in the WWOX
gene in various cancers. An expression analysis study of eight breast cancer cell lines, showed higher
levels of WWOX expression in all of the cancer cell lines than normal breast tissue or normal mammary
13
epithelial cells, although the level of WWOX expression among the cancer cell lines was highly variable
(26). Paige et al. (56) in a screen of 95 tumour cell lines of various tumour types identified four cell lines
that exhibited homozygous deletions in WWOX. Homozygous deletions were detected in exons 4-8 of
an ovarian cancer cell line, exons 6-8 of two small cell lung carcinoma cell lines, and exons 7-8 of a
pancreatic carcinoma cell line. RT-PCR was performed on RNA isolated from a number of primary
tumours and detected transcripts lacking exons 5-8 in a primary ovarian tumour. In addition alternatively
spliced transcripts lacking exons 6-8 were detected in a number of cell lines and a primary ovarian
tumour that were found to be heterozygous for single nucleotide polymorphisms in exons 6, 7, or 8. A
high degree of polymorphism was detected in tumour cell lines (~1 per 100 bp) with four missense
polymorphisms identified that were not detected in normal cells. Similarly, Bednarek et al. (35) detected
aberrantly spliced mRNAs containing deletions of exons 5-8 or 6-8 in several primary tumours and
cancer cell lines but not in normal tissues. In addition, the proteins produced from these transcripts were
found to localise to the nucleus. Driouch et al. (57) analysed WWOX mRNA expression in ten normal
breast tissue samples, 20 human breast tumour samples and nine breast cancer cell lines and found
reduced levels of WWOX expression in several of the breast tumours and cancer cell lines. High
concentrations of the WWOX v3 transcript were also detected in 10 of the 20 tumours and eight of the
nine cell lines analysed. As with other studies, increased levels of internally deleted, in-frame transcripts
lacking exons 6-8 were detected in many of these samples. Of tumours that exhibited predominant
expression of full length transcripts, loss of heterozygosity (LOH) in WWOX was only detected in some
tumours and not others, similarly truncated transcripts were observed both in tumours exhibiting LOH
and no LOH. The results of this study and others suggest that variant WWOX transcripts in cancer cells
may be due to transcriptional events and genetic alterations or a combination of both. It is also
interesting to note that all of the aberrant transcripts detected so far possess deletions in the SDR
coding region and not in the WW domain region suggesting that loss of WWOX enzyme function may
play a role in cancer cell biology or alternatively, these truncated WWOX proteins, like WWOX v3, may
play some protective role during neoplasia.
Low, undetectable expression or aberrant transcripts of WWOX have been detected in a number of
different cancer cell lines of various origins (56). The early observation of frequent deletions in the
WWOX gene in a large number of different tumours led to the hypothesis that WWOX may act as a
tumor suppressor (58-61). Northern blot analysis of normal human tissue showed high levels of WWOX
expression in endocrine organs such as testis, ovary and prostate, with low levels detectable in the
colon, spleen and small intestine. Very low levels of WWOX RNA were found in the breast, thymus and
leukocytes (26).
14
WWOX has been shown to suppress the tumorigenicity of breast cancer cells both in vitro and in vivo.
Bednarek et al. (35) demonstrated that stable expression of WWOX in T47D and MD-MB-435 breast
carcinoma cells resulted in marked decrease in colony number, while increased expression of Wwox in
nude mice dramatically reduced tumorigenicity. A positive correlation between WWOX expression and
estrogen receptor status in a number of breast carcinomas has been made in a number of studies (35,
61, 62), with the highest levels of WWOX mRNA/protein detected in estrogen receptor positive (ER+)
breast cancer cell lines. Furthermore, almost undetectable levels of WWOX expression have been
reported in ER- breast cancer cell lines (MDA435 and MDA231 cells) and tumors (35, 61), suggesting
that WWOX expression levels may be associated with steroid hormone expression.
A study comparing normal ovaries and ovarian carcinomas (63) revealed that of the 444 carcinoma
samples tested, 30% showed a significant decrease in WWOX levels while 70% exhibited moderate to
strong WWOX expression. This study also indicated that WWOX protein expression is highly variable
among ovarian carcinoma histotypes with two histotypes, the Mucinous (70%) and Clear Cell (42%)
types, showing significant loss of WWOX expression. Gourley et al. (64), in a comparison of mRNA
expression of WWOX transcript variants 1 and 4 in human ovarian tumors, demonstrated significantly
lower WWOX v1 expression in tumours than in normal ovaries. Variant 4 was significantly associated
with advanced stage ovarian cancer and expressed at low levels, while tumours that co-expressed
variant 4 and relatively high levels of variant 1 showed significantly worse survival than tumours
expressing variant 1 alone. However, variant 4 was also frequently identified in non-malignant ovarian
tissue.
The accumulated evidence from these studies points to WWOX involvement in cancer biology with loss
of WWOX expression as well as aberrant forms of WWOX correlating with many cancer types.
Additionally, these studies also provide evidence that increased expression of WWOX can suppress the
tumorigenicity of certain cancers, while increased levels of certain WWOX transcripts are also often
found in may tumor types suggesting that certain WWOX isoforms may play a protective role in cancer.
Taken together, these studies of WWOX expression provide a significant amount of evidence
suggesting WWOX involvement in cancer biology, yet they offer few details as to the molecular or
functional roles WWOX may play in cancer. However, a number of detailed molecular studies into
WWOX biology have provided substantial evidence linking WWOX with cancer, many of which are
decribed in the following sections.
15
1.3.2 WWOX / Wwox proapoptotic activity
1.3.2.1 Wwox overexpresion enhances TNF killing
In studying the mechanism by which bovine testicular hyaluronidase (PH-20) sensitises TNF resistant
L929 fibroblasts to TNF killing, it was discovered that exposure to PH-20 resulted in increased p53
expression (65). In a later study Chang et al. (34) showed that increased expression of the murine
WWOX homolog Wwox also occurred in L929 cells following exposure to PH-20. L929 fibroblasts stably
overexpressing full length Wwox, or a truncated form only possessing the SDR region (designated
WWOXadr) were found to enhance TNF killing compared to control cells. Cells expressing only the WW
domains of Wwox failed to produce the same effect. In addition, western blot analysis revealed that
Wwox and WWOXadr overexpression increased p53 expression while reducing the expression of the
anti-apoptotic factors Bcl-2 and Bcl-xL. Chang et al. (34) therefore suggested that the Wwox
enhancement of TNF killing in L929 cells might be due to increased p53 expression and down
regulation of Bcl-2 and Bcl-xL. Such a pro-apoptotic role for Wwox / WWOX in vivo remains unclear, as
the level of increase in p53 expression demonstrated in this study is extremely low and it is doubtful
whether physiological levels of Wwox / WWOX in vivo would be capable of producing even the modest
increase in p53 expression obtained when WWOX is overexpressed. In addition, it has been
demonstrated that L929 fibroblasts transiently expressing the lysosomal hyaluronidases Hyal-1 and
Hyal-2 induce Wwox expression as well as prolonged NF-kappaB activation. These cells also exhibit
Hyal-2 translocation to the mitochondria during apoptosis, but do not induce the expression of p53 as
was reported for PH-20 (36). If WWOX / Wwox does enhance TNF killing by upregulating p53, then the
WWOX expression observed in these cells should have upregulated p53. However, the level of Bcl-2
and Bcl-xL down regulation observed was quite pronounced making it more likely, that physiological
levels of WWOX / Wwox may be capable of modulating the expression of these factors and enhancing
TNF killing. Later Hong et al. (66) showed that in response to TNF, the zink finger protein Zfra is
upregulated then binds and sequesters Tyr33 phosphorylated Wwox, Ser46 phosphorylated p53, NF-
kappaB and phospho-ERK (extracellular signal-activated kinase) in the cytoplasm. As a result, TNF or
UV light could not effectively induce nuclear translocation of these proteins thus abrogating the
apoptotic functions of Wwox and p53.
16
1.3.2.2 Wwox physically interacts with p53 and is required for p53 dependent killing
In exploring the apoptotic function of the Wwox WW domains, Chang et al. (34) demonstrated that the
killing function of this protein was increased when co-expressed with p53 in NIH/3T3 cells. Similarly,
when U937 cells were transfected with plasmids that produce non-killing concentrations of WWOX and
p53 when transfected alone, a synergistic killing effect was observed in cells co-transfected with both. In
addition, when antisense Wwox was expressed in NIH/3T3 and THP-1 cells, p53 mediated apoptosis
was abolished. However, expression of Wwox, Wwox-ww and Wwox-adh in the p53 deficient NCI-
H1299 cell line resulted in cell death, suggesting that Wwox / WWOX-mediated cell death is
independent of p53, but required for p53 mediated apoptosis. Furthermore, Wwox was found to interact
with p53 first by co-localisation analysis, immunoprecipitation using anti-p53 antibodies, and finally yeast
two-hybrid analysis, which demonstrated that the WW domains of Wwox physically interact with the
proline-rich region of p53 (amino acids 66-110). This binding activity was found to be dependent on
Tyr33 phosphorylation of the first N-terminal WW domain of Wwox and is also essential for stabilising
Ser46-phosphorylated p53 (55). It was also found that sex steroid hormones, estrogen and androgen,
induce Wwox phosphorylation at Tyr33 independent of receptors for sex hormones leading to the
nuclear translocation of Wwox (30).
1.3.2.3 Wwox and p73 induce apoptosis synergistically
Aqeilan et al. (51) demonstrated that Wwox also physically interacts via its first WW domain with the p53
homolog, p73. The tyrosine kinase, Src, phosphorylates Wwox at tyrosine 33 in the first WW domain
and enhances its binding to p73. Wwox expression was also shown to trigger redistribution of nuclear
p73 to the cytoplasm suppressing its transcriptional activity in human osteosarcoma NIH 3T3 cells. In
addition, ectopic expression of both p73 and Wwox was shown to contribute to the proapoptotic activity
of Wwox revealing a functional cross-talk between p73 and Wwox.
1.3.2.4 WWOX / Wwox enhances tumor necrosis factor (TNF) cytotoxicity
It has been demonstrated that hyaluronidases HYAL1, HYAL2 and PH-20 induce the expression of
WWOX / Wwox (34, 36, 67). Chang et al. (36) also showed that Hyal-2-increased TNF cytotoxicity in
L929 cells appeared to correlate with upregulation of Wwox, as well as prolonged NF-kappaB activation,
and Hyal-2 translocation to the mitochondria during apoptosis. Chang et al. (34) also demonstrated that
transient overexpression of Wwox alone is sufficient for inducing apoptosis in a number of TNF-resistant
cell lines (34). Both the WW domains and the SDR region of Wwox are capable of inducing apoptosis
independently due to the significant down-regulation of the apoptosis inhibitors Bcl-2 and Bcl-x(L)
(>85%), and the up-regulation of pro-apoptotic p53 ( approximately 200%) (34). Interestingly, Chang et
17
al. (34) produced a Wwox construct in which the NLS amino acid sequence was mutated, and when
overexpressed, failed to induce apoptosis suggesting that the NLS is essential for the WW domain
mediated apoptosis, and that the presence of the WW domains may abrogate the apoptotic activity of
the SDR region of Wwox / WWOX.
1.3.2.5 WWOX physically interacts with JNK1 which blocks WWOX mediated cell death
In a recent study, exogenous PH-20 and ectopic JNK1 were reported to act in a synergistic manner to
block Wwox mediated cell death in the presence of staurosporine, daunorubicin or doxorubicin (68).
JNK1 is a component of a signal transduction pathway that is activated by oncoproteins and UV
irradiation and JNK1 activation is thought to play an important role in tumour promotion (69). Y2H
analysis revealed that Wwox physically interacts with JNK1 via the first Wwox WW domain.
Phosphorylation at a conserved phosphorylation site, Tyr33, was shown to be required for the Wwox-
JNK1 binding interaction. Anisomycin, a potent activator of JNK1 induces Wwox and JNK1
phosphorylation. Interestingly, exposure of L929 cells to UV light, followed by co-immunoprecipitation
using anti-p53 antibody resulted in p53, JNK1 and Wwox in the precipitates. Chang et al. (68) suggests
that a p53-Wwox-JNK1 complex may form during stress responses, however this has yet to be
established.
1.3.3 WWOX / Wwox as a tumor suppressor
1.3.3.1 Ectopic expression of WWOX / Wwox suppresses cancer cell growth
The frequent observation of extremely low levels or lack of WWOX expression in various tumors (see
Chapter 1.3.1) led to the notion of WWOX functioning as a tumor suppressor. Bednarek et al. (35) were
amongst the first to show that ectopic expression of WWOX strongly inhibits anchorage-independent
growth in soft agar of breast cancer cell lines MDA-MB-435 and T47D. They also observed that WWOX
expression induced a dramatic inhibition of tumorigenicity of MDA-MB-435 breast cancer cells when
tested in vivo, confirming a tumor suppressor function for WWOX. Later Fabbri et al. (70) demonstrated
that ectopic expression of WWOX caused a dramatic suppression of tumorigenicity of A549, H460, and
H1299 cells in nude mice after induction of Wwox expression. Simmilarly ectopic expression of WWOX
by Ad-WWOX infection suppressed tumorigenicity of xenografts in nude mice (71).
18
1.3.3.2 Wwox knockout and hypomorph mice exhibit increase in tumorigenesis
The strongest evidence that WWOX / Wwox acts as a tumor suppressor was demonstrated recently in a
study by Aqeilan et al. (72) where a Wwox knockout mouse model was generated by targeted
mutagenesis of the Wwox gene. Wwox knockout homozygous mice exhibited a post-natal lethality
phenotype and marked increase in spontaneous tumor formation in relation to wildtype mice. Wwox
heterozygous mice also showed an increase in spontaneous tumor formation (various lung tumors)
although these tumors still expressed Wwox protein, the incidence of tumors per mouse in heterozygous
Wwox mice was 5-fold higher than wildtype mice. Sixteen percent (9/58) of wildtype mice developed
lung papillary carcinomas, whereas only 3.0% (2/60) of wildtype mice were diagnosed with lung tumors,
suggesting haploinsuffiency of WWOX itself is cancer predisposing. This was supported by a later study
(73) in which Wwox hypomorph mice were generated using a gene-trap vector. Unlike the knockout
mice, hypomorph mice were viable yet had significantly shorter life spans that wildtype mice, with males
exibiting high numbers of atrophic seminiferous tubules and reduced fertility and female hypomorphs
exhibiting a higher incidence of spontaneous B-cell lymphomas. Together these studies provide the
strongest evidence to date that WWOX / Wwox acts as a genuine tumor suppressor.
1.3.4 Drosophila Wwox
1.3.4.1 Wwox null flies exhibit increased sensitivity to ionising radiation
The Drosophila orthologue of WWOX designated Wwox, shares a 49% amino acid identity with the
human protein, and phylogenetic analysis has shown that it groups with the WWOX orthologues from
several other organisms and not with a number of other Drosophila SDR enzymes (Figure 1.5)
suggesting it is a true orthologue. The amino acid comparisons and phylogenetic analysis therefore
support the notion of using Drosophila as a model organism in the study of WWOX. Gene knockout
studies in Drosophila have consequently provided useful insights into the role WWOX plays in vivo. A
Wwox null fly line designated Wwox1 was produced by knocking out the endogenous Drosophila Wwox
gene using a targeted mutagenesis via homologous recombination approach (74-76). These flies were
homozygous viable displaying no obvious defects in the adult flies, but exhibited increased sensitivity
when exposed to ionising radiation (IR) compared to wildtype flies. To test whether this sensitivity might
be due to a defect in apoptosis in these flies, wing discs from Wwox1 and wildtype (w1118 strain) flies
exposed and not exposed to IR were stained with acridine orange, a stain that is excluded from living
cells and only taken up by dying cells. The wing discs from both Wwox1 and w1118 flies showed a
marked increase in cell death following exposure to IR, indicating that apoptosis in Wwox1 flies is not
perturbed, suggesting that Wwox is not required for apoptosis in response to IR. To test whether Wwox1
flies are deficient in some cell cycle checkpoint pathway(s), wing discs from Wwox1 and w1118 flies
19
exposed and unexposed to IR were stained with the mitosis specific stain anti-phosphohistone H3
(PH3). 90 minutes after IR exposure, the wing discs from both Wwox1 and w1118 flies showed cell cycle
arrest. 5.5 hours post IR, both groups of flies demonstrated resumption of cell cycling suggesting that
Wwox1 flies do not exhibit increased mortality following IR exposure due to failure to arrest the cell cycle
(74). Hence the underlying cause of the Wwox1 phenotype is still unclear. The possibility remains that
Wwox1 flies may be deficient in DNA repair, therefore accounting for their increased death rates after IR
exposure, however this is yet to be demonstrated. An alternative explanation for these findings will be
made clear later in this thesis.
Figure 1.5. Dendrogram demonstrating the similarity relationships among WWOX
orthologues and six closest known Drosophila oxidoreductase enzymes. Sequences were
detected by BLAST searches of the annotated Drosophila genome using Wwox as the search
sequence. The Drosophila Wwox (red) clearly groups with the WWOX orthologues of other
species (black) and not with the other Drosophila oxidoreductase enzymes (green). (Richards et
al., personal communication)
20
1.3.5 Summary
Fragile sites represent chromosomal regions of the genome that are prone to various forms of instability
both in vitro and in vivo. The common fragile site FRA16D has been found to coincide with various
chromosomal instabilities including deletions and chromosomal translocation break points in a number
of cancer cell lines. The WWOX / FOR gene spans the FRA16D fragile site region and is often found to
exhibit frequent loss or alteration in at least some cancer cell types. WWOX / FOR has been shown to
reduce tumor growth and induce apoptosis when over expressed, and has a synergistic killing effect
when overexpressed with p53. Furthermore, it is a required partner in p53 dependent apoptosis and
physically interacts with p53 via its WW domains. Finally, Wwox knockout and hypomorph mice exhibit a
marked increase in tumorigenesis, coupled with the fact that Wwox null flies exhibit increased sensitivity
to IR strongly suggests WWOX / Wwox is a bona fide tumor suppressor gene.
1.4 Project aims and approaches
Despite the evidence indicating that WWOX / Wwox has a role in cancer biology, little is known about its
normal biological function. Given the fact that it possesses several physically identifiable regions,
including an enzyme region, which is highly conserved at the amino acid level among distant orthologs,
it is likely that this protein is an important component in certain cellular pathways or processes.
Therefore, by identifying the factors this protein interacts with (directly or indirectly), it may be possible
to reveal the biological pathway(s) it acts within. The Drosophila model organism was selected for use in
the examination of the normal biological function of Wwox as several null mutant lines have been
generated that could provide an ideal genetic background in which to study the Wwox protein. In
addition, the GAL4-UAS system in Drosophila provides a system in which the spatio-temporal
expression of proteins can be manipulated by the researcher (77).
1.4.1 Aim #1: To determine the functional domains / regions in the Wwox
protein
The first aim of this project was to create a series of Drosophila Wwox proteins specifically deleted or
mutated at positions identified through bioinformatics as conserved functional protein motifs, or regions
that are highly conserved among WWOX / Wwox homologs. The expression of these proteins in Wwox
null flies (Wwox1) would be used to assay for modifications of the ionising radiation sensitivity phenotype
discussed in Chapter 1.3.4.1. The expected outcomes of this work would be that mutations / deletions in
regions of the Wwox protein critical to its function would be expected to abolish the ability of Wwox to
21
rescue the Wwox null mutant phenotype following exposure to radiation. Therefore regions required for
Wwox function may be identified.
1.4.2 Aim #2: To determine whether the various functional domains / regions
of Wwox lead to quantitative / qualitative changes in other proteins in
vivo.
Wwox null flies ectopically expressing Wwox constructs containing mutations / deletions in regions
found to be required for rescue of the Wwox1 IR sensitivity phenotype would be used in addition to non-
mutated Wwox, in proteomic studies. Following irradiation of flies ectopically expressing various Wwox
proteins as well as Wwox null and wildtype flies, 2D gel electrophoresis of total fly protein from each
group would allow for the comparison of the different proteomes.
Quantitative changes observed in the proteins produced between Wwox null and flies expressing Wwox
proteins would indicate that the specific lack of Wwox function being assayed is either affecting the
levels of proteins that Wwox interacts with either directly or indirectly, or is the result of up-regulation of
proteins in redundant pathway(s) compensating for the loss of Wwox function. Qualitative changes
observed in the proteins produced between the two groups of flies would indicate that the specific lack
of Wwox function being assayed is responsible (directly or indirectly) for the post-translational
modification of these proteins. Specific proteins may be identified that are up/down-regulated and/or
modified in some way in response to the presence or absence of Wwox in flies following exposure to
irradiation. Identification of such proteins may provide insights into the pathway(s) Wwox interacts with
and possible functions of specific regions/domains of the protein.
22
Chapter 2:
Materials & Methods
23
24
Chapter 2: Materials & Methods
Materials
2.1 Oligonucleotide primers
DNA oligos were synthesised and purified by GeneWorks Pty Ltd (Thebarton, SA). Oligos used for
cloning or in vitro mutagenesis were purified by HPLC. Oligos used for PCR amplification and
sequencing were obtained at the standard PCR grade. Oligo sequences are given in the 5’ � 3’
direction.
2.1.1 Cloning Primers
�WW construct primers
�WW 5’ CACCATGGTGCGCCAGCGATTTGACTCC
dm FOR+RS.R5 GACTATCTAGAATCATTGGTGGTAGCATAATGCA
�OR construct primers
DmFOR-F CACCATGATAGCCCTACCCG
�OR 3’ CTAAGGAGTCAAATCGCTG
�WW1 construct primers
DmFOR-F CACCATGATAGCCCTACCCG
�WW1 R1 GGTACCGGCACGTTCCTCCCAGCCG
�WW1 F2 GGTACCGGTCGCTCCAAACGGATCAC
dm FOR+RS.R5 GACTATCTAGAATCATTGGTGGTAGCATAATGCA
�WW2 construct primers
DmFOR-F CACCATGATAGCCCTACCCG
�WW2 R1 CACCATGATAGCCCTACCCG
�WW2 F2 GGTACCGCATTCGCCGTGGAGGAGC
dm FOR+RS.R5 GACTATCTAGAATCATTGGTGGTAGCATAATGCA
25
CBS mutant construct primers
DmFOR-F CACCATGATAGCCCTACCCG
CBS-F caccgcgctgatagcgggcgcaaattg
CBS-R CAATTTGCGCCCGCTATCAGCGCGGTG
dm FOR+RS.R5 GACTATCTAGAATCATTGGTGGTAGCATAATGCA
AS mutant construct primers
DmFOR-F CACCATGATAGCCCTACCCG
AS-F GGAGCATGATGGCCTTCAACAATGCCAAGC
AS-R GCTTGGCATTGTTGAAGGCCATCATGCTCC
dm FOR+RS.R5 GACTATCTAGAATCATTGGTGGTAGCATAATGCA
2.1.1 Sequencing & Diagnostic Primers
pUAST-F GAAGAGAACTCTGAATAGGG
pUAST-R GTCACACCACAGAAGTAAGG
M13-F TGTAAAACGACGGCCAGT
M13-R GTTTTCCCAGTCACGAC
2.2 Enzymes
Taq DNA polymerase (Invitrogen)
Pfu DNA polymerase (Stratagene)
Restriction Endonucleases (New England Biolabs)
LR Clonase (Invitrogen)
T4 DNA ligase (Roche)
2.3 Antibiotics
Ampicillin (Sigma-Aldrich)
Kanamycin (Sigma-Aldrich)
2.4 Plasmids
pGEM�-T (Promega)
26
pENTR/D-TOPO® (Invitrogen)
pDEST-UAST® (Invitrogen)
2.5 Bacterial strains
DH5�: F’, f80, lacZ�M15, recA1, endA1, gyrA96, thi-1, hsdR17, (rK-, MK+), supE44, relA1, deoR,
�(lacZYA-argF)U169. Chemically competent cells were produced by S. Dayan.
One shot� Top10 chemically competent E. coli cells (Invitrogen)
All cells were stored in 50 μl or 200 μl aliquots at -80°C.
2.6 Kits
QIAquick PCR clean-up kit (Qiagen)
GenElute plasmid miniprep kit (Sigma-Aldrich)
QIAquick gel extraction kit (Qiagen)
PlusOne� 2D clean-up kit (GE Healthcare)
ReadyPrep� 2-D Protein Cleanup Kit (BioRad)
EZQ protein quantitation kit (Molecular Probes)
2.7 Molecular weight markers
DNA Markers:
1Kb Plus DNA Ladder (Invitrogen) sizes in base pairs: 100, 200, 300, 400, 500, 650, 850, 1000, 1650,
2000-12,000 in 1000bp increments
Protein Markers:
Benchmark pre-stained protein ladder (Invitrogen) sizes in kDa: 8, 15, 20, 27, 38, 50, 65, 80, 115, 180
Precision Plus unstained protein standard (Bio-Rad) sizes in kDa: 10, 15, 20, 25, 37, 50, 75, 100, 150,
250
2.8 Antibodies
Primary: anti-N-DmWWOX (see reference (74) for details)
Secondary: anti-Rabbit HRP (Jackson Laboratories)
27
2.9 Bacterial Media
All media were prepared with deionised and distilled water and sterilized by autoclaving, except for heat
labile reagents that were sterilized by filtration. Antibiotics were added from sterile stock solutions to
media following autoclaving.
SOC: 20mM glucose, 10mM MgSO4, 10mM MgCl2, 2.5mM KCl, 10mM NaCl, 0.5% yeast extract, 2%
bactotryptone
Luria Broth (LB): 1% NaCl, pH 7.0, 1% (w/v) amine A, 0.5% yeast extract
Plates: LB containing 1.5% (w/v) bactoagar supplemented with ampicillin (100mg/ml) or Kanamycin
(50mg/ml) where appropriate.
2.10 Drosophila Media
Fortified Drosophila medium: 18.75% compressed yeast, 10% treacle, 10% polenta2.5% tegosept
(10% parahydroxybenzoate in EtOH), 1.5% acid mix (47% propionic acid, 4.7% orthophosphoric acid),
1% (w/v) agar.
Grape juice agar plates: 25% grape juice, 0.3% agar, 0.3% sucrose, 0.03% tegosept
2.11 Buffers and Solutions
TBE: 1.8 M Tris, 1.8 M boric acid, 0.05 M EDTA, pH 8.3
PBS: 145mM NaCl, 7.5 mM Na2HPO4, 2.5 mM NaH2PO4
Agarose gel loading buffer: 50 mM EDTA, 50% (w/v) glycerol, 0.001% (w/v) bromophenol blue, 0.1%
(w/v) xylene cyanol
Embryo injecting buffer:5 mM KCl, 0.1 mM NaPO4 pH 6.8
Squishing buffer: 25 mM NaCl, 10 mM Tris-HCl pH 8.2, 1 mM EDTA, 200 �g/ml Proteinase K
28
SDS sample buffer: 125 mM Tris pH 6.8, 10% glycerol, 4% sodium dodecyl sulfate (SDS), 2% �-
mercaptoethanol, 0.006% bromophenol blue
Transfer buffer: 14.413 g/L glycine, 20% methanol, 3.0275 g/L Tris base
Western blocking buffer: 100 mM NaCl, 10 mM Tris pH 7.5, 0.1% Tween-20
2D protein sample buffer: 7 M urea, 2 M thiourea, 30 mM Tris, 4% CHAPS
IEF rehydration solution: 7 M urea, 2 M thiourea, 30 mM Tris, 2% CHAPS, 1.2% DeStreak, 0.5%
amphylites
10x Laemmli SDS electrophoresis buffer: 250 mM Tris, 1.92 M Glycine, 1% (w/v) SDS, pH 8.2
SDS equilibration buffer: 6 M Urea, 75 mM Tris-HCl (pH 8.8), 29.3% (v/v) Glycerol, 2% (w/v) SDS,
0.002% (w/v) bromophenol blue solution
29
Methods
2.12 PCR amplification of DNA
Pfu polymerase was used with the following conditions: 0.5 U Pfu polymerase, 1 ng template DNA, 0.1
ng primers, 0.2 mM dNTPs in 1 x Pfu PCR buffer. Reactions were performed using an MJ Research
PTC-200 peltier thermal cycler with the following steps: 94°C – 2 minutes, 94°C – 30 seconds, 55°C –
30 seconds, 72°C – 45 seconds, 33 cycles of 94°C – 30 seconds, 55°C – 30 seconds, 72°C – 45
seconds.
Resulting PCR products were analysed by agarose gel electrophoresis, excised and extracted using a
QIAquick gel extraction kit (following manufacturers protocols) or purified using a QIAquick PCR
cleanup kit.
2.13 Generation of recombinant plasmids
Details are outlined in the Materials and Methods sections of the relevant chapters.
2.14 Transformation of bacteria
Chemically competent DH5� or Top10 chemically competent cells were thawed on ice (from -80°C) and
50μl added to 2-5 μl of ligation reaction. The mixture was incubated on ice for 20 minutes, heat-
shocked for 45-50 seconds at 42°C and then returned to ice for 2 minutes. 450 μl LB was added and
the mixture inverted gently before incubating at 37°C for 1 hour, then pelleting for 30 seconds at 6,500
rpm. 400 μl of the supernatant was removed and the cells gently resuspended in the remaining LB,
plated onto L-agar plates with appropriate supplements and incubated at 37°C over night.
2.15 Isolation of plasmid DNA
Small-scale preparations of plasmids were performed using the Sigma GenElute plasmid miniprep kit
according to the manufacturers instructions.
2.16 Genomic DNA preparations
Single flies were homogenised in 50μl squishing buffer and incubated at 37°C for 30 minutes. The
preparation was then heated to 95°C for 2 minutes to inactivate the proteinase K contained in the buffer.
1 μl of the resulting solution was used as template for PCR.
30
2.17 Agarose gel electrophoresis
Molten 1% agarose dissolved in 0.5x TBE and containing ethidium bromide was poured onto a glass
plate or into a plastic gel-cast (sealed at each end with masking tape) and set with well combs in place.
The gel was submerged in 0.5x TBE in an Mini-Sub� Cell GT electrophoresis tank (Bio-Rad). DNA
samples were mixed with agarose loading buffer and loaded into wells alongside a well containing DNA
markers of known size (1 Kb Plus DNA Ladder (Invitrogen)). DNA was size separated by applying 40-
120 constant volts, 400 mA, 400 W to the tank using a Power Pac 3000 (Bio-Rad) unit and was
visualised by UV light exposure using Gel-Doc apparatus (Bio-Rad).
2.18 Automated DNA sequencing
ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Mix (Perkin-Elmer), was used for DNA
sequencing using the manufacturer’s instructions with the modification of using half the described
amount of reaction mix. 100 ng of primer was used with 400-800 ng of double stranded DNA as a
template. Reactions were performed using an MJ Research PTC-200 peltier thermal cycler, with the
following conditions:
25 cycles 96°C for 30 seconds, 50°C of 15 seconds, 60°C for 4 minutes. Running and analysis of the
Dye Terminator gels was conducted by the IMVS Sequencing Centre.
2.19 Generation of deletion constructs
To generate open reading frame sequences containing deletions, two PCR products were produced;
one containing the sequence upstream of the deletion region with a KpnI site introduced at the 3’ end of
the sequence by the reverse primer and the other product containing the sequence downstream of the
deletion region with a KpnI site introduced at the 5’ end of the sequence by the forward primer. These
were then subcloned in pGEM-T vector which was then restricted using SphI and KpnI enzymes.
Restriction digests were electrophoretically separated on a 1% agarose gel and DNA bands
corresponding to the restricted insert sequences excised from the gel and purified using a QIAquick gel
extraction kit. The two sequences now containing KpnI sticky ends were then mixed and ligated
together to produce complete open reading frame sequences containing the desired deletion. In order to
amplify these sequences, the ligation reactions were used as template in PCR reactions containing
oligonucleotides complementary to the 5’ and 3’ ends of the open reading frame. These PCR products
were then subcloned into the pENTR/D-TOPO® vector followed by further subcloning into pDEST-
UAST® by LR clonase-mediated recombination. These were then used for microinjection to generate
transgenic Drosophila.
31
2.20 In vitro site directed mutagenesis
Two oligonucleotide primers were designed being the reverse complement of each other and containing
the mutated residue(s) flanked by approximately 20 bases upstream and downstream. The primer
having the sense sequence was then used in a PCR reaction with a primer for the 3’ sequence of the
open reading frame. The anti-sense mutant primer was used in a second PCR reaction with the 5’
primer of the open reading frame. Each of these PCR products were then used in a third PCR reaction
containing 1x Pfu buffer, 0.2 mM dNTPs and 1 U Pfu polymerase and run under the following
conditions; 94°C – 2 minutes, 8 cycles of 94°C – 30 seconds, 56°C – 30 seconds, 72°C – 45 seconds.
This reaction was then spiked with 0.1 ng of 5’ and 3’ primers for the open reading frame and the
reaction continued for 20 cycles to amplify the full length open reading frame now containing the
mutation. These sequences were then subcloned into pENTR/D-TOPO® and the introduced mutation
confirmed using sequencing analysis.
2.21 P-element transformation of Drosophila
Micro injection: an injection mix was prepared to a concentration of 0.5-1 μg/μl transformation vector
plasmid and 0.3 μg/μl of pp25.7wc (2-3 transposase) plasmid in 1x Embryo injecting buffer.
2.21.1 Fly strains
w1118 w[1118] wildtype strain used in all studies.
Wwox1 w[1118]; Wwox1 (74) Wwox null strain created using knock-
out via homologous recombination
technique.
Wwox1-2 w[1118]; Wwox1-2 (78) A second Wwox null strain created
using knock-out via homologous
recombination technique.
Wwoxf04545 w[1118]; PBac{w[+mC]=WH}Wwox[f04545] Wwox null strain containing a
Piggy-Bac insertion sequence in the
second intron of the Wwox open
reading frame.
32
2.22 Irradiation of Drosophila
Groups of 50 wandering third instar larvae were placed in 3.5 cm plastic culture dishes and sealed with
paraffin film and exposed to varying doses of gamma-irradiation using a CIS Bio-international IBL 437C
machine. The total number of flies eclosed was scored after 5–6 days at 25°C.
2.23 One-dimensional polyacrylamide gel electrophoresis
One-dimensional polyacrylamide gel electrophoresis (1-DE) was carried out according to Laemmli (79).
Protein samples were mixed with 4x SDS sample buffer and incubated at 100°C for 10 minutes
immediately prior to 1-DE. 0.8 mm, 12% acrylamide analytical gels were prepared using the Protean� 3
gel electrophoresis system (Bio-Rad) according to the manufacturers instructions. Samples were loaded
onto the gels alongside a standard molecular weight marker and electrophoresis was performed at 200
V, in the presence of 1x Laemmli SDS electrophoresis buffer. Once separation of proteins was
complete, protein was visualised according to the staining methodologies described in Chapter 2.25.2.
Alternatively, gels were electro-transferred onto nitrocellulose membranes (Chapter 2.25.3).
2.24 Two-dimensional electrophoresis
Two-dimensional polyacrylamide electrophoresis was carried out as described in 2-D Electrophoresis
Principals and Methods Handbook 80-6429-60AC (GE Healthcare) (80). First dimension isoelectric
focusing (IEF) was performed using the IPGphor system (GE Healthcare). Protein samples (outlined in
the relevant chapters) were applied to 24cm non-linear pH gradient (IPG) strips (GE Healthcare) using
either the rehydration loading method or cup loading method (outlined below).
2.24.1 Drosophila protein preparations
Flies were placed in a 1.5 ml tubes, frozen in liquid nitrogen and mechanically homogenised using a
fitted pestle. Before the tissue could thaw, 100μl of 2D sample buffer (Chapter 2.11) was added and the
samples thoroughly mixed and incubated on ice for one hour. The samples were then centrifuged at
maximum speed for 30 minutes after which the supernatant was retained. Protein preparations were
purified using a 2D cleanup kit and protein concentrations estimated using a protein quantitation kit (see
Chapter 2.6). All samples were stored at -20°C.
33
2.24.2 Cy Dye Labelling of proteins
Proteins were labelled as described in Chapter 6.3.3 of 2-D Electrophoresis Principals and Methods
Handbook 80-6429-60AC (GE Healthcare) (80). The amount of protein and Cy dye used is outlined in
the Materials and Methods sections of the relevant chapters.
2.24.3 Rehydration loading isoelectric focusing
Protein samples, mixed with an appropriate volume of IEF rehydration solution (see Chapter 2.11), were
applied to 24cm ceramic IPGphor strip holders (GE Healthcare), which were subsequently overlaid with
IPG strips. Care was taken to ensure that the gel was in contact with the electrodes of the strip holder
and that no air bubbles were trapped beneath the strips. Strips were overlaid IPG cover fluid (GE
Healthcare) to minimise evaporation and urea crystallisation. IEF strips were actively rehydrated using
the IPGphor (50 volts constant, 10 hours, at 20°C), after which the strips were removed from the strip
holders, which were then cleaned and dried. Dampened paper electrode pads were then placed over
the electrodes of the strip holder before the IEF strips were repositioned in contact with the pads.
Isoelectric focusing was then performed using an IEF protocol as outlined in the Materials and Methods
sections of the relevant chapters.
2.24.4 Cup loading isoelectric focusing
IEF strips were placed gel side down in IEF rehydration solution (see Chapter 2.11) in an Imobiline
DryStrip Reswelling Tray (GE Healthcare). Care was taken to ensure that no air bubbles were trapped
beneath the strips that were then overlaid with IPG cover fluid (GE Healthcare) to minimise evaporation
and urea crystallisation. After passively rehydrating overnight, the strips were placed gel side up in an
IPGphor Manifold (GE Healthcare), and the manifold set up for cathodic cup loading (as outlined in
Chapter 2.3.4 2-D Electrophoresis Principals and Methods Handbook 80-6429-60AC (GE Healthcare)
(80)). Isoelectric focusing was then performed using an IEF protocol as outlined in the Materials and
Methods sections of the relevant chapters.
2.24.5 Second-dimension SDS-PAGE
Equilibration of IEF strips and SDS-PAGE was carried out as described in Chapter 3 of 2-D
Electrophoresis Principals and Methods Handbook 80-6429-60AC (GE Healthcare) (80). All second-
dimension SDS-PAGE was performed using manually cast 12.5% polyacrylamide gels. The
electrophoresis and gel casting system used is as outlined in the Materials and Methods sections of the
relevant chapters.
34
2.25 Protein visualisation on polyacrylamide gels
2.25.1 Sypro Ruby Staining
Gels were first fixed in 40% v/v methanol, 10% v/v acetic acid for at least two hours, then immersed in a
sufficient volume of Sypro ruby stain and left to stain overnight in the dark with gentle agitation.
Following staining, the gels were rinsed in RO-H2O three times for 10 minutes.
2.25.2 Coomassie brilliant blue staining (CBB)
Gels were stained with CBB by immersing in a sufficient volume of 0.25% w/v CBB R-250 (Sigma
Aldrich), 45% v/v methanol and 10% v/v acetic acid for several hours. Gels were then destained in 10%
v/v acetic acid and 40% v/v methanol until the background colour was cleared.
2.25.3 Antibody detection (Western blotting)
Transfer of proteins to nitrocellulose membrane was performed using a BioRad mini Protean� 3 trans-
blot electrophoretic transfer cell according to the manufacturer’s protocol. PAGE gels were equilibrated
in transfer buffer for 30 minutes, then transfer was carried out at 100V for 1 hour. Nitrocellulose blots
were blocked for 1 hour at room temperature in western blocking buffer containing 5% skim milk
powder. Upon removal of the blocking buffer, the membrane was washed three times for 10 minutes
with TBST before incubating overnight at 4°C with an appropriate primary antibody (diluted in TBST).
Non-binding antibodies were removed by three additional 10 minute TBST washes before exposing the
membrane to an HRP-conjugated secondary antibody. Following incubation for 1 hour at room
temperature, the membranes were washed three times for 10 minutes in TBST.
2.26 DIGE analysis
All DIGE analysis was conducted using the DeCyder 2-D Differential Analysis Software v6.5 (GE
Healthcare). Specific details of analysis conducted are described in the results section of relevant
chapters.
2.27 Sample preparation for mass spectrometric analysis
The general sample preparation method for mass spectrometry used is outlined below. Variations on
the method detailed here are presented in the materials and methods sections of the relevant chapters.
35
2.27.1 Excision and destaining
Spots were excised either manually using a modified pipette tip, or in an automated fashion using an
Ettan� Spot Picker robot (GE Healthcare). Excised spots were diced into pieces ~1-2 mm, put in 1.5
ml tubes and coomassie stained gel pieces destained by adding 200 μl of 100 mM ammonium
bicarbonate / 50% v/v acetonitrile. Tubes were vortexed and left at room temperature for 15 minutes at
which time the liquid was removed. This process was repeated until the gel pieces were clear of all
staining.
2.27.2 Reduction and alkylation
200 μl of 100% acetonitrile was added to each tube and incubated at room temperature for 10 minutes
or until gel pieces were completely dehydrated. Gel pieces were then dried completely in a vacuum
centrifuge before reducing the proteins with 50 μl of 10 mM DTT in 100 mM ammonium bicarbonate for
1 hour at 56°C. Following reduction, gel pieces were washed twice in 100 mM ammonium bicarbonate
to remove excess DTT, then dehydrated again by the addition of 100 μl of 100% acetonitrile. When
dehydrated the acetonitrile was replaced with 50 μl of 55 mM iodoacetamide in 100 mM ammonium
bicarbonate and incubated at room temperature in the dark for 45 minutes. Gel pieces were again
washed twice in 100mM ammonium bicarbonate and dehydrated as described above.
2.27.3 Proteolytic digestion
Gel pieces were rehydrated in 10-20 μl of 10 ng/μl trypsin in 5mM ammonium bicarbonate and
incubated over night at 37°C. Following digestion, 20 μl of 50% acetonitrile containing 1% formic acid
was added to each tube and incubated in a sonicating water bath for 15 minutes. The liquid, containing
extracted peptides was removed and transferred to fresh collection tubes before 50 μl of 100%
acetonitrile was added to the gel pieces that were then incubated again in a sonicating water bath for 15
minutes. The liquid was again removed from the gel pieces and added to the final collection tubes that
were then concentrated to ~1-3 μl using a vacuum centrifuge.
2.28 Mass spectrometry
Specific details of the instrumentation used and type of analysis conducted are described in the
materials and methods section of relevant chapters
36
37
38
Chapter 3:
Investigation of the radiation sensitivity of Wwox mutant flies
39
40
Chapter 3: Investigation of the radiation sensitivity of
Wwox mutant flies
3.1 Introduction
3.1.1 Use of the Drosophila model system
The Drosophila model organism was selected to investigate the functional regions of the Wwox protein
due to the high level of conservation between the human and fly proteins. In addition, a Wwox null
mutant line (Wwox1) had been established which could provide an ideal genetic background in which to
study perturbations of the Wwox protein. The GAL4-UAS system in Drosophila provides a system in
which proteins can be expressed in the organism under tight spatio-temporal control (77). At the outset
of these studies it appeared that Wwox1 mutant flies had shown an increased sensitivity to ionising
radiation that could be partially rescued by the over expression Wwox protein (74). This appeared to
provide the ideal system in which to study the functional aspects of the Wwox protein.
Figure 3.1. The Drosophila GAL4>UAS system of gene expression. The crossing scheme
required to generate a fly line ubiquitously expressing Wwox protein in a Wwox null mutant
background (Wwox1). A tissue and/or developmental time specific promoter sequence, in this case
from the ubiquitously expressed daughterless gene (da), drives expression of exogenous GAL4
protein that binds to the upstream activation sequence (UAS) of the gene to be exogenously
expressed, in this case Wwox.
GAL4 UAS da Wwox
Wwox1 ; UAS>Wwox Wwox
1 ; da>GAL4
X
Wwox1 ; da>Wwox
41
3.1.2 Approach: Radiation sensitivity of various Wwox mutants
In order to identify the functional domains/regions of the Wwox protein essential to its ability to rescue
the Wwox1 radiation sensitivity phenotype, constructs encoding various Wwox mutant proteins were
designed to be expressed ubiquitously in Wwox1 flies using the GAL4-UAS system. The WW domains
and sequences identified as functional elements of the oxidoreductase enzyme were either deleted or
mutated to produce a number of mutant Wwox proteins. The inability of any of these proteins to rescue
the radiation sensitivity phenotype would then identify the altered region of the protein as having a
critical function with regards to its ability to confer resistance to ionising radiation on Drosophila.
Figure 3.2 Schematic representation of mutant Wwox proteins. (A) The Wwox�WW1 protein with
deletion of most of the first WW domain. A small part of the WW domain was left as a putative PEST
protein degradation sequence overlaps the N-terminal sequence of this WW domain. (B) The
unaltered Wwox protein showing the relative positions of the two WW domains and the
oxidoreductase enzyme. (C) The Wwox�WW2 protein lacking the entire second WW domain. (D) The
WwoxT127A co-factor binding site mutant protein and (E) The WwoxY288F active site mutant protein
showing the relative positions of the cofactor binding and active site sequence motifs respectively.
The highly conserved amino acid residues of these motifs are shown in bold with mutated residues
shown in green.
Oxidoreductase
ALIAGANCGIGYE
MMAFNNAKLC
WW
WWWW
WW
A
B
C
D
E
42
3.2 Materials and Methods
3.2.1 Wwox deletion construct generation
A construct containing a deletion of most of the first WW domain of Wwox (Figure 3.2 - A) was
generated using the method outlined in Chapter 2.19. The first PCR product was generated using
primers DmFOR-F and �WW1 R1 (see Chapter 2.1.1) creating a 78 base pair product from nucleotides
1-78 containing a 3’ Kpn1 restriction site sequence. The second PCR product was generated using
primers �WW1 F2 and dm FOR+RS.R5 (see Chapter 2.1.1) creating a 1173 base pair product from
nucleotides 133-1289 with a 5’ Kpn1 restriction site sequence. A construct containing a deletion of the
entire second WW domain of Wwox (Figure 3.2 - C) was generated in a similar manner to that of the
�WW1 construct. Two PCR products were generated, the first using primers DmFOR-F and �WW2 R1
(see Chapter 2.1.1) creating a 174 base pair product containing the first 159 bases of the Wwox open
reading frame and a 3’ Kpn1 restriction site sequence. The second PCR product was generated using
primers �WW2 F2 and dm FOR+RS.R5 (see Chapter 2.1.1) creating a 1049 base pair product from
nucleotides 159-1289 with a 5’ Kpn1 restriction site sequence. All PCR products generated were
subcloned into pGEM-T vector and cleaved with Kpn1 and Sph1 restriction enzymes. The restriction
digestion reactions were electrophoresed on 1% agarose gel and the bands corresponding to the Wwox
insert sequences were excised from the gel and purified using a QIAquick gel extraction kit (Qiagen).
The corresponding 5’ and 3’ sequences for each construct were then ligated and 2μl of the ligation
reaction used as template in a PCR reactions using primers DmFOR-F and dm FOR+RS.R5 which
correspond to the very 5’ and 3’ sequences of Wwox open reading frame, thus amplifying the those
sequences that ligated in the correct orientation. The PCR products were then subcloned into pENTR/D-
TOPO and sequenced to confirm the correct sequence was present in these constructs before
subcloning into pDEST-UAST by LR clonase-mediated recombination. These were then used for
microinjection into Wwox1 flies to generate transgenic Drosophila. Multiple independent transgenic lines
were generated for both of the WW domain deletion constructs. These lines were crossed to the driver
da-GAL4, which drives expression of the mutant protein ubiquitously throughout all stages of
development.
43
3.2.2 Wwox enzyme mutant construct generation
Using the in vitro site directed mutagenesis method described earlier (see Chapter 2.20), primers were
designed against the nucleotide sequences spanning the region coding for the Wwox active and co-
factor binding sites. These introduced an Adenine to Thymine substitution at position +863 of the open
reading frame and an Adenine to Guanine substitution at position +379 of the ORF. These mutations
therefore cause a Tyrosine to Phenylalanine substitution of the active site motif and a Threonine to
Alanine substitution at the co-factor binding site (Figure 3.2 D and E). Once sequences containing these
mutations were obtained, they were subcloned into the pENTR/D-TOPO vector and sequenced to
confirm the correct sequence was present in these constructs before subcloning into pDEST-UAST by
LR clonase-mediated recombination. These were then used for microinjection into Wwox1 flies to
generate transgenic Drosophila.
3.2.3 DNA sequencing of transformed Drosophila lines
Genomic DNA preparations were obtained as described in Chapter 2.16 and automated DNA
sequencing performed (Chapter 2.18) using the following primers: DmFOR-F, 593 F, 686 R, dm
FOR+RS.R5 (Chapter 2.1.1)
3.2.4 Detection of mutant Wwox proteins
Three wandering third instar larvae from each transgenic fly line produced were collected and
homogenised in 30μl SDS sample buffer and electrophoretically separated as described in Chapter
2.23. The protein from the resulting gels was then subject to antibody detection as described in Chapter
2.25.3 using the dWW #97 3rd bleed antibody (see Chapter 2.8)
3.2.5 Irradiation of Drosophila
Irradiation of Drosophila was performed as described in Chapter 2.22. The average number of flies that
survived IR exposure was calculated for each genotype tested in each experiment. The error bars
shown in the bar graphs presented in this chapter represent the variability in survival between different
groups of 50 larvae exposed to IR.
44
3.3 Results
3.3.1 Verification and detection of WW domain deleted Wwox fly lines
Injection of the Wwox WW domain deletion expression constructs into Wwox1 flies generated a total of
11 independent lines expressing the Wwox�WW1 construct and 15 expressing the Wwox�WW2 construct.
Multiple transformed lines were obtained to which the insertion of the expression constructs were
mapped to either the second or third chromosomes of the Drosophila genome.
To determine whether transgenic fly lines were expressing mutant proteins, western analysis was
performed on protein preps from whole third instar larvae expressing full length Wwox protein –
da>Wwox (positive over expression control); larvae expressing mutant Wwox protein - Wwox�WW1 and
Wwox�WW2 (WW domain deletion); larvae not expressing Wwox protein - Wwox1 (negative control).
Following SDS-PAGE and transfer to nitrocellulose membrane, proteins were probed with the N-
terminal polyclonal Wwox antibody. Despite the large amount of background signal produced by this
antibody, clear protein bands of the correct molecular weights were visible for all the transgenic lines
tested, although significantly less Wwox�WW2 was detected for the line run in lane 4 (Figure 3.3),
demonstrating that WW domain deleted Wwox proteins were being expressed in these lines.
45
Figure 3.3 WW domain deleted proteins are expressed. da>GAL4 was used to drive
expression of the WW domain deletion constructs. Whole third instar larvae protein preps
were run on a 15% polyacrylamide gel, which was transferred to nitrocellulose and probed
with a polyclonal antibody against the N-terminal region of the Wwox protein. Lane 1
shows positive control larvae expressing unaltered Wwox protein running at approximately
46.5 kDa. Lanes 2 and 3 show two independent fly lines expressing Wwox�WW1 protein
that was detected at approximately 44 kDa. Lanes 4 and 5 show larval protein from two
independent fly lines expressing Wwox�WW2 protein that was detected at approximately
42.5 kDa.
3.3.2 Flies expressing WW domain deleted Wwox proteins not sensitive to
IR
To test the ability of the WW domain deletion Wwox proteins to rescue the radiation sensitivity
phenotype, 600 Wwox�WW1 and Wwox�WW2 wandering third instar larvae were collected from two
independent lines, as well as larvae from w1118 (wildtype), Wwox1 (Wwox null mutant) and Wwox1;
da>Wwox (Wwox over expression). Following exposure to 20 Grays of ionising radiation (IR) the larvae
were left at 25°C to develop to adulthood. After all surviving individuals had eclosed, it appeared that
deletion of either the first or second WW domain of the Wwox protein was not sufficient to abrogate the
ability of the protein to at least partially rescue the radiation sensitivity phenotype observed in Wwox null
flies (Figure 3.4). The same outcome resulted for all independent WW domain deletion lines tested in
this study.
Wwox
46
Figure 3.4 Effect of ionising radiation on WW domain deleted Wwox expressing flies. The
percentage survival to adulthood of third instar larvae (N=600) following exposure to 20 Grays of IR is
shown for the following lines: w1118 (green), Wwox1 (red), Wwox over expression (purple), two
independent Wwox�WW1 lines (light blue) and two independent Wwox�WW2 lines (dark blue).
3.3.3 Wwox enzyme mutant Drosophila generation and verification
The WWOX protein belongs to the short chain dehydrogenase-reductase (SDR) super family of
enzymes. This class of enzymes typically do not show a great deal of amino acid sequence homology
except for two evolutionary conserved regions of the protein upon which their classification is based.
These regions constitute the active and co-factor binding sites of the enzyme and are known to be
critical for enzyme function and specificity (41, 43). A previous study conducted by Filling et al. (47),
identified those amino acid residues of both the active and co-factor binding site motifs that are required
for enzyme activity. The study demonstrated that substituting the Tyrosine residue of the active site to
any other amino acid was sufficient to totally abrogate enzyme function. Similarly, substituting the
Threonine residue of the co-factor binding site was also sufficient to destroy all enzyme activity.
Multiple independent transgenic lines were generated for both the active site and co-factor binding site
mutation constructs. These lines were crossed to the driver da-GAL4, which drives expression of the
mutant protein ubiquitously throughout all stages of development.
0
10
20
30
40
50
60
70
80
90
100
w1118
Wwox1 Wwox
1;
da>Wwox
Wwox1;
da>Wwox�WW1
Wwox1;
da>Wwox�WW2
% S
urviv
al
(2
0 G
y)
Fly Lines
47
3.3.4 DNA sequencing of enzyme mutant flies
Prior to experimentation, all Wwox enzyme mutant fly lines were tested for the presence of the desired
mutation in the open reading frame of the Wwox cDNA sequence these lines had been transformed
with. Figure 3.5 shows the results from the genomic sequencing of both a co-factor binding site mutant
line and an active site mutant line, with each exhibiting the engineered point mutation in the open
reading frame of the Wwox sequence. All lines used in radiation sensitivity experiments contained the
correct point mutations.
Figure 3.5 Sequence alignments obtained from Wwox enzyme mutant fly lines. (A)
Sequencing data obtained from co-factor binding site mutant line showing an A-G mutation at
position 379 (red box) of the Wwox open reading frame resulting in a T-A mutation at the co-
factor binding site of the enzyme. (B) Sequencing data obtained from active site mutant line
showing an A-T mutation at position 863 (red box) of the Wwox open reading frame resulting in
a Y-F mutation in the active site of the Wwox enzyme.
48
3.3.5 Detection of enzyme mutant proteins
Western analysis was performed on the enzyme mutant lines to determine whether these lines were
expressing recombinant proteins. The Western blot was conducted as previously described for the WW
domain deletion transgenic fly lines and produced clear protein bands of the correct molecular weights
that were visible for all the transgenic lines tested (Figure 3.6). This demonstrated that the enzyme
mutant proteins were expressed in these lines.
Figure 3.6 Wwox enzyme mutant proteins are expressed. Expression of the Wwox enzyme mutant
constructs was driven using da>GAL4. Whole third instar larvae protein preps were run on a 15%
polyacrylamide gel, which was transferred to nitrocellulose and probed with the Wwox N-terminal
polyclonal antibody. (A) Expression of enzyme co-factor binding site mutant protein. Lane 1: Larvae
over expressing Wwox protein. Lane 2: Wwox1 larvae protein with no Wwox protein detected. Lane 3:
larvae expressing WwoxT127A protein showing a band of the same molecular weight as unmodified
Wwox protein. (B) Expression of enzyme active site mutant protein: Lane 1, positive control larvae
expressing unaltered Wwox protein running at approximately 46.5 kDa. Lane 2: protein from flies
expressing WwoxY288F that is the same molecular weight as the unmodified protein. Lane 3: wildtype
protein with a faint band corresponding to the endogenous Wwox protein present. Lane 4: protein from
Wwox1 larvae with no Wwox protein detected. The yellow arrows indicate the position of Wwox proteins
on the gels.
49
3.3.6 Flies expressing enzyme mutant Wwox proteins not sensitive to IR
Multiple independent fly lines expressing WwoxT127A (co-factor binding site mutant) or WwoxY288F (active
site mutant) proteins were tested for their ability to survive ionising radiation. 300 to 450 wandering third
instar larvae were collected along with w1118, Wwox1 and da>Wwox larvae and exposed to 20 grays of
radiation then left to develop to adulthood at 25°C. All mutant lines tested, exhibited either a partial
rescue (Figure 3.7 A) or a complete rescue (Figure 3.7 B) of the IR sensitivity phenotype.
Figure 3.7 Effect of ionising radiation on Wwox enzyme mutant flies. The
percentage survival to adulthood of third instar larvae (N=350-400) following
exposure to 20 Grays of IR is shown for the following lines: w1118 (green),
Wwox1 (red), Wwox over expression (purple), Wwox enzyme mutants (blue).
(A) Survival to adulthood of Wwox1 flies overexpressing the SDR cofactor
binding site mutant WwoxT127A protein. (B) Survival of Wwox1 flies
overexpressing the SDR active site mutant WwoxY288F protein.
0
10
20
30
40
50
60
70
80
90
w1118
Wwox1 Wwox
1 ;
da>Wwox
Wwox1 ;
da>WwoxY288F
Fly
% S
urviv
al
(2
0 G
y)
B
0
5
10
15
20
25
30
35
40
w1118 Wwox
1 ;
da>Wwox
% S
urviv
al
(2
0 G
y)
Wwox1 Wwox
1 ;
da>WwoxT127A
Fly
A
50
3.4 Discussion
In an effort to elucidate the functional region(s) of the Wwox protein responsible for conferring a level of
resistance to IR that had been previously observed, a mutation screen approach was undertaken. Of
the various functional regions of the Wwox protein, the N-terminal WW domains and the oxidoreductase
enzyme, which comprises the majority of the protein, were chosen as targets for this analysis. Lines of
Wwox1 flies expressing Wwox proteins with deletions of either the first or second WW domain were
successfully generated as were Wwox proteins containing mutations, in either the active or co-factor
binding sites of the oxidoreductase enzyme, that have been shown to be sufficient in abrogating all
enzyme activity for other SDR’s.
3.4.1 Lack of IR sensitivity in Wwox mutant fly lines generated
The exposure of third instar larvae expressing various mutant Wwox proteins to 20 Gy of IR revealed a
significant loss of the IR sensitivity observed in the Wwox1 genetic background of these lines. Both the
WW domain deletion and enzyme mutant flies showed equivalent levels of survival as that exhibited by
control flies expressing unmodified Wwox protein, with several lines consistently displaying survival
rates greater than the positive control line (Figures 3.4 and 3.7). This lack of sensitivity was surprising
given the deletion or mutation of various functional regions of the Wwox proteins expressed in these
flies. A possible explanation for this observation is that the regions of the protein modified in these lines
are not responsible for conferring resistance to IR in Drosophila. This explanation however appears
unlikely, as the protein binding and enzyme regions of the Wwox protein constitute the vast majority of
the proteins sequence and presumably its functional properties. Previous studies by Filling et al. 2001
(47) demonstrated that introducing either of the mutations that were created in the active site or co-
factor binding sites of enzyme mutant lines created in this study, were sufficient to completely abrogate
all enzyme activity in SDR enzymes. As for the WW domain mutants, these contained the deletion of
only one of the two N-terminal WW domains of Wwox. It is possible that both of these domains need to
be absent or non-functional for the IR sensitivity seen in flies lacking Wwox protein to become apparent.
The only remaining components of the Wwox protein not tested in this study were the N-terminal PEST
protein degradation sequence and nuclear localisation signal sequence located between the two WW
domains. It remains to be seen if these functional regions of the protein play a part in the IR sensitivity
phenotype observed in Wwox1 flies.
51
3.4.2 Inconsistencies observed in IR exposure experiments
One troubling aspect of the IR rescue experiments conducted, was the considerable degree of variation
in survival rates observed from one day to the next and from experiment to experiment. This is
highlighted in Figure 3.7, in which w1118 flies exhibited survival rates around 30% in graph A and survival
rates closer to 70% in graph B. It was noticed during the course of these experiments that external
environmental conditions were having a significant influence over larval survival rates, with the amount
of environmental humidity appearing to have a significant impact on survival rates of the larvae. When
the humidity levels were more tightly controlled in the insect laboratory, thus reducing the desiccation of
larvae, exposure to 20 Grays of ionising radiation no longer produced increased levels of lethality in
Wwox1 flies (Appendix A). A dose response experiment was subsequently conducted exposing w1118,
Wwox1 and da>Wwox larvae to 22.5, 25 and 30 Grays of IR and revealed that when larvae were left to
recover in more humid conditions, 30 Grays of IR exposure was required to produce a significant level
of increased lethality in Wwox1 flies compared to w1118 and da>Wwox (Appendix B). Repeat
experiments employing higher levels of humidity in the environment and 30 Gy of IR recapitulated the
results presented in Figures 3.4 and 3.7 (Appendix C). The fact that environmental humidity was the
determining factor in the observed Wwox1 IR sensitivity at 20 Gy, highlighted concerns that other
unknown and thus less controllable environmental factors could be responsible for increased rates of
mortality observed, not merely the exposure doses of IR.
3.4.3 Summary
The aim of the experiments presented in this chapter was to identify the functional region(s) of the
Wwox protein responsible for conferring the levels of resistance to ionising radiation seen in flies
expressing Wwox protein. Given the lack of IR sensitivity observed in all Wwox mutant lines generated
and tested in this study, it was not possible to identify any part of the Wwox protein responsible for the
increased resistance to IR. As a result, it was decided that additional Wwox mutant proteins should be
generated containing much broader deletions of the Wwox protein. Expressing only the WW domains or
the SDR enzyme regions of the protein in Wwox1 flies should indicate wether Wwox protein binding
activity or enzyme function are required for increased resistance to IR. Testing constructs of this sort
would eliminate questions of whether the mutations/deletions tested in this study were sufficient in
abrogating Wwox function regarding survival following IR exposure. In light of the inconsistencies
observed in this study, it was also decided that a biochemical approach would also be undertaken to
examine the consequences arising from a lack of Wwox expression. As the extent to which external
environmental factors were responsible for the IR sensitivity phenotype used to examine the genetics of
various Wwox mutants was still unknown, it was hoped that a biochemical approach would provide a
52
clearer insight into the biological consequences of differential Wwox expression. A proteomic analysis of
Wwox mutants is presented in the next chapter.
As will be discussed in detail later, an alternative explanation was found to account for the rescue of
radiation sensitivity observed for all the Wwox variants tested. The radiation sensitivity appears not to be
the consequence of the Wwox mutations in the Wwox1 line, but of mutation(s) elsewhere in the
Drosophila genome that is complemented by wildtype chromosomes during the crossing of the fly lines
to test the ‘rescue’ Wwox constructs examined in this study.
53
54
Chapter 4:
Proteomic analysis of the consequences of
Wwox gene mutations
55
56
Chapter 4: Proteomic analysis of the consequences
of Wwox gene mutations
4.1 Introduction
4.1.1 Proteomic analysis of Wwox null mutant fly lines
As the radiation rescue experiments were unable to identify any mutations in Wwox that were able to
modify the null mutant sensitivity phenotype, a proteomic analysis of Wwox null flies was conducted. In
the absence of a phenotype, quantitative differences are needed that are quantitative in order to
undertake genetic analysis. The purpose of such an analysis was to identify proteins that are
consistently differentially expressed / modified between wildtype and Wwox null flies. The identification
of such proteins could facilitate their use as biomarkers to later assay the various Wwox mutant fly lines
that were examined for their ability to rescue the ionising radiation sensitivity phenotype observed. In
addition, the identification of differentially expressed / modified proteins could offer some insight into
which pathway(s) Wwox may be acting within.
4.1.2 Approach: 2D DIGE analysis of wildtype and Wwox null mutant adult
fly proteomes.
In order to identify proteins that are consistently differentially expressed / modified between wildtype and
Wwox mutant flies, two-dimensional Difference Gel Electrophoresis (2D DIGE) was employed. DIGE
technology (first described by Unlu et al. (81)) involves minimally labelling the Lysine residues of
different protein homogenates with one of three different spectrally resolvable florescent dyes referred
to as Cy2, Cy3 and Cy5. The use of these dyes allows up to three differentially labelled protein samples
to be multiplexed on the same gel. A pooled mixture containing an equal aliquot of all samples being
examined is labelled in bulk with Cy2 and used as an internal standard to coordinate between multiple
DIGE gels (see Figure 4.1). In addition to the internal standard, the DIGE gels each contain two different
samples individually labelled with Cy3 and Cy5 respectively. The quantitative comparison of proteomic
changes with statistical confidence is made possible by the analysis of replicate samples relative to the
same-pooled internal standard protein. After electrophoresis, fluorescence imaging with Cy2, Cy3 and
Cy5 excitation wavelengths, generates three different overlapping images per gel (Figure 4.2). These
images, from multiple gels, can then be analysed using the DeCyder� software suite (GE Healthcare)
to identify differentially expressed / modified proteins.
57
Figure 4.1. The DIGE pooled internal standard. An equal quantity of protein from each
sample examined in a DIGE experiment is pooled in a single tube and labelled with Cy2 dye.
The theoretical example shown in this figure shows the pooled internal standard created for
an experiment involving 4 control and 4 treated protein samples
The use of a Cy2 labelled internal protein mix in a set of gels allows for the quantitative comparison of
protein abundances within and between gels. It is important to note that for a resolved protein,
quantitative comparison is between the Cy2 internal standard signal and the Cy3 or Cy5 signals for the
same protein. When analysing a spot across a coordinated set of DIGE gels, the intra-gel ratios for each
resolved protein (Cy2:Cy3 and Cy2:Cy5) are normalised to the cognate ratios present in the other gels
(Figure 4.2). This allows the normalised protein abundance ratios for all samples on all gels to be
compared in the same experiment with statistical confidence. Figure 4.3 demonstrates how the internal
standard protein is used to normalise protein abundance values for each of the samples that comprise a
single matched spot. In addition, running a pooled internal standard protein sample on each gel of an
experiment, allows gel to gel variation to be differentiated from biological variation as illustrated in Figure
4.2.
1 2 3 4
Control samples
1 2 3 4
Treated samples
Pooled internal standard labeled with Cy2
58
Figure 4.2 Function of the DIGE Cy2 pooled internal standard. The internal standard,
in addition to permitting different DIGE gels containing very different Cy3 and Cy5 labelled
protein samples to be accurately spot matched, also allows gel to gel variation to be
differentiated from biological variation in a data set. Shown is a simplified schematic of two
simplified theoretical DIGE gels and the three spot maps corresponding to the Cy2 labelled
internal standard protein (yellow) and the Cy3 (red) and Cy5 (blue) labelled protein
samples for each gel. The coloured spots on the different spot maps illustrate the different
kinds of variation that can be encountered on 2D gels and how the internal standard allows
for the accurate identification of such variation. Green spots represent gel to gel variation
not biological variation, as both gels have the same ratio of Cy3 and Cy5 protein to Cy2.
Pink spots represent a biological decrease in sample 3 as it is the only spot with a
decreased ratio to its Cy2 standard spot. Grey spots represent biological absence of
protein in sample 1 with little gel to gel variation in this protein apparent between the gels.
Blue spots represent gel to gel variation and not an absence of this protein in samples 3
and 4, as no spot is detected in the relative location in the Cy2 image from gel 2.
Ratio
Ratio
Ratio
Ratio
Spots matched and normalised across gels to Cy2 standard
Standard (Cy2) Sample 3 (Cy3) Sample 4 (Cy5)
Standard (Cy2) Sample 1 (Cy3) Sample 2 (Cy5)
Gel 1
Gel 2
59
4.1.3 2D DIGE experimental design
To help facilitate the identification of genuine changes in protein expression / modification between
wildtype (w1118) and Wwox null flies, three different Wwox null mutant Drosophila lines were examined in
this study. In addition to the Wwox1 line, a second Wwox null mutant line generated by targeted
mutagenesis via homologous recombination, Wwox1-2 was examined. Wwox1-2 was derived from the
same reduction step, in the same parental fly, that produced Wwox1 thus making it an ideal internal
control for examining the homologous recombination knockout flies. The third mutant line used in this
study was an independent line generated from w1118 flies containing a piggyBac transposon in the
second intron of the Wwox open reading frame (Wwoxf04545, see Chapter 2.21.1). The reason for
Ab
un
da
nce
Sta
nd
ard
Gro
up
1
Gro
up
2
1.6
1.55
1.5
1.45
1.4
1.35
1.3
1.25
1.2
1.15
1.1
1.05
1
A B
Sta
nd
ard
Gro
up
1
Gro
up
2
Sta
nd
ard
ize
d A
bu
nd
an
ce
1.1
1.08
1.06
1.04
1.02
1.0
0.98
0.96
0.94
0.92
0.9
Average 1.08
Average 0.92
Spot ratio =Ave. Group 1
Ave. Group 2=
1.08
0.92= 1.17
Ab
un
da
nce
Sta
nd
ard
Gro
up
1
Gro
up
2
1.6
1.55
1.5
1.45
1.4
1.35
1.3
1.25
1.2
1.15
1.1
1.05
1
A
Ab
un
da
nce
Sta
nd
ard
Gro
up
1
Gro
up
2
1.6
1.55
1.5
1.45
1.4
1.35
1.3
1.25
1.2
1.15
1.1
1.05
1
A B
Sta
nd
ard
Gro
up
1
Gro
up
2
Sta
nd
ard
ize
d A
bu
nd
an
ce
1.1
1.08
1.06
1.04
1.02
1.0
0.98
0.96
0.94
0.92
0.9
Average 1.08
Average 0.92
Spot ratio =Ave. Group 1
Ave. Group 2
Ave. Group 1
Ave. Group 2=
1.08
0.92
1.08
0.92= 1.17
Figure 4.3 Normalisation of spot data using the internal standard. Shown is the protein
abundance data for a single matched protein spot across four DIGE gels containing
quadruplicate biological replicates of two different biological groups (Group 1 – blue and
Group 2 - red). Each of the dots on the graphs represents the relative abundance of protein
for each Cy3 and Cy5 labelled sample and Cy2 labelled internal standard protein that
comprises the matched spot on all four gels. Group 1, group 2 and the internal standard
proteins that were run on the same gel are linked by dotted lines. The crosses represent the
average relative abundance for each biological group and the internal standards. (A) Relative
protein abundance for each of the biological quadruplicates for groups 1, 2 and internal
standards prior to data normalisation. The differences in relative protein abundance shown
for the internal standard protein are due to gel to gel variation. (B) Normalising the internal
standard values obtained from each gel to a value of 1.0 thus normalises the relative
abundance values of each of the biological samples and clustering of all the biological
replicates in each group occurs.
60
examining multiple, independent Wwox null lines, was to allow the identification of common proteomic
changes between all mutant lines with respect to the wildtype. Any such changes would be more likely
due to the lack of Wwox expression than any outside factors influencing proteomic expression /
modification. Three biological replicates for each fly line, consisting of ten age matched male adult flies,
collected on consecutive days were examined across six gels. A loading matrix, showing how individual
samples were labelled and loaded for each of the six gels is shown in Table 4.1.
61
4.2 Materials and Methods
4.2.1 Sample preparation
For each fly line, ten age matched male adult flies were collected and protein preparations prepared as
described in Chapter 2.24.1. Protein purification was performed using a PlusOne� 2D clean-up kit (GE
Healthcare) and protein concentrations were estimated using an EZQ protein quantitation kit (Molecular
Probes).
4.2.2 DIGE labelling of protein samples
50μg of each protein preparation was labelled with 400pmoles of Cy Dye as described in Chapter
2.24.2. The protein labelling scheme is outlined in Table 4.1 below.
Table 4.1 DIGE experimental design for comparison of w1118 flies with three different Wwox
mutants. The letters in parentheses refer to the biological replicate protein sample labelled in this
experiment.
4.2.3 Electrophoretic separation of proteins
Samples were electrophoretically separated in the first dimension on 24cm pI 4-7 NL IEF strips using
the rehydration loading method (see Chapter 2.24.3). Isoelectric focusing was performed at 20°C using
a stepwise gradient of 30 minutes at 500 V, 1 hour at 1000 V, 30 minutes from 1000 V to 8000 V, 5
hours at 8000 V, 30 minutes from 8000 V to 500 V. The current was limited at 50μA per IPG strip.
Following equilibration of focused IEF strips, second-dimension SDS-PAGE was performed (Chapter
2.24.5) using the Ettan� DALTsix Large Vertical electrophoresis system (GE Healthcare), with gels
cast using the Ettan� DALTsix gel caster (GE Healthcare). Electrophoresis was performed at 450 V for
5 hours.
Gel Cy2 Standard Cy3 Cy5
1 Pooled Standard Protein w1118 (A) Wwox1 (C)
2 Pooled Standard Protein Wwoxf04545 (C) Wwox1-2 (A)
3 Pooled Standard Protein Wwoxf04545 (A) w1118 (B)
4 Pooled Standard Protein Wwox1-2 (C) Wwox1 (B)
5 Pooled Standard Protein w1118 (C) Wwox1-2 (B)
6 Pooled Standard Protein Wwox1 (A) Wwoxf04545 (B)
Pooled internal standard protein = w1118 A-C, Wwox1 A-C, Wwox1-2 A-C & Wwoxf04545 A-C
62
4.2.4 Image analysis
DIGE gels were scanned using a Typhoon 9400 Variable Mode Imager (GE Healthcare) and the images
analysed using the DeCyder 2-D Differential Analysis Software v6.5 (GE Healthcare)
4.2.5 Protein identification
Spots of interest were excised from three preparative 2D gels, each gel containing 400μg of pooled
Drosophila protein. These gels were produced in exactly the same way as the DIGE gels (see above)
except that they contained no Cy Dye labelled protein. Protein spots were visualised by coomassie
brilliant blue staining (Chapter 2.25.2) and excised manually using modified pipette tips. Gel pieces
containing the same protein spot were pooled and Briefly, gel pieces were subjected to reduction,
alkylation and in-gel trypsin digestion (Chapters 2.27.2 and 2.27.3 respectively), then destained in
washes of 12.5 mM sodium bicarbonate in 50% acetonitrile, dehydrated in acetonitrile and dried in a
37°C incubator. Gel pieces were digested with Trypsin Gold (Promega) and incubated at 37°C for 4
hours. The digest supernatant was added to 20 �l of purified water, vortexed briefly and sonicated for 1
minute. MALDI mass spectrometry was performed on a Micromass M@LDI™ LR (Micromass,
Manchester, UK) operating in the reflectron mode. A 1:1 mixture of the protein digest and �-Cyano-4-
hydroxycinnamic acid matrix were spotted onto the MALDI target plate. A peptide mass peak list was
generated using ProteinLynx V2.0 (Waters Corp., Milford, MA, USA). the MSDB 20060831 database
was searched using the MASCOT search engine (www.matrixscience.com). Searches were performed
under the parameters of fixed carbamidomethylation of cysteines, variable oxidation of methionines,
mass tolerance of 100 ppb, and one missed trypsin cleavage.
63
64
4.3 Results
4.3.1 Proteome changes detected by DIGE between w1118 and Wwox null
mutants
Following isoelectric focussing and SDS-PAGE, each of the DIGE gels was scanned to produce three
independent spot maps corresponding to the Cy2, Cy3 and Cy5 labelled proteins run on each gel. A
total of 18 spot maps were produced in this experiment that were analysed using the DeCyder 6.5
software suite, which spot matched a total of 1643 spots across all 6 gels. Independent statistical tests
were performed on this data set comparing each Wwox mutant individually to w1118, employing 1
ANOVA and student’s T-tests. Following each statistical test, data sets were filtered by applying a
significance threshold of p and ANOVA values <0.05, with an average ratio change in abundance of
1.2 or � -1.2 and limited to spots matched on all gels. A summary of this analysis is presented in Figure
4.4, which revealed 41 spots showing a change in expression between Wwox1 and w1118, 37 between
Wwox1-2 and w1118 and 77 between Wwoxf04545 and w1118. Each of these data sets were then compared
to each other in order to identify those protein changes common between the different null mutants. This
analysis revealed 15 protein changes shared between Wwox1 and Wwox1-2, 10 between Wwox1 and
Wwoxf04545, 9 between Wwox1-2 and Wwoxf04545 and 4 changes shared between all three mutants. The
positions of the spots represented in the overlapping regions of the Venn diagram in Figure 4.4 are
shown on a spot map in Figure 4.5.
65
Figure 4.4 Summary of proteomic changes detected by DIGE analysis between
Wwox1 (red), Wwox1-2 (yellow), Wwoxf04545 (blue) and w1118 adult flies. The total number
of spots that exhibited an average ratio change in abundance compared to w1118 of 1.2 or
� -1.2 with p and ANOVA values <0.05 were identified for each genotype of fly. The
number of spots (shown in parentheses) exhibiting common changes in abundance
between the different Wwox mutants is shown in the overlapping regions of the circles.
Tables labelled with letters corresponding to those in each shaded region (situated in
Appendix D Tables A-G) present the statistical data for the spots represented by these
regions.
Wwox1
Wwox1-2
Wwoxf04545
C (4)
A (21)
B (5) (11) D
(6)
F (16) G E (62)
66
Figure 4.5 Spot map of proteins exhibiting significant changes in protein abundance between
three different Wwox null mutant lines and w1118 adult flies. Spots exhibiting an average ratio
change in abundance compared to w1118 of 1.2 or � -1.2 with p and ANOVA values <0.05, common
to at least two mutant lines are shown. The colours of the spot boundaries correspond to the genotype
of the flies (listed below the spot map) that exhibited a common change in protein abundance.
1001 1045 1060
1100
113
1241 1349 1381
1462 1491
1510
266
438
632
656 673
674 680
691 765
77 85
913 920 949
968
w1118
vs Wwox1 & Wwox
1-2 w
1118 vs Wwox
1 & Wwox
f04545 w1118
vs all mutants w
1118 vs Wwox
1-2 & Wwox
f04545
4 7
~100kDa
~50 kDa
~10 kDa
~25 kDa
5 6 pI
67
Table 4.2 Quantitative 2D-DIGE data for the 26 spots shown in Figure 4.5. Student’s T-test,
average ratio change in abundance and 1-Way Analysis Of Variance (1-ANOVA) values for the
spots showing a common change in abundance between w1118 and at least two Wwox mutant lines
are presented. The coloured regions of the table correspond to those spots represented by the areas
of overlap in the Venn diagram in Figure 4.4. Only data that was over the significance threshold set
for this analysis is presented in this table.
4.3.2 Multivariate statistical analysis of DIGE data
The DeCyder Extended Data Analysis (EDA) module was used to perform Principal Component
Analysis (PCA) and Hierarchical Clustering (HC). PCA reduces the dimensionality of a multidimensional
dataset to display only two principal components that represent the two largest sources of variation
within that dataset. Each data point in the PCA plots (Figure 4.6) describes the collective expression
profiles for the subset of proteins presented in Figure 4.4 (Figure 4.6-A) and Table 4.2 (Figure 4.6-B).
PCA demonstrated high reproducibility between biological replicate samples as these grouped together
and indicated distinct expression patterns for the four groups evident in their clustering at different
positions along both the x and y axes. Interestingly, the two homologous recombination (HR) knockout
fly lines (Wwox1 and Wwox1-2) grouped together on the plot while the Wwoxf04545 flies clearly grouped
away from them.
Master # T-test Ave Ratio T-test Ave Ratio T-test Ave Ratio 1-ANOVA
1 656 0.0023 1.52 0.0047 1.44 0.033 1.34 0.0017
2 968 0.0091 -1.26 0.038 -1.42 0.016 -1.23 0.022
3 1381 0.0062 -3.6 0.008 -3.1 0.0014 -3.6 0.0015
4 1491 0.0025 -4.06 0.05 -1.58 0.001 -3.03 0.0003
5 77 0.017 1.39 0.018 1.48 0.023
6 266 0.0054 1.55 0.0019 1.65 0.024
7 438 0.02 1.45 0.02 1.44 0.007
8 913 0.018 -1.36 0.0029 -1.73 0.012
9 1349 0.0014 2.04 0.018 1.54 0.005
10 85 0.032 1.23 0.0021 1.33 0.013
11 632 0.0017 2.17 0.0061 1.87 0.00012
12 674 0.0052 1.54 0.0086 1.34 0.0033
13 691 0.035 1.45 0.025 1.21 0.039
14 1001 0.044 -1.23 0.032 -1.34 0.016
15 1045 0.0023 2.5 0.0066 2.14 0.0014
16 1060 0.00079 -2.9 0.037 -1.49 3.00E-05
17 1100 0.014 -1.61 0.00025 -1.68 0.038
18 1241 0.019 -1.84 0.00057 -3.24 2.90E-05
19 1462 0.00097 -1.33 0.044 -1.35 0.0029
20 1510 0.0074 7.87 0.044 7.35 0.0038
21 113 0.0066 1.21 0.00017 1.76 0.00021
22 673 0.014 1.3 0.023 1.45 0.044
23 680 0.0043 -4.15 0.0035 -4.42 0.00027
24 765 0.033 1.3 0.011 1.31 0.0067
25 920 0.023 -1.44 0.029 -1.38 0.0006
26 949 0.0033 -1.36 0.05 -1.29 0.0036
Wwox1
Wwox1-2
Wwoxf04545
68
Figure 4.6 Principal component analysis (PCA) plots of DIGE data. A PCA plot representing all
spots displaying a significant change in protein abundance between Wwox mutants and w1118. Each
data point in the plot describes the global expression values for the set of proteins represented in
Figure 4.4. B. PCA plot of the spots listed in Table 4.2 representing spots exhibiting a consistent and
significant change in protein abundance between at least two Wwox mutant lines.
The grouping patterns displayed in the PCA plot were reiterated in an unsupervised hierarchical
clustering (HC) analysis (Figure 4.7) of the 26 spots represented in Figure 4.6-B. HC compares groups
based on similarity of the collective expression profiles of the proteins examined. The similarity of the
groups is proportional to the lateral distance revealed in the branched dendograms above each
expression matrix. Each data point in the PCA plot is effectively the same as each column in the HC
expression matrix (heat map). Together, the PCA and HC analysis reveal that for the proteins that show
a common change in expression to wildtype, shared by at least two different Wwox mutants, the
homologous recombination knockout lines share the most similar expression profiles with the P-element
insertion knockout flies exhibiting an expression profile clearly divergent from them.
PC
2:
23
.8%
of
va
ria
nc
e
1.4
1
0.5
0
-0.5
-1
-1.4
PC1: 54.65 of variance
2 1 0 -1 -2
Wwox1
w1118
Wwox1-2
Wwoxf04545
2.4
2
1.5
1
0.5
0
-0.5
-1
-1.5
-2
-2.4
3 2 1 0 -1 -2 -3
PC
2:
19
.7%
of
va
ria
nc
e
PC1: 47.9% of variance
A B
69
Figure 4.7 Unsupervised hierarchical clustering of the 12 independent samples based on
the global expression patterns of the 26 proteins detailed in Table 4.2. The relative expression
values are displayed as an expression matrix employing a relative scale ranging from -0.65 (green)
to 0.65 (red). Hierarchical clustering of individual proteins is shown to the left and clustering of
individual protein samples is shown on top. The ID numbers of the individual protein spots are
listed to the right. The gel number and Cy dye labelling for each sample are detailed at the bottom.
266
438
77
765
113
85
656
674
691
673
1349
913
968
1001
1100
920
949
1462
632
1045
680
1381
1491
1060
1241
1510
Gel#
1 –
Cy3 -
A
Gel#
5 –
Cy3 -
C
Gel#
3 –
Cy5 -
B
Gel#
2 –
Cy3 -
C
Gel#
6 –
Cy5 -
B
Gel#
3 –
Cy3 -
A
Gel#
1 –
Cy5 -
C
Gel#
4 –
Cy5 -
B
Gel#
6 –
Cy3 -
A
Gel#
2 –
Cy5 -
A
Gel#
4 –
Cy3 -
C
Gel#
5 –
Cy5 -
B
w1118 Wwoxf0454 Wwox1 Wwox1-2
0 -0.65 0.6
70
4.3.3 Mass spectrometry identification of differentially expressed spots
The 26 proteins outlined in Figure 4.5 were selected for identification by mass spectrometry (MS).
Where present, the spots were excised from three individual preparative gels that were run under the
same conditions as the DIGE gels except that they contained 300μg of unlabeled total protein. Of the
26 spots, three (spots 77, 113 and 765) were unable to be visualised on the coomassie stained
preparative gels and were not identified. Gel pieces containing the same protein spot (excised from
different gels), were pooled and digested with trypsin before being subjected to MALDI-TOF MS
analysis. Being unable to create peptide fragmentation data on the mass spectrometer used in this
study, it was not possible to obtain significant protein identifications for those spots less than 15 kDa in
size, due to the small number of detectable peptides produced by proteins of this size. As a result no
identifications were possible for spots 1349, 1381, 1462, 1491 and 1510. Failure to obtain protein
identifications was also brought about due to the lack of sufficient protein present in a number of
excised spots despite the pooling of multiple excised gel pieces. As a result no identifications were
possible for spots 673, 674, 691, 920, 949,1001, 1045, 1060 and 1100. Of the 23 spots analysed,
protein identities for 8 were obtained – as detailed in Table 4.3. Extensive peptide mass fingerprint
coverage was obtained for spots that yielded positive identifications, with mass fingerprint sequence
coverage ranging from 23%-63%.
71
Table 4.3. MS Identification of proteins exhibiting a significant change in abundance between w1118 &
Wwox mutant flies. The coloured regions of the table correspond to those 2D gel spots shown in Figure 4.5
and Table 4.2. More detailed MS data is presented in Appendix I (on accompanying CD).
Spot # Accession NameQueries
matched
Sequence
coverage
Combined*
MOWSE
score
Theoretical mol.
mass (Da)/pI
Observed mol.
mass (Da)/pI
656 gi|24666065 CG7460-PB 19 38% 62 56,040 / 5.98 ~30,000 / 6.00
968 gi|24651364Ferritin 2 light
chain homologue 15 63% 172 25,455 / 5.90 ~25,000 / 5.80
266 gi|17136630 Black cells 19 29% 91 79,441 / 6.14 ~80,000 / 5.70
438 gi|19921434 CaBP1 18 40% 69 47,179 / 5.48 ~48,000 / 5.45
913 gi|313770
Ubiquitin carbox-
terminal
hydrolase
10 44% 65 25,850 / 5.52 ~26,000 / 6.86
85 gi|24645686Iron regulatory
protein 1B 41 52% 95 99,030 / 5.66 ~100,000 / 5.00
632 gi|20130415 CG9119 15 46% 92 35,866 / 5.96 ~35,000 / 5.78
1241 gi|4572573Superoxide
dismutase7 61% 65 15,699 / 6.06 ~15,000 / 5.80
680 gi|24646910
senescence
marker protein-
30
6 23% 71 33,413 / 6.19 ~32,000 / 6.52
* Scores greater than 59 are significant (p<0.05)
72
4.4 Discussion
The 2D DIGE approach was successful in identifying consistent, statistically significant changes in
protein abundance between the different fly lines examined in this study. Four protein spots were
identified that exhibited a significant change in abundance between w1118 and all three Wwox null
genotypes although attempts to identify these proteins using MS proved successful for only two of the
spots.
4.4.1 Unexpected level of variation detected between Wwox mutant flies
In this study a total of 1,643 spots were matched across all six gels, thus allowing comparison of only a
modest segment of the Drosophila proteome. Despite this, four protein spots were identified that
exhibited a common and significant change in abundance between all Wwox mutant lines and w1118.
Although MS identification of these proteins proved only partially successful, the 2D DIGE analysis
provided novel insight into the proteomic differences (and by extension genetic differences) present
between the fly lines examined. The identification of significant changes in protein abundance between
each Wwox mutant line and w1118 revealed a similar number of spot changes between the individual HR
Wwox mutants and w1118. The piggyBac insertion line Wwoxf04545 however exhibited a much larger
number of proteomic changes to that of the HR mutants, with 77 spots identified for Wwoxf04545
compared to 41 and 37 identified for Wwox1 and Wwox1-2 respectively (Figure 4.4). Although the HR
Wwox mutant lines contained a similar number of protein changes relative to w1118, closer examination
revealed that only a small number of those spots were common to both fly lines. As Figure 4.4 shows,
21 spots were identified displaying changes unique to Wwox1, while 16 spots were unique to Wwox1-2
with 15 spots common to both HR mutant lines.
4.4.2 Multivariate statistical analysis
Multivariate statistical analysis of the data set was undertaken to further characterise the proteomic
differences between the different fly lines. The principal component analysis (PCA) undertaken displays
only two principal components representing the two largest sources of variation within the dataset. This
form of analysis reduces the dimensionality of the DIGE data, allowing for the identification of otherwise
obscured statistical relationships present in the data. A data set consisting of spots exhibiting a
significant change in abundance, relative to w1118, detected in any of the Wwox mutant lines was
created. PCA analysis was conducted on this data set (Figure 4.6-A), consisting of a total of 125
73
proteins represented by the coloured regions of the Venn diagram in Figure 4.4. Principal component 1
(PC1), representing the largest source of variation in the dataset (47.9% total variation), revealed that
the HR mutants largely group together away from Wwoxf04545 which itself groups away from w1118. PC1
shows that the greatest amount of variation in the dataset was found between the HR mutants and
Wwoxf04545. PC2, representing 19.7% of variation, clearly showed w1118 grouped away from all Wwox
mutant lines. This data shows that the differences in protein abundance between the HR Wwox mutant
lines and Wwoxf04545 are greater than the differences between the mutant flies and w1118. PCA
undertaken on a smaller dataset, consisting of the 26 spots that showed changes common to at least
two mutant lines (represented by the overlapping regions of the circles in the Venn diagram in Figure
4.4), revealed a very similar relationship between the fly lines (Figure 4.6-B). Hierarchical clustering
(HC) analysis was also performed on this dataset with the grouping patterns displayed in the PCA plot
reiterated, as illustrated by the clustering pattern of the branched dendogram displayed above the HC
expression matrix.
Taken together, the results of the multivariate statistical analysis showed that each of the Wwox mutant
fly lines possessed unique sources of variation that were manifest at the level of protein expression.
This variation was unlikely to be the result of external environmental conditions as these conditions were
very closely controlled for with all lines being grown on the same media, in identical flasks and kept in
the same area of the insect laboratory. Had environmental conditions been having a significant effect on
the flies, this should have been detected between the biological replicate samples obtained from the
same fly line. As the flies used to create replicate samples were collected on different days, significant
changes in protein expression due to environmental conditions might be expected to be present
between flies collected several days apart. As both the PCA plots and HC matrix (Figures 4.6 A & B,
Figure 4.7) revealed a relatively small amount of variation between biological replicate samples, the
source of the variation between the Wwox mutants was most likely genetic.
4.4.3 Wwoxf04545 flies - the odd ones out
The striking differences in protein profile between the HR Wwox mutant lines and Wwoxf04545 suggested
that the Wwoxf04545 flies might have a slightly different genetic background. Unlike the HR Wwox mutant
lines that were both generated from the w1118 strain used in this study, the Wwoxf04545 line was
generated by the “Drosophila Gene Disruption Project” using a separate laboratory population of w1118
flies. As a result the genetic backgrounds of these flies could be considerably different due to the effects
of random genetic drift and the accumulation of random mutations over time (82). The altered protein
profile observed could also be the result of background mutations introduced during the P-element
insertion process used to create this strain. It has been reported that 0.3–0.5% of piggyBac insertion
74
strains contain unlinked background mutations (83), making this a possible cause of the divergent
profile observed. Another explanation could be that despite the presence of a p-element insertion this
line possesses within the open reading frame of Wwox, there is some read-through from the Wwox start
codon into the P-element sequence resulting in the expression of a protein product. Expression of such
a protein product could result in the activation of various biochemical pathways in the fly, especially if
this protein were able to interact with other components of the cell.
4.4.4 Background mutations detected in Wwox mutant fly lines
While this proteomic study was being undertaken, ionising radiation (IR) sensitivity assays (as described
in Chapter 3) examining both the Wwox1 and Wwoxf04545 strains were conducted by Louise O’Keefe of
the Richards laboratory. Flies homozygous for either Wwox1 or Wwoxf04545 displayed an increased
sensitivity to IR compared to w1118 (74), however, flies that were trans-heterozygous for both Wwoxf04545
and Wwox1 did not display any significant increase in IR sensitivity (78). This suggested that in the
homozygous strains for each of the independent Wwox alleles, the IR sensitivity phenotype was
independent of the mutations in the Wwox gene. In order to confirm this, both the HR and piggyBac
Wwox mutant strains were backcrossed (for four rounds) to the parental w1118 strain used in the targeted
mutagenesis procedure. The resulting homozygous mutant strains exhibited a significant decrease in
sensitivity to IR exposure (78), thus confirming that the initial sensitivity observed in Wwox mutants was
independent of the Wwox mutations.
The discovery of background mutations present in the Wwox mutant strains helped to explain the
marked differences in protein abundances detected by 2D-DIGE. As multivariate statistical analysis of
the DIGE data using the DeCyder software was clearly able to identify the altered protein expression
profiles brought about by background mutations, it helps validate the 2D-DIGE experimental approach
as a powerful and sensitive means of detecting and measuring the changes in biochemical pathways
brought about by targeted mutations.
4.4.5 The significance of proteins identified in this study
The identification of the existence of non-targeted background mutations in the genomes of the mutant
Wwox strains used in this study makes it difficult to differentiate proteomic changes brought about by
the abrogation of Wwox expression from the biochemical changes attributed to the unidentified
background mutations. As such, it is therefore not possible to know whether the proteins identified by
2D-DIGE / MS and their associated biochemical pathways are related to Wwox and it’s associated
pathway(s). However, there is a much stronger possibility that the four spots identified that exhibited
75
consistent and significant changes between all the mutant lines and w1118 do represent proteomic
changes brought about due to lack of Wwox expression. Of these four spots, successful MS
identification of proteins was successful for only two spots (656 and 968). It remains unclear how Ferritin
2 light chain homologue protein, identified in spot 968, that exhibited a decrease in abundance in all of
the mutant lines, relates to Wwox function at this point. Of more interest was the identification of
CG7460, a Drosophila oxidoreductase enzyme protein. Unfortunately, this protein has only one known
homolg (in Anopheles gambiae), and little is known about this protein. It is interesting to note that this
protein exhibited an increase in abundance in all the Wwox null lines examined, suggesting that this
oxidoreductase enzyme may be up regulated to compensate for the lack of Wwox expression. With no
mutant fly lines available for the gene encoding this protein and no antibodies available, further study
into the relationship between Wwox and CG7460 does not appear feasible.
4.4.6 Conclusions
The discovery of non-targeted background mutations in the Wwox mutant lines revealed that there was
no identifiable phenotype associated with the loss of Wwox expression. This helped explain the
unexpected protein expression profiles found in the 2D-DIGE data. DeCyder analysis of the quantitative
2D gel data was able to clearly detect proteomic changes that are most likely the result of these
mutations, thus demonstrating the sensitive and robust capabilities of the DIGE technology. However, it
remains unclear as to how many of the changes in protein abundance identified in this study were
brought about due to the presence or absence of Wwox protein. As a result, it was decided that the
proteomic analysis of Wwox mutants would be repeated using mutant flies that had been backcrossed
to wildtype flies for several rounds. This analysis would hopefully identify proteins changing solely as a
consequence of Wwox expression and maybe provide a Wwox null mutant protein profile that could be
used as a biomarker of Wwox function. In the absence of any phenotype associated with a lack of
Wwox expression, such a biomarker protein profile could be used to assay the various transgenic Wwox
mutants presented in Chapter three.
76
Chapter 5:
Proteomic analysis of Wwox1 2-4 hour embryos
77
78
Chapter 5: Proteomic analysis of Wwox1 2-4 hour embryos
5.1 Introduction
5.1.1 Examination of backcrossed 2-4 hour Drosophila embryos
In an effort to minimise the impact of background mutations on the proteome of Wwox mutant flies,
Wwox1 flies were backcrossed to w1118 for four rounds (performed by Louise O’Keefe, (78)). As
backcrossed flies no longer exhibited an increased sensitivity to ionising radiation, it was important to
know if any proteomic changes could still be detected after backcrossing. It was decided that an early
time point in the Drosophila life cycle would be used for this proteomic study in an effort to identify the
earliest possible consequences of Wwox loss of expression and thus the primary pathway(s) that Wwox
may be involved in. To do this, protein preparations from 2-4 hour w1118 and backcrossed Wwox1
embryo lines were compared using the 2D-DIGE approach.
5.2 Materials and Methods
5.2.1 Embryo collection
For each fly line, 250 fertilised females were placed in a plastic cylinder that was closed off at the top
with fly mesh and a grape agar plate at the bottom so the flies could not escape. A small amount of
bakers yeast was place in the centre of the agar plate to provide the flies with a food source. Females,
after being placed in the cylinder, were kept at 25°C over night to familiarise them to this environment
and help increase their rate of egg laying. The following day, the grape agar plates were replaced every
half hour for two hours. This was done to encourage the females to lay any eggs they may have been
retaining due to the over night agar plate being crowded with eggs. At the end of this period, fresh
plates were positioned and the flies left to lay at 25°C for two hours, after which the plates were
removed from the cylinders and the embryos left to develop for a further two hours at 25°C. The
embryos were then gently gathered off the surface of the agar using a paint brush and placed in a 1.5ml
tubes.
79
5.2.2 Sample preparation
Collected embryos were washed gently twice in 1ml of 0.1% Triton X-100 before being snap frozen in
liquid nitrogen. Protein preparations were prepared as described in Chapter 2.24.1. Protein purification
was performed using a PlusOne� 2D clean-up kit (GE Healthcare), employing two extra wash steps
with cold 100% acetone containing the kit wash additive to ensure the removal of as much yolk fat as
possible. Protein concentrations were estimated using an EZQ protein quantitation kit (Molecular
Probes).
5.2.3 DIGE labelling of protein samples
50μg of each protein preparation was labelled with 400pmoles of Cy Dye as described in Chapter
2.24.2. The protein labelling scheme is outlined in Table 5.1.
Table 5.1 DIGE experimental design for comparison of backcrossed 2-4 hour Wwox1 embryos
with w1118 embryos. The letters in parentheses refer to the biological replicate protein sample
labelled in this experiment.
5.2.4 Electrophoretic separation of proteins
Samples were electrophoretically separated in the first dimension on 24cm pI 3-11 NL IEF strips using
the rehydration loading method (see Chapter 2.24.3). Isoelectric focusing was performed at 20°C using
a stepwise gradient of 30 minutes at 500 V, 1 hour at 1000 V, 30 minutes from 1000 V to 8000 V, 5
hours at 8000 V, 30 minutes from 8000 V to 500 V. The current was limited at 50μA per IPG strip.
Following equilibration of focused IEF strips, second-dimension SDS-PAGE was performed using the
Ettan� DALTsix Large Vertical electrophoresis system (GE Healthcare), with gels cast using the
Ettan� DALTsix gel caster (GE Healthcare). Electrophoresis was performed at 450 V for ~5 hours.
Gel Cy2 Standard Cy3 Cy5
1 Pooled Standard Protein w1118 (A) Wwox1 (C)2 Pooled Standard Protein Wwox1 (A) w1118 (D)3 Pooled Standard Protein w1118 (C) Wwox1 (B)
4 Pooled Standard Protein Wwox1 (D) w1118 (B)
Pooled internal standard protein = w1118 A-D, Wwox1 A-D
80
5.2.5 Image analysis
DIGE gels were scanned using a Typhoon Variable Mode Imager (GE Healthcare) and the images
analysed using the Biological Variation Analysis (BVA) module of the DeCyder 2-D Differential Analysis
Software v6.5 (GE Healthcare)
5.2.6 Protein identification
Spots of interest were excised from three preparative 2D gels, each containing 400μg of pooled
Drosophila embryo protein. These gels were produced in exactly the same way as the DIGE gels (see
above) except that they contained no Cy Dye labelled protein. Protein spots were stained with
CyproRuby (Chapter 2.25.1), visualised over a UV light box and excised manually using modified
pipette tips. Gel pieces containing the same protein spot were pooled and subjected to reduction,
alkylation and in-gel trypsin digestion (Chapters 2.27.2 and 2.27.3 respectively).
A saturated solution of �-cyano-4-hydroxycinnamic acid (Sigma Aldrich) was prepared (HCCA
saturated in acetone : 0.1% TFA, 97 : 3) and applied onto an MTP AnchorChip� 600/384 (Bruker)
target and removed immediately creating an HCCA thin layer over the target points. 1μl of each
concentrated tryptic peptide sample was then applied over the HCCA thin layer and incubated for ~3
minutes. 2μl washing buffer (10mM ammonium phosphate, in 0.1% TFA) was added to the residual
liquid and the whole droplet removed with a pipette tip. Once crystallised, MALDI-TOF mass spectra
were acquired using a Bruker ultraflex III MALDI TOF/TOF mass spectometer (Bruker Daltonics,
Bremen, Germany) operating in reflection mode under the control of the flexControl software (Version
3.0, Bruker Daltonics). External calibration was performed using peptide standards (Bruker Daltonics)
that were analysed under the same conditions. Spectra were obtained randomly over the surface of the
matrix spot at laser intensity determined by the operator. A signal to noise ratio threshold of 10 was
used for peak selection. Peak masses and intensities of TOF and LIFT spectra were detected with
flexAnalysis (Version 3.0, Bruker Daltonics) using the SNAP algorithm.
81
5.3 Results
5.3.1 Proteome changes detected by DIGE between w1118 and Wwox null
mutants
Following isoelectric focussing and SDS-PAGE, each of the DIGE gels were scanned to produce three
independent spot maps corresponding to the Cy2, Cy3 and Cy5 labelled proteins separated on each
gel. A total of 12 spot maps were produced in this experiment that were analysed using the BVA module
of the DeCyder 6.5 software suite, which spot matched a total of 1,303 spots across all 4 gels. All four
gels resolved relatively well with only minor horizontal streaking at the high molecular mass range and
at the basic region of the focusing range (pI 8-10). Due to the high abundance of yolk proteins in the
embryo proteome, considerable distortion to spot resolution of those spots in close proximity was
observed. As there was no viable way of depleting the yolk proteins without excessive loss of other
proteins, the distortion caused was unavoidable. Independent statistical tests were performed on this
data set comparing Wwox1 to w1118, employing 1 ANOVA and student’s T-tests. Following statistical
testing, the data set was filtered by applying a significance threshold of p and ANOVA values <0.05,
with an average ratio change in abundance of 1.2 or � -1.2 and limited to spots matched on all gels. A
summary of this analysis, presented in Figure 5.1 and Table 5.2, revealed 11 spots exhibiting a
significant change in protein abundance between Wwox1 and w1118.
Master # T-test Ave Ratio
1 1143 0.00015 1.96
2 368 0.0031 1.26
3 877 0.0064 1.23
4 1189 0.038 1.23
5 463 0.037 -1.21
6 570 0.0018 -1.28
7 1249 0.03 -1.3
8 370 0.00042 -1.34
9 367 0.00074 -1.36
10 1146 0.0031 -1.42
11 899 0.0013 -1.49
Table 5.2. Spots exhibiting a significant change in protein abundance
between w1118 & Wwox1. The DeCyder BVA module assigned master
number for each spot is given as well as the Student’s T-test and average
ratio change in abundance values.
82
1143 1143 11461146
1189 1189
12491249
367367
368368370370
463 463
570570
877
899 899
~200 kDa
~10 kDa
pH 4 pH 10
1143 1143 11461146
1189 1189
12491249
367367
368368370370
463 463
570570
877
899 899
1143 1143 11461146
1189 1189
12491249
367367
368368370370
463 463
570570
877
899 899
~200 kDa
~10 kDa
pH 4 pH 10
Figure 5.1 Spot map of proteins differentially expressed between Wwox1 and w1118 2-4
hour embryos. Spots exhibiting an average ratio change in abundance compared to w1118 of
1.2 or � -1.2 with student’s T-test values <0.05 are shown. Blue spot boundaries indicate an
increase in protein abundance in Wwox1 and red spot boundaries a decrease in protein
abundance relative to w1118.
83
5.3.2 Mass spectrometry identification of differentially expressed spots
The 11 proteins outlined in Figure 5.1 were selected for identification by mass spectrometry (MS).
Where present, the spots were excised from three individual preparative gels that were run under the
same conditions as the DIGE gels except that they contained 400μg of unlabeled protein. Gel pieces
containing the same protein spot (excised from different gels), were pooled and digested with trypsin
before being subjected to MALDI-TOF MS or liquid chromatography ESI Ion Trap-MS analysis. Of the
11 spots analysed, protein identities for 6 were obtained – as detailed in Table 5.3. No data was
obtained for spot 463 as this spot was unable to be excised as it was not resolved on the preparative
gels due to the yolk protein band positioned just above the position of this spot obscuring the spot. No
significant MS data was obtained for spot 570 due to a lack of detectible peptides in the gel pieces
excised. An insufficient number of ionisable peptides were detected for spot 1249 to provide a
significant protein identification.
Table 5.3. MS Identification of proteins exhibiting a significant change in abundance between w1118 &
Wwox1 2-4 hour embryos. More detailed MS data is presented in Appendix I (on accompanying CD).
^ Analysis performed using LC-ESI-Ion Trap MS/MS
Spot Ave Ratio T-test
1143^ 1.96 0.00015 gi|8647Superoxide
Dismutase8 (8) 58% 822 15,988 / 5.85 ~16,000 / 6.00
368 1.26 0.0031 gi|24583049GDP dissociation
inhibitor12 (1) 28% 229 50219 / 5.51 ~50.000 / 5.60
877 1.23 0.0064 gi|24584213 mRpS23 11 (3) 56% 228 21559 / 5.58 ~22,000 / 5.60
1189 1.23 0.038 gi|24656769 CG4279 6 (0) 48% 104 15,803 / 5.29 ~15,500 / 6.00
463 -1.21 0.037 - - - - - - -
570 -1.28 0.0018 - - - - - - -
1249 -1.3 0.03 - - - - - - -
370 -1.34 0.00042 gi|17137572Elongation factor
1alpha48D10 (0) 33% 78 50561 / 9.14 ~50.000 / 5.40
367 -1.36 0.00074 gi|24581952 Hel25E 11 (1) 29% 120 49,085 / 5.43 ~50.000 / 5.50
1146^ -1.42 0.0031 gi|8647Superoxide
Dismutase5 (5) 40% 363 15,988 / 5.85 ~16,000 / 6.20
899 -1.49 0.0013 gi|20129563 CG17331 7 (0) 29% 68 22525 / 5.95 ~22,000 / 6.20
Observed mol.
Mass (Da)/pI
Sequence
Coverage
Combined
MOWSE
score
Theoretical mol.
Mass (Da)/pI
DIGEAccession Name
Queries*
Matched
84
5.4 Discussion
The 2D DIGE study presented here demonstrated that significant changes in protein abundance were
still detectable after several rounds of backcrossing Wwox1 flies to w1118. The number of spots exhibiting
a significant change in abundance between the two lines examined was lower than that observed in the
previous study (Chapter 4), with roughly half the number identified. Of the protein spots resolved from
the Drosophila embryo proteomes, the magnitude of changes in protein abundance detected between
w1118 and Wwox1 was not as great as that observed in adult flies prior to backcrossing. It is not known if
this was due to the backcrossing or the different developmental time point examined. However, DIGE
comparisons of backcrossed Wwox1 adult flies with w1118, also exhibited a significant decrease in the
number of proteins that exhibited a change in abundance (78). Another point of difference between the
two studies was the type of IEF strip used, with broad range pI 3-11 strips used in this study compared
to the pI 4-7 strips used in Chapter 4. As a result, these two factors together make it difficult to make
direct comparisons between the two studies.
5.4.1 Changes in Superoxide dismutase 1 abundance detected in both
embryos and adults
Almost all the proteins identified in this study were found to be different from those identified in Chapter
4, which was probably due to the difference in developmental time point and pI range of strips used in
the two studies. The one exception was the identification of Superoxide dismutase (Sod) in both studies.
Significant changes in Sod protein abundance were detected in all three Wwox null mutants lines at the
adult stage prior to backcrossing. Spot 1241 that contained Sod protein, showed a -1.84 and -3.24 fold
change in abundance (compared to w1118) between Wwox1 and Wwox1-2 respectively (Table 4.2), while
Wwoxf04545 exhibited a 1.36 fold increase in abundance (Appendix D: Table E). Why this decrease in
abundance in the HR mutants and an increase in the piggyBac mutant line was observed remains
unclear. The non-targeted background mutations found in the HR lines may have contributed to
biochemical changes in these flies resulting in a decrease in Sod protein where normally flies not
expressing Wwox would exhibit an increase in Sod protein, as seen in Wwox1 embryos after
backcrossing. Alternatively, the difference in Sod abundance may be due to the difference in
developmental stages being compared. In the adult fly, Sod protein levels remain generally constant,
while during embryogenesis, the level of Sod rises rapidly peaking in mid-embryogenesis then falling
gradually in late embryogenesis (84). Although two different Sod isoforms exhibited significant changes
in abundance in this study, one increasing the other decreasing, a recent microarray analysis of Wwox
85
null fly lines revealed an upregulation of Sod mRNA levels (S. Dayan, L. O’Keefe and G. Price 2006,
unpublished data).
Sod, also know as Cu-Zn Superoxide dismutase and Sod1, is one of several superoxide dismutase
enzymes that convert superoxide anion radicals (O2-) to hydrogen peroxide (H2O2) and oxygen (O2).
Sod functions as a homodimeric enzyme with the active site of each subunit containing a metal ion, one
with copper the other with zinc. Sod1 is ubiquitously expressed and is predominantly localised to the
cytoplasm although it is also found to a lesser extent in the nucleus, mitochondrial intermembrane
space, lysosomes and peroxisomes. Sod1 has also been shown to possess peroxidase activity, acting
on its own catalytic product, however under pathological H2O2 concentrations it loses its metal cofactors
and becomes inactive.
5.4.2 Possible links between Wwox and Sod
Like WWOX / Wwox, SOD1 has been implicated in several aspects of cancer biology. Changes in
serum and tissue SOD activities as well as activities of other free radical scavengers have been
confirmed in various cancers. Both SOD1 and WWOX have been shown to enhance the apoptotic
activity of p53 (34, 85). WWOX is known to physically interact with TRAF2 and JNK1 to promote cell
survival (54, 68), while SOD1 in generating H2O2 is capable of regulating the protective NF-�B pathway
(57). The possibility exists for the interaction of SOD1 and WWOX with the extensive crosstalk between
the JNK, TNF and NF-�B pathways (86, 87). Interestingly, it has been shown that reactive oxygen
species (ROS) play a role in the induction of apoptosis by regulating the phosphorylation and
ubiquitination of the antiapoptotic Bcl-2 family proteins, resulting in decreased antiapoptotic protein
expression (88). Ectopic expression of Wwox has also been shown to reduce the levels of Bcl-2 and
Bcl-xL (34) in promoting the induction of apoptosis. As Sod1 is involved in the metabolism of ROS and
the abundance levels of this protein have been shown here to be influenced by Wwox expression, this
may provide an explanation as to how WWOX / Wwox reduces the level of the antiapoptotic Bcl-2 family
proteins. The idea of some kind of interaction (direct or indirect) between Wwox and Sod1 at this point
remains highly speculative in nature until further work is done to validate a functional relationship.
However, the significant changes in protein abundance detected here and in the earlier proteomic study
presented in Chapter 4 make this gene / protein the strongest candidate for further study in illuminating
biological processes and pathways in which Wwox acts.
86
5.4.3 Other proteins identified in this study
Those proteins identified in this study that increased in abundance in Wwox1 embryos, other than Sod1,
where CG4279, mRpS23 and Gdi. CG4279 is the Drosophila homolog of the human protein LSM1, an
oncogenic protein involved in mRNA degradation in humans (89). Mitochondrial ribosomal protein S23
(mRpS23) is a ribosomal subunit protein involved in protein synthesis within the mitochondria and in a
microarray study conducted to identify changes in gene expression associated with metastatic
phenotypes of locally advanced cervical carcinomas, mRpS23 was identified in a gene cluster group of
genes associated with oxidative phosphorylation, rapid proliferation, invasiveness, and tumor size (90).
The only other protein identified that was increased in Wwox null embryos was GDP dissociation
inhibitor (GDI1), a class of protein that regulate the GDP-GTP exchange reaction of members of the rab
family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of
molecules between cellular organelles (91).
The three proteins identified that decreased in abundance in Wwox1 embryos were Hel25E, Ef1�48D
and CG17331. The human homolog of Helicase at 25E (Hel25E) is HLA-B associated transcript 1
(BAT1), a member of the DEAD box family of RNA-dependent ATPases that mediate ATP hydrolysis
during pre-mRNA splicing (92). This protein is an essential splicing factor required for association of U2
small nuclear ribonucleoprotein with pre-mRNA, and plays an important role in mRNA export from the
nucleus to the cytoplasm (93). Elongation factor 1alpha48D (Ef1�48D) does not possess a human
homolg, but in Drosophila is the alpha unit of a heterotrimeric protein, elongation factor 1, which
promotes the binding of aminoacyl-tRNA to ribosomes (94). Enhanced expression of Ef1�48D has
been shown to increase the lifespan of mated females in Drosophila (95, 96). The third protein that
decreased in Wwox null embryos was CG17331, of which the mammalian homolog is proteasome
(prosome, macropain) subunit, beta type, 2 (PSMB2 / PsmB2), a member of the proteasome B-type
family, also known as the T1B family, that is a 20S core beta subunit (97).
Taken together, the proteins identified that exhibited significant changes in protein abundance in Wwox1
embryos, other than Sod1, appear to be proteins involved in protein expression, turnover and transport.
Proteins involved in mRNA degradation, mitochondrial protein synthesis and organellular transport
increased in abundance in the absence of Wwox expression, while proteins involved in mRNA export to
the cytoplasm, protein translation and protein degradation showed a decrease in Wwox1 embryos. As all
of these proteins function in quite broad, non-specific molecular and biological processes, they provide
very few clues as to a possible functional role for the WWOX / Wwox protein.
87
5.4.4 Summary
After four rounds of back-crossing Wwox1 flies to w1118, significant changes in protein abundance were
still detectable despite the lack of any observable phenotype. This study demonstrated that proteomic
changes brought about by a lack of Wwox expression are detectable at even the earliest stages of
Drosophila development. As there is no observable phenotype in Wwox null flies, it is highly likely that
redundant pathways and/or processes are altered as a response with certain genes up-regulated and
others down-regulated. However, most of the proteins identified here appear to be involved in broad,
non-specific molecular and biological processes and most likely represent components of the system
that bring about those changes and as such, do not provide any specific information with regards to
Wwox function. Why a greater number of proteins that function in more narrow and specific biological
processes were not identified by this study was certainly due to the known limitations of the 2D-gel /
mass spectrometry technologies employed here. As it is not possible to resolve and detect all proteins
of a given proteome on a 2D gel, studies such as this are only able to analyse a fraction of the proteins
present (namely highly abundant, soluble proteins). As a result, only a small fraction of the proteins that
change in abundance in response to a lack of Wwox expression can be detected.
The single exception was the identification of two isoelectric isoforms of superoxide dismutase 1, that
was the only protein to display significant changes in abundance in Wwox null flies before and after
back-crossing as well as in adult and embryo Drosophila. Both Wwox and Sod1 are known to share
common expression patterns and have both been implicated in the same pathological conditions,
making Sod1 the most interesting and promising target for further research. Unfortunately, no
Drosophila Sod1 antibodies were available to independently test the changes in abundance detected in
this study. However, a number of different Sod1 mutant strains were available making it possible to test
for a genetic interaction between Sod1 and Wwox. As Sod1 represents the only gene / protein likely to
offer any potential insight into Wwox function, more targets need to be identified in order to give a
clearer and potentially more detailed idea of the possible pathways and processes Wwox acts within.
Therefore a much more in-depth proteomic study comparing not only the effects of Wwox ablation but
over-expression may provide a greater number of potential targets offering novel insights into Wwox
function.
88
Chapter 6:
The investigation of proteomic alterations resulting from
changes in Wwox protein levels in Drosophila
89
90
Chapter 6: The investigation of proteomic alterations
resulting from changes in Wwox protein levels in
Drosophila
6.1 Introduction
Large format 2D gels (24cm) are typically capable of resolving around 4000 spots on average. This
represents only a small fraction of the complete Drosophila proteome that is likely to contain well over
50,000 proteins when splice variants and isoelectric isoforms resulting from post-translational
modifications are taken into account. Therefore, a study of this kind is only likely to identify a fraction of
the proteins that change in response to altered levels of Wwox expression. The proteomic analysis of
Drosophila embryos using 2D-DIGE presented in Chapter 5 revealed 11 spots that exhibited significant
changes in response to the lack of Wwox expression. Protein identifications for 8 of these spots
revealed proteins involved in a broad range of biological functions and processes. The small amount of
information obtained from this work therefore made it difficult to ascertain any possible pathways or
processes Wwox may act within. Hence, a study was undertaken comparing the proteomic
consequences resulting not only from a lack of Wwox expression (as examined in Chapters 4 and 5) but
also from the ectopic over-expression of Wwox. The aim of this study being to identify a larger number
of proteins that are altered, either quantitatively and/or qualitatively in response to differing levels of
Wwox expression in Drosophila.
6.1.1 2D DIGE experimental design
The DIGE experiment conducted was designed to examine the proteomic changes resulting from three
different levels of Wwox expression in Drosophila. These being the normal wildtype level of Wwox
expressed (referred to here as endogenous expression / levels), a complete lack of Wwox expression
(referred to as null expression / levels) and the ectopic over-expression of Wwox (referred to as ectopic
expression / levels). As described in Chapter 3, the GAL4-UAS system was employed to express the
open reading frame (ORF) of Wwox. The dauterless (da) promoter driving expression of GAL4 protein
was used to constitutively and ubiquitously over-express Wwox in w1118, Wwox1 and Wwoxf04545 fly lines.
To provide an appropriate control for flies over-expressing Wwox, lines expressing GAL4 protein alone,
in each of the three genetic backgrounds were generated. This was done to address concerns about the
possible proteomic changes brought about by ectopic expression of GAL4 protein in Drosophila (98,
99). Therefore in order to detect proteomic changes in flies over-expressing Wwox, the proteins from
91
these lines would be compared to GAL4 expressing flies. As a result, the following nine genotypes were
generated for this experiment:
Figure 6.1 (below) details each of the genotypes generated for this experiment and outlines the naming
conventions adopted herein when referring to the different genotypes.
Endogenous genotypes
Null genotypes
Ectopic genotypes
w1118
w1118; da>GAL4
Wwox1; da>GAL4
Wwoxf04545; da>GAL4
Wwox1
Wwoxf04545
w1118; da>Wwox
Wwox1; da>Wwox
Wwoxf04545; da>Wwox
GAL4 control
genotypes
92
Figure 6.1. The classification of Drosophila genotypes examined. A. Endogenous genotype (w1118):
represents the wildtype line from which the two Wwox null lines were generated and expresses
endogenous levels of Wwox protein. B. Endogenous-GAL4 genotype (w1118; da>GAL4): expresses
endogenous levels of Wwox as well as ectopic expression of GAL4 protein driven by the daughterless (da)
promoter. C. Endogenous-Ectopic genotype (w1118; da>Wwox): expresses endogenous levels of Wwox as
well as ectopic levels of GAL4 and Wwox protein. D. Null genotypes (Wwox1 and Wwoxf04545): represent
two different Wwox gene disruptants that do not express Wwox protein. E. Null-GAL4 genotypes (Wwox1;
da>GAL4 and Wwoxf04545; da>GAL4): ectopically express GAL4 protein driven by the daughterless (da)
promoter and do not express Wwox protein. F. Null-ectopic genotypes (Wwox1; daWwox and Wwoxf04545;
da>Wwox): only express ectopic levels of Wwox protein.
w1118
A
w1118; da>GAL4
B
w1118; da>Wwox
C
Wwox1
Wwoxf04545
D
Wwox1; da>GAL4
Wwoxf04545; da>GAL4
E
Wwox1; da>Wwox
Wwoxf04545; da>Wwox
F
Endogenous
Endogenous-GAL4
Endogenous-ectopic
Null
Null-GAL4
Null-ectopic
93
6.2 Materials and Methods
6.2.1 Sample preparation
For each fly line, ten age matched male adult flies were collected and protein preparations prepared as
described in Chapter 2.24.1. Protein purification was performed using a PlusOne� 2D clean-up kit (GE
Healthcare) and protein concentrations were estimated using an EZQ protein quantitation kit (Molecular
Probes).
6.2.2 DIGE labelling of protein samples
100μg of each protein preparation was labelled with 200pmoles of Cy Dye as described in Chapter
2.24.2. The protein labelling scheme is outlined in Table 6.1 (below).
Table 6.1 DIGE experimental design for comparison of w1118 flies with three different Wwox
mutants. The letters in parentheses refer to the biological replicate protein sample labelled in this
experiment. The pooled internal standard protein comprised 100μg of a protein pool consisting of
50μg of each of the 28 protein samples used in this study.
Gel Cy2 Standard Cy3 Cy5
1 Pooled Standard Protein w1118 (A) Wwox1; da>GAL4 (C)
2 Pooled Standard Protein Wwox1 (B) Wwoxf04545; da>ORF (C)
3 Pooled Standard Protein Wwox1; da>ORF (A) w1118; da>GAL4 (B)
4 Pooled Standard Protein Wwoxf04545; da>GAL4 (A) w1118; da>ORF (C)
5 Pooled Standard Protein Wwox1; da>GAL4 (B) w1118; da>GAL4 (C)
6 Pooled Standard Protein Wwoxf04545 (A) w1118 (D)
7 Pooled Standard Protein w1118; da>ORF (A) Wwoxf04545 (B)
8 Pooled Standard Protein w1118 (C) Wwox1; da>ORF (B)
9 Pooled Standard Protein Wwox1; da>ORF (C) w1118; da>ORF (B)
10 Pooled Standard Protein Wwox1 (A) w1118 (B)
11 Pooled Standard Protein Wwoxf04545 (C) Wwoxf04545; da>ORF (A)
12 Pooled Standard Protein Wwoxf04545; da>ORF (B) Wwox1; da>GAL4 (A)
13 Pooled Standard Protein Wwoxf04545; da>GAL4 (B) Wwox1 (C)
14 Pooled Standard Protein w1118; da>GAL4 (A) Wwoxf04545; da>GAL4 (C)
94
6.2.3 Electrophoretic separation of proteins
Samples were electrophoretically separated in the first dimension on 24cm pI 3-11 NL IEF strips using
the cup loading method (see Chapter 2.24.4). Isoelectric focusing was performed at 20°C using a
stepwise gradient of 2 hours at 300 V, 2 hours at 500 V, 2 hours at 1000 V, 5 hours from 1000 V to
8000 V, 8000 V until 40,000 volt hours had elapsed, 500 V until stripes were removed. The current was
limited at 50μA per IPG strip. Following equilibration of focused IEF strips, second-dimension SDS-
PAGE was performed (Chapter 2.24.5) using the Ettan� DALTtwelve Large Vertical electrophoresis
system (GE Healthcare), with gels cast using the Ettan� DALTtwelve gel caster (GE Healthcare).
Electrophoresis was performed at 85 V for 25 hours.
6.2.4 Antibody detection (Western blotting)
Western blotting and antibody detection was carried out as described in Chapter 2.25.3, using an anti-
N-DmWWOX primary and anti-Rabbit-HRP secondary antibodies (see Chapter 2.8).
6.2.5 Image analysis
DIGE gels were scanned using a DIGE Scanner (GE Healthcare) and the images analysed using the
DeCyder 2-D Differential Analysis Software v6.5 (GE Healthcare)
6.2.6 Protein identification
Spots of interest were excised from gels using an Ettan� Spot Picker robot (GE Healthcare) employing
a 1.2 mm diameter picker head. Gel pieces containing the same protein spot were pooled and subjected
to reduction, alkylation and in-gel trypsin digestion (Chapters 2.27.2 and 2.27.3 respectively). The
peptide extract was concentrated by centrifugal evaporation to approximately 5μl.
6.2.6.1 Nano-flow-Liquid chromatography-Electro Spray Ionisation-Ion Trap-Mass
Spectrometry (LC-ESI-IT-MS)
One to two microlitres of each sample was diluted to 5.5�l with 1% formic acid in an autosampler vial
and 5�l chromatographed using an Agilent Protein ID Chip column assembly (40 nl trap column with
0�075 x 43 mm C-18 analytical column) housed in an Agilent HPLC-Chip Cube Interface connected to
an a HCT ultra 3D-Ion-Trap mass spectrometer (Bruker Daltonik GmbH). The column was equilibrated
with 4% acetonitrile (ACN) / 0�1% formic acid (FA) at 0�5 �l/min and the samples eluted with an ACN
95
gradient (4%-31% in 32 min). Ionizable species (300 < m/z < 1,200) were trapped and one or two of the
most intense ions eluting at the time were fragmented by collision-induced dissociation (CID).
MS/MS spectra were subjected to peak detection using DataAnalysis (Version 3.4, Bruker Daltonik
GmbH). The MS/MS mass lists were imported into BioTools (Version 3.1, Bruker Daltonik GmbH) and
submitted to the in-house Mascot database-searching engine (Version 2.1, Matrix Science). The
specifications were as follows:
Taxonomy: Drosophila
Database: NCBI non-redundant 20071013 (5546074 sequences, 1918517171 residues)
Enzyme: Trypsin
Fixed modifications: Carbamidomethyl (C)
Variable modifications: Oxidation (M)
Mass tol MS: 0.3 Da
MS/MS tol: 0.4 Da
Peptide charge: 1+, 2+ and 3+
Missed cleavages: 1
Positive protein identifications were assigned on the basis of combined ion scores (calculated by the
software) that exceeded the calculated protein identification threshold, also containing at least two
individual ion scores over the specified peptide ‘identity’ threshold. Protein identifications for proteins for
which combined ion scores exceeding the protein identification threshold but possessing only one
peptide over the peptide ‘identity’ threshold are presented although these assignments are considered
less reliable.
6.2.6.2 MALDI-TOF/TOF MS
A saturated solution of �-cyano-4-hydroxycinnamic acid (HCCA) (Sigma Aldrich) was prepared (HCCA
saturated in acetone : 0.1% TFA, 97 : 3) and applied onto an MTP AnchorChip� 600/384 (Bruker)
target and removed immediately creating an HCCA thin layer over the target points. 1μl of each
concentrated tryptic peptide sample was then applied over the HCCA thin layer and incubated for ~3
minutes. 2μl washing buffer (10mM ammonium phosphate, in 0.1% TFA) was added to the residual
liquid and the whole droplet removed with a pipette tip. Once crystallised, MALDI-TOF mass spectra
were acquired using a Bruker ultraflex III MALDI TOF/TOF mass spectometer (Bruker Daltonics,
Bremen, Germany) operating in reflection mode under the control of the flexControl software (Version
3.0, Bruker Daltonics). External calibration was performed using peptide standards (Bruker Daltonics)
that were analysed under the same conditions. Spectra were obtained randomly over the surface of the
96
matrix spot at laser intensity determined by the operator. A S/N ratio of threshold of 10 was used for
peak selection. Peak masses and intensities of TOF and LIFT spectra were detected with flexAnalysis
(Version 3.0, Bruker Daltonics.
MS and MS/MS spectra were subjected to smoothing, background subtraction and peak detection using
flexAnalysis (Version 3.0, Bruker Daltonik GmbH) using the SNAP algorithm. The spectra and mass lists
were exported to BioTools (Version 3.1, Bruker Daltonik GmbH). Here, the MS and corresponding
MS/MS spectra were combined and submitted to the in-house Mascot database-searching engine
(Matrix Science: http://www.matrixscience.com). The specifications were as follows:
Taxonomy: Drosophila
Database: NCBI non-redundant 20071013 (5546074 sequences, 1918517171 residues)
Enzyme: Trypsin
Fixed modifications: Carbamidomethyl (C)
Variable modifications: Oxidation (M)
Mass tol MS: 50 ppm
MS/MS tol: 0.5 Da
Missed cleavages: 1
Standard Scoring
Positive protein identifications were assigned on the basis of combined ion scores (calculated by the
software) that exceeded the calculated deprecated protein identification threshold.
6.2.6.3 Estimating protein abundance from LC-ESI-IT-MS data using emPAI values
Estimating the relative amounts of individual proteins in proteomic samples was done employing
exponentially modified protein abundance index (emPAI) calculations (100). emPAI values are
calculated from MS spectra data employing the following equation:
Where Nobserved is the number of experimentally observed peptides matched to a given protein and
Nobservable is the calculated number of observable peptides for the same protein. The emPAI values used
in this study were automatically calculated by the Mascot database-searching engine (Matrix Science:
http://www.matrixscience.com). Mascot calculates the number of observed peptides as the number of
peptides matched with scores at or above the homology threshold, while the number of observable
emPAI = 10 — 1
Nobserved
Nobservable
97
peptides is calculated using an estimate of the number of observable peptides based on protein mass,
average amino acid composition of the database and the enzyme specificity. Calculations of protein
content in mole percent was performed using the following equation:
Mol% = emPAI / �(emPAI) x 100 (100)
98
6.3 Results
6.3.1 Proteome changes detected by DIGE
Following isoelectric focussing and SDS-PAGE, each of the DIGE gels were scanned to produce three
independent spot maps corresponding to the Cy2, Cy3 and Cy5 labelled proteins run on each gel. A
total of 42 spot maps were produced in this experiment that were then analysed using the DeCyder 6.5
software suite. A total of 2488 spots were automatically matched across the 14 gels by the software. A
number of independent statistical tests were performed on this data set using the Extended Data
Analysis (EDA) module of the DeCyder software with the aim of identifying proteomic changes resulting
from ectopic-expression as well as Wwox null expression.
6.3.2 Spot changes resulting from null Wwox expression
In order to identify changes in protein abundance resulting from null Wwox expression, individual
statistical tests were performed comparing Wwox null genotypes to endogenous genotypes both with
and without GAL4 expression. A summary of the analysis conducted is presented in Figure 6.2.
Figure 6.2. Summary of the 2D-DIGE analysis conducted comparing endogenous and null fly
genotypes.
2D-DIGE
Spot changes resulting from null expression
16 Spots (Table 6.2)
9 Spots (Table 6.3)
0 Spots in common
MS Identification
w1118
Wwox1
+ Wwox
f04545
w1118; da>GAL4
Wwox1; da>GAL4
+ Wwox
f04545; da>GAL4
99
Master # Ave Ratio T-test Ave Ratio T-test
1 2486 2.7 0.0114 2 0.0138
2 2218 2.15 0.00107 1.64 0.038
3 2485 1.53 0.00374 1.27 0.0433
4 298 1.27 0.00307 1.09 0.0332
5 876 1.25 0.0336 1.36 0.00473
6 1385 1.16 0.0173 1.21 0.000584
7 869 1.14 0.00641 1.18 0.0154
8 879 1.14 0.0303 1.23 0.00679
9 732 1.13 0.00556 1.21 0.000642
10 867 1.1 0.00308 1.08 0.0286
11 769 -1.08 0.0225 -1.24 0.000158
12 1306 -1.12 0.00305 -1.19 0.00831
13 457 -1.24 0.0416 -1.19 0.0425
14 709 -1.24 0.0203 -1.18 0.0161
15 1468 -1.3 0.00635 -1.13 0.0339
16 2484 -2.23 0.00142 -1.53 0.0329
Wwox1
Wwoxf04545
Table 6.2. Spots exhibiting significant changes between endogenous (w1118) and null
(Wwox1 & Wwoxf04545) genotypes. Average ratio protein abundance and student’s T-test
values for each spot are shown. The average ratio values represent the change in protein
abundance observed in Wwox null genotypes relative to endogenous. Spots that exhibited
a 1.2 or � -1.2 fold change in abundance in both null genotypes are highlighted grey.
Master # Ave Ratio T-test Ave Ratio T-test
1 437 1.18 0.00395 1.05 0.0307
2 215 1.17 0.00842 1.12 0.0183
3 1360 1.14 0.0379 1.22 0.0259
4 1383 -1.09 0.0327 -1.17 0.000581
5 1987 -1.1 0.0123 -1.13 0.0136
6 1395 -1.19 0.0174 -1.32 0.0018
7 459 -1.25 0.00818 -1.26 0.0175
8 333 -1.4 0.0364 -1.2 0.0248
9 454 -1.41 0.00305 -1.16 0.0151
Wwox1; da>gal4 Wwox
f04545; da>gal4
Table 6.3. Spots exhibiting significant changes between ectopic-GAL4 (w1118;
da>GAL4) and null-GAL4 (Wwox1; da>GAL4 and Wwoxf04545; da>GAL4) genotypes.
Average ratio protein abundance and student’s T-test values for each spot are shown. The
average ratio values represent the change in protein abundance observed in null-GAL4
genotypes relative to the endogenous-GAL4 genotype. Spots that exhibited a 1.2 or � -1.2
fold change in abundance in both null-GAL4 genotypes are highlighted grey.
100
Comparing endogenous genotypes (w1118) with null genotypes (Wwox1 and Wwoxf04545), a total of 16
spots displayed common changes in abundance between both null genotypes relative to endogenous,
with only 5 displaying a fold change in abundance 1.2 or � -1.2 for both Wwox null genotypes (Table
6.2).
101
6.3.3 Spot changes resulting from ectopic Wwox expression
In order to identify 2D gel spot changes that result from ectopic over-expression of Wwox, individual
statistical tests were performed comparing ectopic genotypes to GAL4 genotypes. This was done
because the expression of GAL4 was shown to alter the proteomic profiles of Drosophila, as
demonstrated in the previous section. A summary of the analysis conducted is presented in Figure 6.3.
Figure 6.3. Summary of the 2D-DIGE analysis conducted that identified spot changes resulting
from ectopic Wwox expression. The individual analysis of ectopic genotypes with GAL4 genotypes is
shown. Comparisons of null-GAL4 and null-ectopic genotypes are outlined in A and C. The comparison
of endogenous-GAL4 and endogenous-ectopic genotypes are outlined in B.
2D-DIGE
Spot changes resulting from ectopic expression
MS Identification
Wwox1; da>GAL4
Wwox1; da>Wwox
16 Spots (Table 6.4)
14 Spots (Table 6.6)
3 in common
5 Spots (Table 6.5)
0 in common
0 in common
A
B C. w1118; da>GAL4
w1118; da>Wwox
Wwoxf04545; da>GAL4
Wwoxf04545; da>Wwox
102
Master # Ave Ratio T-test
1 1074 3.04 0.00194
2 1027 1.6 0.00121
3 1382 1.49 0.00107
4 687 1.48 0.00569
5 699 1.43 0.0185
6 2145 1.31 0.021
7 1060 1.23 0.0416
8 515 1.22 0.00619
9 1387 1.22 0.00409
10 136 -1.23 0.0474
11 2218 -1.23 0.0349
12 334 -1.26 0.0128
13 1022 -1.37 0.0462
14 318 -1.43 0.000907
15 378 -1.57 0.031
16 1055 -2.2 0.00396
Table 6.4. Spots that exhibited significant changes between endogenous-GAL4 and
endogenous-ectopic genotypes. Average ratio protein abundance and student’s T-test
values for each spot are shown. The average ratio values represent the change in protein
abundance observed in endogenous-ectopic flies relative to endogenous-GAL4 flies.
Highlighted in grey are the three spots that also exhibited changes between null-GAL4
(Wwoxf04545; da>GAL4) and null-ectopic (Wwoxf04545; da>Wwox) flies (see Table 6.6).
Master # Ave Ratio T-test
1 1034 1.4 0.0363
2 1808 1.25 0.0449
3 1695 -1.24 0.0233
4 1875 -1.26 0.0474
5 1847 -1.34 0.0116
Table 6.5. Spots that exhibited significant changes between null-GAL4 flies (Wwox1 ;
da>GAL4) and null-ectopic (Wwox1 ; da>Wwox) flies. Average ratio protein abundance and
student’s T-test values for each spot are shown. The average ratio values represent the
change in protein abundance observed in null-ectopic flies relative to null-GAL4 flies.
103
Table 6.6. Spots that exhibited significant changes between null-GAL4 flies (Wwoxf04545;
da>GAL4) and null-ectopic (Wwoxf04545; da>Wwox) flies. Average ratio protein abundance
and student’s T-test values for each spot are shown. The average ratio values represent the
change in protein abundance observed in null-ectopic flies relative to null-GAL4 flies.
Highlighted in grey are the three spots that also exhibited changes between endogenous-GAL4
and endogenous-ectopic genotypes (see Table 6.4).
Master # Ave Ratio T-test
1 1074 2.56 0.0236
2 478 1.24 0.043
3 965 1.21 0.000875
4 607 -1.2 0.0439
5 2219 -1.2 0.0172
6 1678 -1.22 0.0147
7 642 -1.23 0.0358
8 391 -1.35 0.0131
9 1578 -1.38 0.0262
10 1707 -1.38 0.0402
11 378 -1.9 0.0364
12 1448 -2.42 0.0192
13 1055 -2.76 0.0165
14 2103 -2.97 0.0469
104
6.3.4 Detection of Wwox protein in lines over-expressing Wwox
The complete lack of overlap in 2D spot changes between the two null-ectopic genotypes facilitated the
detection of Wwox protein in the remaining protein preparations left over from the DIGE experiment.
Consequently, 10μg of protein from each ectopic genotype protein preparation was subjected to anti-
Wwox antibody detection. Following electrophoresis, proteins were transferred to a nitrocellulose
membrane and probed with anti-Wwox antibody. The amount of Wwox protein present in these samples
was quite low, as a 30 minute exposure time was needed to produce a strong enough signal. Clear
signals at the correct molecular weight for Wwox were detected in each of the replicate protein samples
obtained from the endogenous-ectopic (w1118; da>Wwox) and the null-ectopic genotype Wwoxf04545;
da>Wwox but not in any of the null-ectopic Wwox1; da>Wwox genotype samples (Figure 6.4).
Figure 6.4. Antibody detection of Wwox in protein preparations from ectopic genotypes
analysed in the DIGE experiment. 10μg of each of the remaining protein preparations from
each of the ectopic genotypes were electrophoretically separated on a 7cm precast 4-12%
acrylamide Zoom� gel (Invitrogen), which was transferred to nitrocellulose and probed with an
antibody against the N-terminal region of Wwox. Lanes 1-3 contain protein from each of the
replicate protein samples (A-C) obtained from endogenous-ectopic w1118; da>Wwox flies with
Wwox protein detected at approximately 47 kDa. Lanes 4-6 contain protein from each of the
replicate protein samples (A-C) obtained from Wwox1 ; da>Wwox flies (null-ectopic); no Wwox
protein was detected in these lanes. The final three lanes contain protein from each of the
replicate protein samples (A-C) obtained from Wwoxf04545; da>Wwox flies (null-ectopic); at
approximately 47 kDa Wwox protein was detected in these lanes.
kDa
62
49
38
28
18
A B C A B C A B C
Wwox
105
The apparent lack of Wwox expression in the Wwox1; da>Wwox flies used in this study, was possibly
due to errors made in the generation of this genotype. The generation of each of the ectopic genotypes
produced in this study required the crossing of a da>GAL4 line with a UAS>Wwox line (see Figure 3.1).
If the wrong genotypes were crossed (ie. Wwox1; da>GAL4 x Wwox1; da>GAL4) the resulting genotype
would not express Wwox protein. This may explain the lack of Wwox expression observed for the
Wwox1; da>Wwox flies tested here and shows that Wwox protein expression levels should have been
tested for each of the genotypes tested in this study before the proteomic experiment was conducted.
106
6.3.5 Mass spectrometry detection of protein spots
Mass spectrometry (MS) identification of proteins was conducted on the spots identified that exhibited
significant changes resulting from null Wwox expression (detailed in Chapter 6.3.2) and from ectopic
Wwox expression (Chapter 6.3.3). A summary of the MS analysis conducted is presented in Figure 6.5
below.
Figure 6.5. Summary of the MS analysis workflow and outcomes in the identification of
proteins from spots that exhibited changes resulting from null Wwox expression and ectopic
Wwox expression. * A total of 31 spots were subjected to MS analysis as spot 2218 exhibited
significant changes as a result of both null and ectopic Wwox expression.
Mass Spectrometry (LC-ESI-Ion trap MS)
Spot changes resulting from null expression (Chapter 6.3.2)
Spot changes resulting from ectopic expression (Chapter 6.3.3)
16 Spots (Table 6.4)
Spots excised from DIGE gels
31 Spots* (Figures 6.6 & 6.7)
Single protein ID’s found for 16
spots (Tables 6.7 & 6.8)
Multiple protein ID’s found for 11
spots (Appendix E & F)
No protein ID’s found for 4 spots
16 Spots (Table 6.2)
Quantitative MS analysis
(Chapter 6.3.10) Successful protein IDs for 25 spots (Tables 6.11 & 6.12)
No IDs for 6 spots
107
The spots listed in Tables 6.2 and 6.4 were the focus of this study and comprised a total of 31 spots, the
positions of which are shown in Figures 6.6 and 6.7. These spots were excised from DIGE gels
numbers 4, 6, 10 and 14 (see Table 6.1) and gel pieces containing the same spot pooled and digested
with trypsin. The peptide samples obtained were analysed using Nano flow - Liquid Chromatography -
Electro Spray Ionisation – Ion trap - Mass Spectrometry (referred to herein as LC-ESI-IT-MS). This
method of mass spectrometry was selected, as it is effective in analysing samples containing very low
amounts of protein. It was therefore hoped that proteins comprising the faintest spots on the DIGE gels
could be identified by this method.
6.3.6 LC-ESI-IT-MS protein identification results
From a total of 31 spots analysed, protein identification was unsuccessful for 4 spots (13%) as there
was most likely too little protein present in these spots for successful detection. Of the remaining 27
spots for which positive Mascot identifications were obtained, 16 spots (52%) were found to contain a
single protein species while the remaining 11 (35%) contained between 2 and 8 different proteins. For
reasons of clarity, the MS data for the spots that contained multiple proteins has been omitted from this
section and can be found in Appendix E and F. Additional analysis of the 11 spots that contained
multiple proteins was undertaken to identify the protein species responsible for the changes in
abundance detected by DIGE and is presented in Chapter 6.3.10.
6.3.7 An explanation of the MS/MS data presented
When searching MS/MS data queries against a protein database, the Mascot software assigns each
query a peptide ion score that represents a measure of how well the MS/MS data matches a particular
peptide sequence. For a query to match a given peptide sequence it must receive an ion score that
exceeds a probability based threshold score calculated by Mascot. The numbers in the ‘Queries
Matched’ column of the MS data tables represent the number of MS/MS queries for each spot that were
assigned ion scores matching them to the assigned protein. The numbers in parentheses in this column
represent the number of queries that received ion scores exceeding the peptide ‘identity’ threshold
score. This score indicates a statistical confidence of p <0.05, therefore queries receiving individual ion
scores above the assigned ‘identity’ threshold indicate a statistically high probability of an absolute
match to the assigned peptide. The numbers shown in parentheses in the column headed ‘Combined
MOWSE score’ of the MS data tables, indicate the peptide ‘identity’ threshold score calculated for that
database search. Queries receiving ion scores below the ‘identity’ threshold (p>0.05) have exceeded
108
the lower ‘homology’ threshold score and therefore represent a statistically lower probability of an
absolute match. The ‘combined MOWSE scores’ shown in the MS data tables (numbers not in
parentheses), represent the combined ion scores of all the queries matched to the assigned protein, i.e.
those that passed the ‘identity’ threshold and those that only passed the ‘homology’ threshold. The
combined MOWSE score can therefore be considered a measure of the statistical probability of a
positive match, with higher values generally indicating a greater probability of a match. Similarly, the
sequence coverage values presented in the data tables also give a measure of protein identification
strength. The greater the number of peptides matching to a single protein the lower the probability these
represent random matches as could be the case with just a single peptide. The theoretical and
observed protein molecular mass and pI can be another indication of the likelihood of a positive protein
identification. If these values correlate, it adds strength to the protein identification however, this data
can also provide information as to possible post-translational modifications (PTMs) that may be present
on the protein analysed. If the observed mass of a protein is smaller than the theoretical mass, this may
indicate a cleaved form of the protein has been detected, while differences in the observed and
theoretical pI values can indicate that a protein contains PTMs that have altered it’s pI while not
detectibly changing it’s molecular mass.
109
6.3.8 Protein IDs for spots that contained single proteins and exhibited
changes between endogenous and Wwox null flies
MS analysis of peptides from spots displaying changes between both Wwox null genotypes (Wwox1 and
Wwoxf04545) and endogenous flies (w1118) (Table 6.7) yielded 7 spots that contained a single protein
species. Of these, 4 spots (732, 876, 2218 and 2486) passed the criteria for positive protein
identification with two or more queries that exceeded the Mascot peptide ‘identity’ threshold score
matching to these proteins. The remaining three proteins identified (769, 2484 and 2485) were based on
only a single peptide identified with a score above the Mascot ‘identity’ threshold and as a result these
assignments are considered less reliable.
Table 6.7. MS Identification of proteins from spots that exhibited changes between endogenous and
Wwox null flies by LC-ESI-IT-MS. More detailed MS data is presented in Appendix I (on accompanying CD).
^ Average ratio spot change between both Wwox null genotypes relative to endogenous genotype # Number in parentheses represents the peptide ‘identity’ threshold score * Number in parentheses represents number of queries over the peptide ‘identity’ threshold score
SpotAve.^
RatioAccession Name
Combined#
MOWSE
score
Queries*
Matched
Sequence
coverage
Theoretical mol.
mass (Da)/pI
Observed mol.
mass (Da)/pI
2486 2.35 gi|24664081 Fat body protein 1 630 (35) 18 (9) 20% 119,666 / 6.39 ~47,000 / 5.9
2218 1.90 gi|8647 Cu-Zn superoxide
dismutase
94 (35) 2 (2) 20% 15,974 / 5.67 ~15,000 / 5.5
2485 1.40 gi|8282 Alcohol
dehydrogenase
114 (35) 4 (1) 19% 27,858 / 7.74 ~28,000 / 6.2
876 1.31 gi|20129399 Aldehyde
dehydrogenase
212 (35) 8 (2) 16% 57,325 / 6.37 ~54,000 / 5.4
732 1.17 gi|24649832 CG11089 380 (35) 9 (7) 16% 63,797 / 7.97 ~65,000 / 7.65
769 -1.16 gi|45550132 Hsp60C 88 (35) 3 (1) 6% 61,890 / 6.75 ~60,000 / 5.1
2484 -1.88 gi|8647 Cu-Zn superoxide
dismutase
63 (24) 1 (1) 9% 15,974 / 5.67 ~15,000 / 5.9
110
Figure 6.6. Map of the 2D gel spots excised for MS analysis that exhibited changes between Wwox
null and endogenous genotypes. The DIGE data for these spots is presented in Table 6.2. Blue spot
boundaries indicate those spots that exhibited an increase in protein abundance in the Wwox null
genotypes relative to endogenous genotype. Red spot boundaries indicate those spots that exhibited a
decrease in protein abundance in the Wwox null genotypes relative to endogenous genotype.
130303006 1306 138855 5 555 1385 1468 1468
2218 2218 2 2 248484848444 4 2484
22484444848485 2485
2 2 2 2 2 248484848484 6666 6 2486
44 4 4 4 575757575775 457
7 7 770909099 709 732 732 7 776969699 769 8 88888888 888867676767676767767666666666 867
888 8886696969696969999999 869
8 8888767767766 876
88 87997979 879
~111111111111111110000000~100 k kDaDaDaDaDaDaDaDa kDa
4pI 5 6 8 97
~5~5~5~5~55555500000000000000000000000~50 kkkkkkkkkkkkkkkkkkkk kkk kDaDaDaDaDaDaDaDDaDaDaDaDaaDaDaDaDaDaDaDDaDDD kDa
~~2~2~2~222222555~25 k k kDaDaDa kDa
~1~1~1~10000~10 kDkDkkDakDa
111
6.3.9 Proteins identified in spots that contained single proteins and
exhibited changes between endogenous-GAL4 and endogenous-ectopic
genotypes
MS analysis of peptides from the spots displaying changes between endogenous-GAL4 (w1118;
da>GAL4) and endogenous-ectopic (w1118; da>Wwox) flies (Table 6.8) yielded 9 spots for which only a
single protein species was detected. Four spots (136, 318, 1055 and 1382) passed the criteria for
positive protein identification based on multiple queries that passed the peptide ‘identity’ threshold
matching to these proteins and can therefore be considered highly confident protein IDs. The remaining
5 spots (334, 378, 1022, 1060 and 2145) had protein identifications based on matches to single
peptides with scores above the peptide ‘identity’ threshold, therefore these assignments are considered
less confident.
Table 6.8. MS Identification of proteins from spots that exhibited changes between endogenous-ectopic
and endogenous-GAL4 genotypes. More detailed MS data is presented in Appendix I (on accompanying CD).
^ Average ratio spot change between endogenous-ectopic flies relative to endogenous-GAL4 flies # Number in parentheses represents the peptide ‘identity’ threshold score * Number in parentheses represents number of queries over the peptide ‘identity’ threshold score
SpotAve.^
ratioAccession Name
Combined#
MOWSE
Score
Queries*
Matched
Sequence
coverage
Theoretical mol.
mass (Da)/pI
Observed mol.
mass (Da)/pI
1382 1.49 gi|20129347 Wwox 101 (35) 2 (2) 8% 47052 / 7.19 ~35,000 / 6.10
2145 1.31 gi|20130249 CG2852 45 (32) 1 (1) 9% 22,185 / 8.69 ~20,000 / 6.75
1060 1.23 gi|17136394 Phosphoglycerate
kinase
144 (32) 4 (1) 9% 44,119 / 7.01 ~45,000 / 6.45
136 -1.23 gi|20130403 Tudor-SN 593 (35) 14 (8) 18% 103,436 / 8.14 ~100,000 / 6.5
334 -1.26 gi|21358001 CG14526 60 (35) 3 (1) 5% 79,172 / 5.69 ~80,000 / 5.7
1022 -1.37 gi|21357673 CG5590 57 (32) 2 (1) 5% 44,611 / 8.11 ~46,000 / 7.15
318 -1.43 gi|21357643 CG7470 308 (34) 7 (4) 13% 84,093 / 6.71 ~85,000 / 5.7
378 -1.57 gi|1079042 Acetyl Coenzyme A
synthase
60 (33) 2 (1) 4% 75,946 / 5.44 ~75,000 / 5.45
1055 -2.2 gi|24664081 Fat body protein 1 575 (43) 14 (8) 16% 119,350 / 5.82 ~47,000 / 5.95
112
Figure 6.7. Map of the 2D gel spots excised for MS analysis that exhibited changes between endogenous-
GAL4 and endogenous-ectopic genotypes. The DIGE data for these spots is presented in Table 6.4. Blue spot
boundaries indicate those spots that exhibited an increase in protein abundance in endogenous-ectopic (w1118;
da>Wwox) flies relative to endogenous-GAL4 (w1118; da>GAL4) flies. Red spot boundaries indicate those spots
that exhibited a decrease in protein abundance in endogenous-ectopic flies relative to endogenous-GAL4 flies.
6.3.10 Examination of spots in which multiple proteins were detected
Large format (24cm) 2D gels are typically capable of resolving approximately 4000 distinct proteins
spots per gel and as there are often a far greater number of proteins present in a sample, it is inevitable
that a large number of spots will contain multiple abundant proteins. This occurrence of multiple proteins
in 2D gel spots creates problems regarding the interpretation of data relating to comparative studies of
changes in protein abundance as is presented here. Having determined that a spot has changed in
abundance between two samples, it is important to know what protein(s) contained within the spot are
responsible for the observed change. As spots were first excised directly from the DIGE gels produced
in this study and subjected to LC-ESI-IT-MS, it was not possible to determine which protein(s) present in
spots containing multiple proteins were responsible for the changes in abundance detected using the
1 111 11100000202022 1022
1 1 100020202022227777 7 1027
111111 1 105050500050555 5 5 5 5555555 1055
1 1 106060606066600 0 0 1060
1 1 1 11111363636333 136
1 1 1383822 22 1382 1387 1387
2145 2145
22121212 8 2218
3 3 3 3 3333 81818181818181818 318
333333333 3 3334343434343434343434344444443444343 334
33 3787878 378
55 55 555555515151515151555555555555 515
6 6 6 6 6 6666 6687878787878788787888888 687
6 666666 6699999999999999999999 699
~111111111111111111000000 kkk kDDaDaDaDaDaDaDaDa~100 kDa
4 pI 5 6 8 9 7
~5~5~5~5~555555500000000000000000000000 kDkDkDkDkDkDkDkDkDkDkDkDkDkDkDkDkDkDkDkkDkDDDk aaaaaaaaaaaaaaaaaaaaaa~50 kDa
~2~2~2~2~222222222222222222255 5 kDkDkDaaa~25 kDa
~1~1~1~10000 0 kDkDkDDkDkkDa~10 kDa
113
DIGE analysis software. This created the need to produce a series of preparative gels containing the
protein of single fly line(s) so direct comparisons of the abundances of individual proteins in the same
spot could be ascertained. 12 additional preparative gels were generated in the same way as the DIGE
gels except that each contained 300μg of unlabelled protein from either endogenous, null, endogenous-
GAL4 or endogenous-ectopic genotypes (see Figure 6.9). Quantitative MS methodologies were then
employed to ascertain which protein(s) were responsible for the observed 2D gel spot changes. A
summary of the analysis conducted is presented in Figure 6.8 below.
Figure 6.8. Summary of the quantitative MS analysis workflow employed in the identification of proteins
responsible for the 2D gel spot changes detected via DIGE.
11 Spots found to contain
multiple proteins
Run additional gels containing protein from single genotypes
(Figure 6.7)
Excise spots
MALDI-TOF/TOF-MS
Quantitative Mass Spectrometry
Use calculated emPAI scores to estimate protein abundances (Chapter 6.3.14)
LC-ESI-IT-MS
Use peptide intensity coverage values to estimate protein abundances (Chapter 6.3.11)
Determine most abundant proteins in
each spot
114
Figure 6.9. The experimental workflow for the examination of spots containing multiple
proteins. A. The workflow for the comparison of proteins in endogenous and null 2D gel spot
samples. B. The workflow for the comparison of proteins in endogenous-GAL4 and endogenous-
ectopic 2D gel spot samples. Following excision, gel spots from the same triplicate gel sets
representing the same spot were pooled, digested and analysed via mass spectrometry. Protein
identifications for each spot from the gel sets indicated were then compared.
Endogenous-GAL4 (w1118; da>GAL4)
6 spots cut
6 spots cut
MS
MS
Compare proteins
Endogenous (w1118)
Null (Wwox1 + Wwoxf04545)
5 spots cut
5 spots cut
MS
MS
Compare proteins
Endogenous-ectopic (w1118; da>Wwox)
A
B
115
After SyproRuby� staining, the preparative gels produced were scanned and the images imported into
the DeCyder BVA workspace created in the initial analysis of these genotypes (detailed earlier in this
chapter). After spot matching these gels to the original dataset, ‘pick-lists’ were generated allowing the
spots for which multiple proteins were detected in the previous study to be excised by the robot spot
picker. Again, gel pieces containing the same spot, from gels containing protein from the same
genotype were pooled and digested for MS analysis (see Chapter 2.27). A total of 11 different spots
were analysed in which two different quantitative MS methodologies were used. A combination of a
MALDI-TOF/TOF-MS based method and an LC-ESI-IT-MS method was used to analyse these samples,
the details of which are presented in Chapters 6.3.11 and 6.3.14. The reason for using these two
different methods was to provide the greatest chance of identifying the protein(s) responsible for the 2D
gel spot changes, as some peptides typically ionise differently given different MS methods (101, 102).
Using two different MS approaches thus increases the chances of obtaining a positive protein
identification as a greater number of peptides can potentially be identified than could be identified using
any single MS approach.
6.3.11 Protein abundance estimation using MALDI peptide intensity coverage
values
The first quantitative MS methodology employed involved using MALDI peptide spectra intensity values
to estimate protein abundances. This method involved comparing the MALDI mass spectra from 2D gel
spots that each contained protein from a single genotype of fly. Where spots contain peptides from
multiple proteins, the measured peptide intensity values (which are roughly proportional to the amount
of the peptide present) can be used to estimate the most abundant protein present. Comparing 2D gel
spots containing protein from different genotypes would also make it possible to see whether the
proteins that comprise a spot are not just changing in their relative abundances but wether they are
different between the genotypes of interest. The intensity coverage values presented in the data tables
of this section represent the percentage of total ion intensities the ions matched to a particular protein
represent and therefore represent an estimate of relative peptide intensities. The ratios of peptide
intensity coverage values are presented allowing the comparrison of the relative abundances of
particular proteins between different samples.
116
6.3.12 MALDI-TOF/TOF-MS estimation of protein abundances in endogenous
and null 2D gel spot samples
A total of 10 samples that contained peptides from 5 different spots were analysed by MALDI-TOF/TOF-
MS. 5 samples contained peptides from spots excised from gels containing endogenous (w1118) protein
and another 5 from gels that contained Wwox null protein (Wwox1 and Wwoxf04545). Protein
identifications were obtained for 8 of the 10 samples analysed, with no peptide data obtained for spot
457. Of the 8 samples for which protein identifications were obtained (spots 867, 879, 1385 and 1468),
only 3 were found to contain multiple proteins (Wwox null spots 867, 879 and endogenous spot 1385)
underlining the decreased sensitivity of MALDI-TOF analysis. Each of the proteins identified however,
matched to the top two proteins identified in the earlier LC-ESI-IT-MS study. Surprisingly, no proteins
were identified in both spot 457 samples, for which 25 peptides were matched to 4 different proteins in
the previous study (Appendix E).
Peptide spectra intensity coverage ratios were calculated for each of the proteins identified in samples
that contained multiple proteins. Only one sample, Wwox null spot 879 was found to contain a single
protein (aldehyde dehydrogenase) with a significantly higher intensity coverage ratio than that of the
other proteins identified in the sample. The Wwox null spot 867 sample, for which 4 proteins were
identified, contained two proteins (CG7430 and CG31075) exhibiting similar intensity coverage ratios
(5.5 and 5.7 respectively), that were significantly higher than the other two proteins suggesting they may
have been in equal abundance in this sample. Similarly, The two isoforms of CG6084 detected in
endogenous spot 1385, contained very similar peptide spectra intensity values also suggesting similar
abundances of these two proteins.
117
Table 6.9. Protein identifications for spots in which multiple proteins were detected by LC-ESI-IT-MS
using MALDI-TOF/TOF. For each spot, spectra were obtained from samples containing protein from
endogenous and Wwox null flies. The data obtained from genotypes that exhibited an increase in protein
abundance are shaded grey. More detailed MS data is presented in Appendix I (on accompanying CD).
* Numbers in parentheses refer to the number of peptides with ion scores over the identity threshold # Numbers in parentheses represents the protein identification threshold score
SpotProtein
SampleAccession Name MOWSE#
Score
Queries*
Matched
Seq
Coverage
Intensity
coverage
Intensity
Coverage
Ratio
Endogenous - - - - - - -
Wwox Null - - - - - - -
Endogenous gi|21358499 CG7430 123(60) 19(0) 43% 31.3% -
gi|21358499 CG7430 192(60) 15(3) 34% 24.8% 5.5
gi|24650465 CG31075 135(60) 16(2) 36% 25.7% 5.7
gi|11033 miniparamyosin 86(60) 19(0) 52% 4.5% 1
gi|24661120 Paramyosin 80(60) 21(0) 43% 4.8% 1.1
Endogenous gi|20129399Aldehyde
dehydrogenase122(60) 12(1) 7% 40.9% -
gi|24650465 CG31075 294(60) 17(4) 37% 19.6% 2.2
gi|20129399Aldehyde
dehydrogenase175(60) 10(2) 18% 49.4% 5.4
gi|21358499 CG7430 81(60) 17(0) 36% 9.0% 1
gi|24662785 CG6084 isoform B 107(60) 14(0) 38% 5.2% 1.2
gi|24662781 CG6084 isoform A 84(60) 11(0) 31% 6.1% 1
Wwox Null gi|157561
sn-glycerol-3-
phosphate
dehydrogenase
80(60) 7(0) 26% 5.7% -
Endogenous gi|24647881 CG7998-PA 96(60) 12(0) 33% 12.3% -
Wwox Null gi|24647881 CG7998-PA 175(60) 10(2) 30% 11.8% -
45
71
38
51
46
88
67
Wwox Null
87
9
Wwox Null
Endogenous
118
6.3.13 MALDI-TOF/TOF-MS estimation of protein abundances in Endogenous-
GAL4 and Endogenous-ectopic 2D gel spot samples
A total of 12 samples that contained peptides from 6 different spots were analysed by MALDI-TOF/TOF-
MS. 7 samples contained peptides from spots excised from gels containing w1118; da>GAL4 protein and
another 7 from gels that contained w1118; da>Wwox protein. Protein identifications were obtained for 12
of the 14 samples analysed, with no peptide data obtained for the w1118; da>GAL4 sample for spots
1382 and 1387. However protein identifications were possible for all 7 spots examined. Multiple protein
species were detected in 7 of the 14 samples analysed, corresponding to 4 different spots, although
fewer proteins were detected in these samples than were observed in the DIGE gel samples analysed
by LC-ESI-IT-MS. 3 of the 4 spots with multiple proteins detected were found to contain the proteins that
matched the top two protein hits recorded from the DIGE gel samples, with the w1118; da>Wwox sample
for spot 1074 found to contain Fat body protein 1 (Fbp1) and Wwox as the top two hits, neither of which
were detected in the DIGE gel sample analysed earlier. This was the first time Wwox protein had been
detected using mass spectrometry although the peptide spectra intensity coverage ratio of Fbp1 was far
greater than that of Wwox suggesting it was a minor protein component in this sample. Also of interest
was the detection of Wwox protein in the w1118; da>Wwox sample for spot 1382, which was of a much
lower molecular weight (~35kDa) than that of the full length protein (~47kDa). The identification of Wwox
in this sample was highly significant with 16 queries matched to this protein, one peptide with MS/MS
data exceeding the identity threshold and 43% peptide fingerprint coverage. The intensity coverage
ratios for proteins within multi protein samples again provided few instances where a single protein
species appeared more abundant. The w1118; da>Wwox sample for spot 699 revealed a 2.4 : 1 intensity
coverage ratio for malic enzyme to malate dehydrogenase suggesting the former to be the more
abundant protein of the two. As mentioned earlier, Fbp1 detected in the w1118; da>Wwox sample for
spot 1074 exhibited the highest intensity coverage ratio difference calculated for this entire study of 22.5
compared to 3.8 for Wwox thus clearly identifying this protein to be the most abundant in this sample.
The intensity coverage ratio values obtained for the proteins contained in the samples for spots 1027
and 515 were far less informative in regards to relative protein abundances with more than one protein
exhibiting greater yet similar peptide spectra intensity values.
119
Table 6.10. Protein identifications for spots in which multiple proteins were detected by LC-ESI-IT-MS
using MALDI-TOF/TOF. For each spot, spectra were obtained from samples containing protein from
endogenous-GAL4 and endogenous-ectopic flies. The data obtained from fly lines that exhibited an increase in
protein abundance are shaded grey. More detailed MS data is presented in Appendix I (on accompanying CD).
* Numbers in parentheses refer to the number of peptides with ion scores over the identity threshold # Numbers in parentheses represents the protein identification threshold score
SpotProtein
SampleAccession Name
Combined#
MOWSE
Score
Queries*
Matched
Seq
Coverage
Intensity
coverage
Intensity
Coverage
Ratio
gi|19921864 CG8193 207 (60) 29 (1) 36% 23.9% 1.8
gi|24643010 Transferrin 1 190 (60) 24 (0) 38% 13.4% 1
gi|13774118 prophenol oxidase A3 141 (60) 21 (1) 25% 20.1% 1.5
gi|19921864 CG8193 276 (60) 30 (2) 52% 31.6% 1.3
gi|24643010 Transferrin 1 255 (60) 25 (2) 46% 24.4% 1
gi|13774118 prophenol oxidase A3 163 (60) 18 (2) 32% 26.9% 1.1
GAL4-control gi|24655582 CG7461 94 (60) 15 (0) 30% 9.0% -
Ectopic gi|7248650 malic enzyme 172 (60) 20 (2) 43% 6.6% -
gi|6634090malate
dehydrogenase121 (60) 23 (0) 37% 18.1% 1.3
gi|7248650 malic enzyme 87 (60) 22 (0) 38% 14.3% 1
gi|7248648 malic enzyme 84 (60) 24 (0) 32% 14.8% 1
gi|7248650 malic enzyme 250 (60) 21 (1) 41% 36.7% 2.4
gi|6634090malate
dehydrogenase60 (60) 14 (0) 27% 15.2% 1
gi|20129399Acetaldehyde
dehydrogenase186 (60) 11 (2) 19% 26.6% 2.4
gi|161511955aldehyde
dehydrogenase178 (60) 10 (2) 14% 35.9% 3.3
gi|24664085Fat body protein 1
isoform B120 (60) 32 (0) 23% 35.9% 3.3
gi|21358499 CG7430 60 (60) 13 (1) 29% 10.9% 1
gi|24664081Fat body protein 1
isoform A111 (60) 31 (0) 23% 36.1% 3.3
gi|24664085Fat body protein 1
isoforms A &/or B311 (60) 30 (2) 31% 68.3% 3.3
gi|7961 Fat body protein 1 280 (60) 24 (2) 24% 61.9% 3
gi|27819874 LP07910p 70 (60) 12 (0) 24% 20.5% 1
GAL4-control gi|11176phosphoglycerate
kinase66/60 10 (0) 27% 14.2% -
gi|24664081 Fat body protein 1 483/60 40 (6) 33% 53.9% 22.5
gi|20129347 Wwox 155/60 19 (1) 45% 9.2% 3.8
gi|111144749phosphoglycerate
kinase87/60 11 (1) 31% 2.4% 1
GAL4-control - - - - - - -
Ectopic gi|157476glyceraldehyde-3-
phosphate
dehydrogenase
72/60 7 (0) 19% 12.8% -
51
5
GAL4-control
Ectopic
68
76
99
GAL4-control
Ectopic
10
27
GAL4-control
Ectopic
10
74
Ectopic
13
87
120
6.3.14 Comparison of protein identifications from spots obtained from DIGE
gels and gels containing single fly line proteins
Following MALDI-TOF/TOF analysis, there was a small quantity of peptide sample remaining for several
of the spots analysed. The available samples that contained protein from genotypes that exhibited an
increase in abundance for a given spot (samples shaded grey in Tables 6.9 and 6.10) were analysed
using LC-ESI-IT-MS. These samples were analysed since the most abundant proteins in multi-protein
DIGE gel spots should be those proteins found to be the most abundant in the samples that exhibited
the highest standardised abundance. Therefore by calculating the percent protein content of the various
proteins in spots from fly lines that displayed the highest abundance, it would be possible to ascertain
the protein(s) responsible for the observed change in abundance. Calculating the percent protein
content of the various proteins in spots can thus allow a number of different tests to be carried out.
Firstly, this methodology could be employed to assess the validity of using MALDI-TOF/TOF intensity
coverage values as a crude measure of protein abundance. In addition this method could help verify
some of the results obtained by MALDI-TOF/TOF-MS and to test whether the most abundant proteins in
DIGE gel samples are the same as those responsible for the observed spot changes. In order to do this,
protein abundances were calculated using the ‘emPAI’ methodology described in Chapter 6.2.6.3.
Given the very small quantities of peptide samples remaining after MALDI-TOF/TOF analysis, detection
of proteins using LC-ESI-IT-MS was successful for only 8 different spots (515, 699, 867, 879, 1027,
1468, 1382 and 2218). The mole percentage of each detected protein in these samples was calculated
with the results presented in Figure 6.10 that shows the relative amounts of proteins present in these
samples as well as the relative amounts of different proteins detected in the DIGE gel samples analysed
earlier. The data used to construct each of the graphs presented in Figure 6.10 is located in Appendix
G. All of the samples analysed confirmed the protein identifications obtained by MALDI-TOF/TOF
analysis (Appendix G). The most abundant proteins in samples that exhibited DIGE increases in
abundance were not found to be the most abundant in the DIGE gel derived samples as can be seen in
each of the graphs in Figure 6.10, except for spot 1468 that showed the same protein (CG7998) to be
the most abundant protein in both samples. It is important to note that the molar percentages of Fat
body protein 1 (Fbp1) calculated for spot 1027 are certainly under representative of the level of this
protein. This is due to the fact that the NCBI database used in the Mascot database search only
contains full length protein sequence, but the molecular weight of the 2D spots examined correlate with
reported post-translationally modified forms of this protein (103). Therefore, the value obtained for the
number of observable peptides used in the calculation of emPAI (shown above) for the full length Fbp1
protein (~119 kDa) is likely to be at least twice the size of the actual number of observable peptides for
the protein observed on the 2D gels (~48 kDa). As a result, the protein abundances calculated for spot
1027 shown in Figure 6.10 and Appendix G are likely to represent about half the protein present.
121
Interestingly, the top hit proteins for 4 out of 6 multi-protein spots were the same in both DIGE and
single sample spots examined (spots 515, 699, 867 and 1468). Comparing results obtained using
MALDI with LC-ESI-IT-MS, the protein with the highest MALDI peptide intensity coverage matched the
most abundant protein(s) calculated from LC-ESI-IT-MS data for 5 spots (515, 699, 867, 1027 and
1468). Similarly, the first hit protein obtained using MALDI matched to the most abundant protein(s)
calculated from LC-ESI-IT-MS data for 5 spots (515, 699, 879, 1027 and 1468).
Figure 6.10. Comparison of percent protein content for each protein in 6 different spots (A-
F) containing multiple proteins obtained from DIGE gels and gels containing proteins from
single fly lines. The mole percentages (based on emPAI values) and Mascot hit rankings for
each protein are shown with colour coded protein identities listed in the accompanying legend of
each graph. The red * label above pyramids denotes the protein with the highest intensity
coverage value identified by MALDI-TOF/TOF. The blue # label above pyramids denotes the
Mascot top hit protein identified by MALDI-TOF/TOF. The green ‡ label indicates protein
abundances likely to be highly underestimated due to emPAI values used not calculated from the
smaller post-translationally modified form of the protein detected. More detailed MS data is
presented in Appendix I (on accompanying CD).
Composite fly genotype protein
sample (DIGE gel)
Wwox null fly protein only
1st hit 2nd hit
3rd hit 4th hit
5th hit
0 10 20 30 40 50 60 70
mo
l%
Sample Type
Spot 879
Aldehyde dehydrogenase
CG31075
CG7430
Thioredoxin reductase-1
upheld
MOWSE Score Rankings
*
#
A
122
1st hit
2nd hit
3rd hit
4th hit
0 5
10 15 20 25 30 35 40
mo
l%
Sample Type
MOWSE score rankings
Spot 867
CG31075
CG7430
Paramyosin
Bellwether
Composite fly genotype protein
sample (DIGE gel)
Wwox null fly protein only
*
#
1st hit 2nd hit
3rd hit
0
10
20
30
40
50
60
mo
l%
Sample Type
MOWSE Score Ranking
Malic enzyme
Malate dehydrogenase
Phosphoglucomutase
CG7461
Composite fly
genotype protein sample
(DIGE gel)
w1118
; da>Wwox fly protein only
Spot 699
* #
B
C
123
1st hit 2nd hit 3rd hit 4th hit 5th hit 6th hit 7th hit 8th hit
0
5
10
15
20
25
mo
l
%
MOWSE Score Rankings
Spot 1027
Fat body protein 1 isoforms A ‡ &/or B
CG7430
Fat body protein 1 (gi/7961) ‡
Phosphogluconate dehydrogenase
Rpt1
Troponin T-5 CG9510
Aldehyde dehydrogenase
CG31075
Thioredoxin reductase-1 splice variant
CG32351
S-adenosyl-L-homocysteine hydrolase
Endolase
Composite fly genotype protein
sample (DIGE gel)
w1118
; da>Wwox fly protein only
‡
‡
‡
‡ * #
mo
l%
Sample Type
MOWSE Score Ranking
Spot 515
Transferrin 1
Lethal (2) k05713
Hrp59
Composite fly genotype protein
sample (DIGE gel)
0
10
20
30
40
50 60
70
CG8193
w1118
;da>Wwox fly protein only
1st hit 2nd hit
3rd hit 4th hit
#
*
D
E
124
6.3.15 Protein Identification summary
Detailed below in Tables 6.11 and 6.12 is a summary of the proteins identified as having displayed
changes detected via the DIGE analysis conducted in this study.
1st hit
2nd hit
0
10
20
30
40
50
60
70
80
90
100
Composite fly genotype protein
sample (DIGE gel)
w1118
fly protein only
MOWSE Score Ranking
Sample Type
CG7490
CG15093 (isoform B)
CG7998
mo
l%
Spot 1468
* #
F
125
Sp
ot
Nam
eH
um
an H
om
olo
gL
oca
lisat
ion
Mo
lecu
lar
fun
ctio
nB
iolo
gic
al P
roce
ss
457
--
--
-
709
--
--
-
732
CG
1108
9A
TIC
?IM
P c
yclo
hydr
olas
e ac
tivity
;
phos
phor
ibos
ylam
inoi
mid
azol
ecar
boxa
mid
e
form
yltr
ansf
eras
e ac
tivity
purin
e ba
se m
etab
olis
m; p
urin
e nu
cleo
tide
bios
ynth
esis
769
Hsp
60C
HS
PD
1 (c
hape
roni
n)m
itoch
ondr
ion
AT
Pas
e ac
tivity
, cou
pled
; AT
P b
indi
ng; u
nfol
ded
prot
ein
bind
ing
prot
ein
fold
ing;
pro
tein
ref
oldi
ng; r
espo
nse
to s
tres
s; 'd
e
novo
' pro
tein
fold
ing;
pro
tein
targ
etin
g to
mito
chon
drio
n
867
CG
3107
5A
ldeh
yde
dehy
drog
enas
e
1B1
(ALD
H1B
1)m
itoch
ondr
ion
alde
hyde
deh
ydro
gena
se (
NA
D)
activ
itypy
ruva
te m
etab
olis
m; a
min
o ac
id c
atab
olis
m
869
--
--
-
876*
Ald
ehyd
e
deh
ydro
gen
ase
Ald
ehyd
e de
hydr
ogen
ase
2 (A
LDH
2)m
itoch
ondr
ion
alde
hyde
deh
ydro
gena
se (
NA
D)
activ
itypy
ruva
te m
etab
olis
m
879
CG
3107
5A
ldeh
yde
dehy
drog
enas
e
1B1
(ALD
H1B
1)m
itoch
ondr
ion
alde
hyde
deh
ydro
gena
se (
NA
D)
activ
itypy
ruva
te m
etab
olis
m; a
min
o ac
id c
atab
olis
m
1306
--
--
-
1385
Gly
cero
l 3
ph
osp
hat
e
deh
ydro
gen
ase
Gly
cero
l 3 p
hosp
hate
dehy
drog
enas
e 1
(GP
D1)
cyto
sol
glyc
erol
-3-p
hosp
hate
deh
ydro
gena
se (
NA
D+
)
activ
ity; N
AD
bin
ding
glyc
erol
-3-p
hosp
hate
met
abol
ic p
roce
ss; t
riacy
lgly
cero
l
met
abol
ic p
roce
ss; g
lyce
roph
osph
ate
shut
tle; l
ipid
met
abol
ic
proc
ess;
car
bohy
drat
e m
etab
olic
pro
cess
; gly
cero
l-3-
phos
phat
e ca
tabo
lic p
roce
ss.
1468
CG
7998
mal
ate
dehy
drog
enas
e 2
(MD
H2)
mito
chon
drio
nL-
mal
ate
dehy
drog
enas
e ac
tivity
; L-la
ctat
e
dehy
drog
enas
e ac
tivity
tric
arbo
xylic
aci
d cy
cle;
gly
coly
sis;
mal
ate
met
abol
ic
proc
ess.
2218
*S
up
ero
xid
e
dis
mu
tase
Sup
erox
ide
dism
utas
e 1
(SO
D1)
cyto
plas
mco
pper
, zin
c su
pero
xide
dis
mut
ase
activ
ity;
antio
xida
nt a
ctiv
ity; m
etal
ion
bind
ing
rem
oval
of s
uper
oxid
e ra
dica
ls; d
eter
min
atio
n of
adu
lt lif
e
span
; agi
ng; s
uper
oxid
e m
etab
olic
pro
cess
; def
ense
resp
onse
2484
*S
uper
oxid
e di
smut
ase
Sup
erox
ide
dism
utas
e 1
(SO
D1)
cyto
sol
copp
er, z
inc
supe
roxi
de d
ism
utas
e ac
tivity
;
antio
xida
nt a
ctiv
ity; m
etal
ion
bind
ing
rem
oval
of s
uper
oxid
e ra
dica
ls; d
eter
min
atio
n of
adu
lt lif
e
span
; agi
ng; s
uper
oxid
e m
etab
olic
pro
cess
; def
ense
resp
onse
2485
*A
lco
ho
l
deh
ydro
gen
ase
-F
atbo
dyal
coho
l deh
ydro
gena
se a
ctiv
ityet
hano
l oxi
datio
n; b
ehav
iora
l res
pons
e to
eth
anol
.
2486
*F
at b
od
y p
rote
in 1
-F
at b
ody
prot
ein
tran
spor
ter
activ
ity; o
xyge
n tr
ansp
orte
r
activ
ityst
orag
e pr
otei
n im
port
into
fat b
ody.
Ta
ble
6.1
1. S
um
ma
ry o
f b
iolo
gic
al fu
nctio
ns f
or
pro
tein
s t
ha
t d
isp
laye
d c
ha
ng
es in
ab
un
da
nce
be
twe
en
w1
11
8 a
nd
Ww
ox n
ull
flie
s.
Pro
tein
s s
ho
wn
in
bo
ld f
on
t e
xh
ibite
d a
n in
cre
ase
in
ab
un
da
nce
in
Ww
ox n
ull
file
s r
ela
tive
to
w1
11
8.
*Spo
ts th
at e
xhib
ited
>1.
5 fo
ld c
hang
es in
abu
ndan
ce
126
Sp
ot
Nam
eH
um
an H
om
olo
gL
oca
lisat
ion
Mo
lecu
lar
fun
ctio
nB
iolo
gic
al P
roce
ss
136
Tud
or-S
N
SN
D1
?tr
ansc
riptio
n co
activ
ator
act
ivity
; nuc
leas
e
activ
ity; n
ucle
ic a
cid
bind
ing
tran
scrip
tion
from
RN
A p
olym
eras
e II
prom
oter
318
CG
7470
Ald
ehyd
e de
hydr
ogen
ase
18A
1 (A
LDH
18A
1)
mito
chon
drio
n
cyto
plas
m
delta
1-py
rrol
ine-
5-ca
rbox
ylat
e sy
nthe
tase
activ
ity; g
luta
mat
e 5-
kina
se a
ctiv
ity; g
luta
mat
e-5-
sem
iald
ehyd
e de
hydr
ogen
ase
activ
ity.
prol
ine
bios
ynth
esis
334
CG
1452
6en
doth
elin
con
vert
ing
enzy
me-
like
1 (E
CE
L1)
plas
ma
mem
bran
een
doth
elin
-con
vert
ing
enzy
me
activ
ity; n
epril
ysin
activ
ity; z
inc
ion
bind
ing
prot
eoly
sis;
sig
nal t
rans
duct
ion.
378*
Ace
tyl C
oenz
yme
A
synt
hase
acyl
-CoA
syn
thet
ase
shor
t-
chai
n fa
mily
mem
ber
2
(AC
SS
2)
cyto
sol
acet
ate-
CoA
liga
se a
ctiv
ity; A
MP
bin
ding
met
abol
ism
; fat
ty a
cid
met
abol
ism
515
--
-
687
Mal
ic e
nzy
me
mal
ic e
nzym
e 3
NA
DP
(+)-
depe
nden
t (M
E3)
mito
chon
drio
nm
alat
e de
hydr
ogen
ase
(oxa
loac
etat
e-
deca
rbox
ylat
ing)
(N
AD
P+
) ac
tivity
; NA
D b
indi
ngtr
icar
boxy
lic a
cid
cycl
e; m
alat
e m
etab
olis
m
699
Mal
ic e
nzy
me
mal
ic e
nzym
e 3
NA
DP
(+)-
depe
nden
t (M
E3)
mito
chon
drio
nm
alat
e de
hydr
ogen
ase
(oxa
loac
etat
e-
deca
rbox
ylat
ing)
(N
AD
P+
) ac
tivity
; NA
D b
indi
ngtr
icar
boxy
lic a
cid
cycl
e; m
alat
e m
etab
olis
m
1022
CG
5590
hydr
oxys
tero
id
dehy
drog
enas
e lik
e 2
(HS
DL2
)
? o
xido
redu
ctas
e ac
tivity
, act
ing
on th
e C
H-O
H
grou
p of
don
ors,
NA
D o
r N
AD
P a
s ac
cept
or;
ster
ol c
arrie
r ac
tivity
met
abol
ism
1027
*F
at b
od
y p
rote
in 1
-F
at b
ody
prot
ein
tran
spor
ter
activ
ity; o
xyge
n tr
ansp
orte
r
activ
ityst
orag
e pr
otei
n im
port
into
fat b
ody.
1055
*F
at b
ody
prot
ein
1-
Fat
bod
ypr
otei
n tr
ansp
orte
r ac
tivity
; oxy
gen
tran
spor
ter
activ
ityst
orag
e pr
otei
n im
port
into
fat b
ody.
1060
Ph
osp
ho
gly
cera
te
kin
ase
phos
phog
lyce
rate
kin
ase
1
(PG
K1)
cyto
sol
phos
phog
lyce
rate
kin
ase
activ
ity; c
arbo
hydr
ate
kina
se a
ctiv
itygl
ycol
ysis
; pho
spho
ryla
tion
1074
*F
at b
od
y p
rote
in 1
-F
at b
ody
prot
ein
tran
spor
ter
activ
ity; o
xyge
n tr
ansp
orte
r
activ
ityst
orag
e pr
otei
n im
port
into
fat b
ody.
1382
Ww
ox
WW
OX
cyto
sol /
mito
chon
dria
oxid
ored
ucta
se a
ctiv
ity, a
ctin
g on
CH
-OH
gro
up
of d
onor
s.ap
opto
sis;
met
abol
ic p
roce
ss
1387
Gly
cera
ldeh
yde
3
ph
osp
hat
e
deh
ydro
gen
ase
1
Gly
cero
l 3 p
hosp
hate
dehy
drog
enas
e 1
(GP
D1)
cyto
sol
glyc
erol
-3-p
hosp
hate
deh
ydro
gena
se (
NA
D+
)
activ
ity; N
AD
bin
ding
glyc
erol
-3-p
hosp
hate
met
abol
ic p
roce
ss; t
riacy
lgly
cero
l
met
abol
ic p
roce
ss; g
lyce
roph
osph
ate
shut
tle; l
ipid
met
abol
ic
proc
ess;
car
bohy
drat
e m
etab
olic
pro
cess
; gly
cero
l-3-
phos
phat
e ca
tabo
lic p
roce
ss.
2145
CG
2852
pept
idyl
prol
yl is
omer
ase
B
(cyc
loph
ilin
B)
endo
plas
mic
retic
ulum
pept
idyl
-pro
lyl c
is-t
rans
isom
eras
e ac
tivity
defe
nse
resp
onse
; pro
tein
fold
ing;
pro
tein
targ
etin
g
2218
Sup
erox
ide
dism
utas
eS
uper
oxid
e di
smut
ase
1
(SO
D1)
cyto
sol
copp
er, z
inc
supe
roxi
de d
ism
utas
e ac
tivity
;
antio
xida
nt a
ctiv
ity; m
etal
ion
bind
ing
rem
oval
of s
uper
oxid
e ra
dica
ls; d
eter
min
atio
n of
adu
lt lif
e
span
; agi
ng; s
uper
oxid
e m
etab
olic
pro
cess
; def
ense
resp
onse
Tab
le 6
.12. S
um
mary
of bio
logic
al fu
nctions for
pro
tein
s that dis
pla
yed c
hanges in a
bundance b
etw
een w
1118; dagal4
flie
s a
nd w
1118; da>
Ww
ox flie
s.
Pro
tein
s s
how
n in b
old
font exhib
ited a
n incre
ase in a
bundance in w
1118; da>
Ww
ox file
s r
ela
tive to w
1118; da>
gal4
flie
s.
*Spo
ts th
at e
xhib
ited
>1.
5 fo
ld c
hang
es in
abu
ndan
ce
127
128
6.4 Discussion
6.4.1 2D DIGE analysis of proteomic changes
In this study, the quantitative analysis of almost 2,500 resolved and detected protein spots across
multiple gels containing protein from nine different fly lines and comprising three different experimental
groups was achieved. The overall aim of this study was to identify proteins that exhibit quantitative
and/or qualitative changes resulting from a lack of Wwox expression or in response to the ectopic over-
expression of Wwox. It was expected that mass spectrometry identification of the proteins that comprise
these spots could help elucidate possible biological pathways and processes that WWOX / Wwox may
be involved in. Overall, relatively small numbers of spots were identified that exhibited statistically
significant changes in abundance between the fly lines compared in this study. As observed in the
earlier DIGE studies presented in chapters 4 and 5, only modest changes in protein abundance were
observed among the spots identified with a 3.04 fold change being the largest observed.
The comparison of proteins derived from Wwox null flies to endogenous fly proteins revealed a total of
16 spots that exhibited a statistically significant change in abundance common to both Wwox null
genotypes compared to endogenous with only 5 of those exhibiting changes greater that 1.2 fold. The
comparison of proteins derived from null-GAL4 flies to endogenous-GAL4, revealed a total of 9 spots
that exhibited significant changes in abundance common to both null-GAL4 genotypes compared to
endogenous-GAL4, with only 2 exhibiting changes greater that 1.2 fold. There were no common
changes in protein abundance detected between the spots that exhibited changes between endogenous
and both null genotypes and the spots exhibiting changes between endogenous-GAL4 and both null-
GAL4 genotypes. This can be seen by a comparison of the spots in Tables 6.2 and 6.3 that show there
were no spots in common between the two groups. These differences in protein profile were most likely
brought about by alterations in biochemistry resulting from the ectopic expression of GAL4 protein. This
outcome was not unforseen (98, 99), as it formed the basis for including the GAL4 genotypes to act as
an appropriate control for those flies expressing GAL4 and Wwox (ectopic genotypes).
However, the analysis of protein changes resulting from ectopic Wwox over-expression did present
some unexpected results. The comparison of endogenous-GAL4 flies to endogenous-ectopic flies
(Table 6.4) revealed significantly more spot changes than the null-GAL4 flies compared to null-ectopic
flies (Tables 6.5 and 6.6). This disparity may have been brought about by the slightly different genetic
backgrounds of the lines being compared (i.e. endogenous compared to Wwox null). Even more
surprising was the lack of spots that displayed shared changes in abundance between Wwox1;
129
da>GAL4 compared to Wwox1; da>Wwox and Wwoxf04545; da>GAL4 compared to Wwoxf04545;
da>Wwox. Western analysis of Wwox levels present in the protein samples from each of the ectopic
genotypes analysed in the DIGE experiment showed that no Wwox protein was detected in any of the
Wwox1; da>Wwox samples analysed, which was probably due to an error made involving the fly
crosses required to produce this genotype as discussed earlier. This discovery helped to explain why
there were no shared changes in abundance between both null-ectopic genotypes compared to null-
GAL4. Among the Wwox1; da>GAL4 flies, five proteins were detected that exhibited statistically
significant changes in protein abundance over the 1.2 fold threshold. This result therefore suggests that
the employment of a higher average ratio change threshold would have been more appropriate in this
experiment. Average ratio changes above 1.5 or 2.0 fold may have been better suited, as suggested by
the average ratio values for the five proteins listed in Table 6.5 that effectively represent false positives.
As the Wwox protein detection experiment was not conducted until after the mass spectrometry was
performed, proteins identified from spots that exhibited average ratio changes below 1.5 fold are
therefore more likely to represent false positives than those above 1.5 fold. As is the case with changes
detected in microarray experiments, different method(s) of quantitation should be employed to
independently verify the results of any large scale screening methodology such as DIGE. However, as
there is likely to be a high rate of false positives among a number of the spots identified (due to the 1.2
fold threshold used), that does not automatically mean that all spots that exhibited changes <1.5 fold
represent false positives, but that spots with changes below 1.5 fold are statistically more likely to be
false positives.
The proteomic changes that were of most interest in this study were the changes brought about by null
expression (spots in Table 6.2) and the changes resulting from the ectopic over-expression of Wwox
protein. In light of the knowledge that the Wwox1; da>Wwox flies were not expressing Wwox protein, it is
not surprising that there were no spots in common between Wwox1; da>Wwox flies and the other
ectopic genotypes examined. If we now remove the data from Wwox1; da>Wwox and Wwox1; da>GAL4
from this analysis, there were 3 spots identified that represent generalised proteomic changes brought
about in response to ectopic Wwox expression. Unfortunately, as we were unaware that the Wwox1;
da>Wwox flies were not expressing Wwox protein at the time protein spots were excised for mass
spectrometry analysis, the reassignment of identified spots to the various representational groups
outlined above was not made. As a result, the 5 spots representing changes in response to null-ectopic
expression were not analysed by mass spectrometry. The three spots identified representing
generalised proteomic changes in response ectopic Wwox expression, each exhibited relatively large
changes in abundance in both Wwoxf04545; da>Wwox and w1118; da>Wwox flies relative to the GAL4
genotypes. The DIGE data for these spots is presented in bold in Tables 6.4 and 6.6, and shows that
the average change in protein abundance for this data set was 2.3 fold, with lowest value being a -1.57
130
fold change for w1118; da>Wwox in spot 378. This makes these spots more likely to represent true
positives as was discussed earlier.
6.4.2 A Wwox ‘rescue’ profile not identified
After the data obtained from Wwox1; da>Wwox flies was removed from the DIGE data set, there were
no spots identified that exhibited a Wwox ‘rescue’ profile (see Figure 6.11 below).
Figure 6.11. An illustration showing a plot of log standard abundance values for proteins in a spot
displaying a Wwox ‘rescue’ expression profile.
Failure to detect spots exhibiting these kinds of expression profiles may have been due to the failure of
these proteins to resolve on the gels produced. As discussed earlier, only ~10% of the Drosophila
proteome was able to be examined in this study with hydrophobic proteins in particular that are often
found in the membrane fraction of biological samples, rarely resolved on 2D gels due to their tendency
to precipitate during isoelectric focusing (104, 105). Very low abundance proteins that may have
exhibited this kind of expression profile would most likely have been below the level of detection
possible using DIGE and as such would also have gone undetected. Alternatively, the possibility exists
that such changes in protein level may not occur under the conditions examined in this study. In work
performed by Ishi et al. (106), multiple high-throughput measurements of the response of E. coli cells to
both genetic and environmental perturbations were carried out. In this study, quantitative data sets of
RNA, proteins and metabolites were obtained and compared for wildtype cells grown at a number of
different growth rates and for a series of 24 single gene disruptants representing the most viable
Log
Sta
nda
rd A
bund
ance
4
3
2
1
0
-1
-2
-3
-4
Experimental groups
w1118 / da>GAL4 Wwoxf04545 / da>GAL4 Wwoxf04545 / da>Wwox w1118 / da>Wwox
131
glycolysis and pentose phosphate pathway mutants. What was found was that most of the knock-out
mutant lines exhibited only subtle changes in average expression levels for both mRNA and protein of
the central carbon metabolism enzymes, with expression levels within the range observed for wildtype
cells grown under the same conditions. These findings suggest that in E. coli, the loss of a single carbon
metabolism enzyme does not substantially result in the regulation of abundance of other compensatory
enzymes. It appears that in E. coli, metabolic networks employ fundamentally different processes to
maintain operation in the event of genetic or environmental disruption, most likely through structural
redundancy. If a similar regulatory system of metabolic pathways were present in Drosophila, then
obvious changes in protein profile would be less likely to be detected for a single gene like Wwox that
encodes a putative steroid metabolising protein (61, 62, 107).
This study was successful in identifying two different putative proteomic profiles, a Wwox null profile and
a Wwox over-expression profile. Once the abundance changes in these proteins have been confirmed
by some orthogonal approach(s), it may be possible to assay different Wwox mutant expressing fly lines
to see which profile they most closely resemble. However, for such an approach to be successful it
would be necessary to independently measure the abundance of the proteins that were identified as
changing between Wwoxf04545; da>GAL4 and Wwoxf04545; da>Wwox flies (Table 6.6). It was unfortunate
that comparative data was obtained for only one of the Wwox null genetic backgrounds used in this
study, and for that background (Wwoxf04545) only three proteins were positively identified (Acetyl
coenzyme A synthase and two isoforms of Fat body protein 1). Unfortunately, these proteins also
displayed similar changes in endogenous-ectopic flies compared to endogenous-GAL4, suggesting that
these proteins represent generalised proteomic changes in response to Wwox over-expression. It is
therefore highly doubtful whether these proteins could be used as appropriate biomarkers of restoration
of Wwox function in a Wwox null background.
6.4.3 Mass spectrometry analysis of 2D gel protein spots
The MS results obtained in this study demonstrate two of the major challenges associated with mass
spectrometry analysis of proteins electrophoretically separated via 2D electrophoresis. The first problem
is the difficulty in obtaining confident protein identifications, particularly for low abundance proteins
contained within faint staining spots. Typically, low yields of peptides are recovered from in-gel tryptic
digests as a result of a number of factors including incomplete digestion of the gel bound protein (due to
partial protease penetration of the acrylamide gel), incomplete extraction of peptides from the gel and
the steady loss of extracted peptides during subsequent liquid handling steps (102). The second
problem is the detection of multiple proteins within 2D gel spots. As large format gels are capable of
resolving around 4000 individual spots and the Drosophila proteome is estimated to contain
132
approximately 25,000 proteins (not including splice variants, translation variants and post translational
modifications) it is not surprising that a high proportion of spots that appeared well resolved on the gels
produced were found to contain multiple proteins. The high proportion of spots containing multiple
proteins in this study compared to the previous proteomic studies presented in Chapters 4 and 5 was
most likely due to the extensive employment of liquid chromatography mass spectrometry which has
been shown to provide a significant increase in dynamic range facilitating the increased detection of low
abundance proteins in a spot (101, 108). Unlike the previous studies, multiple proteins were also
detected in several spots analysed using MALDI-TOF/TOF-MS which was most likely the result of
improved methods of sample preparation as well as in the preparation and application of matrix used in
this analysis (see section 6.2.6.2).
There are many issues associated with the quantitation of individual components of a complex peptide
analyte solution containing multiple proteins. Firstly, all peptides do not ionise with the equal efficiencies
that are often mixture dependent with the same peptide ionising differently depending on the other
components of the analyte mixture. Therefore peak intensity and volume cannot be directly correlated to
analyte concentration. However, the general aim of studies such as the one presented here is the
identification of proteins exhibiting changes in abundance between different biological samples. It is
important to note that quantitative measurements made in a study such as this one are of an
approximate nature and should be verified using methods of a more sensitive and select nature such as
antibody detection. As mass spectrometry continues to improve and as its sensitivity increases, the
detection of multiple proteins in individual 2D gel spots is likely to pose more of a problem in the future.
Part of this problem can be overcome by increasing the separation of protein spots through the use of
multiple narrow range isoelectric focusing strips. Although this is certain to reduce the number of
proteins migrating to a particular point on a gel, it also increases the number of 2D gels that need to be
produced for coverage of the entire proteome. If the study presented here was repeated employing four
different narrow range IEF strips (i.e. pH 3 to 5.6, 5.3 to 6.5, 6.2 to 7.5 and 7 to 11) instead of using pH
3 to 11 strips only, 56 DIGE gels would have to be produced, which is not realistically possible when
considering the cost, time taken and difficulty involved in performing such a study. The best realistic
alternative is to estimate which protein(s) are most likely responsible for the increased abundances
observed via DIGE. As such, an exploration of label free protein quantitation using mass spectrometry
data was undertaken to see if certain biases for the detection of the most abundant components, given
a particular mass spectrometry methodology exist.
In this study, 11 out of 31 spots were found to contain multiple proteins. The examination of spots from
single fly lines provided protein identifications for 10 of the 11 multi-protein spots via MALDI-TOF/TOF-
133
MS. Comparing the proteins present in the samples that exhibited a change in abundance revealed very
few examples where obvious changes in protein content were present between the two samples. Spots
1385, 1468 (Table 6.9) and 687, 1074 and 1387 (Table 6.10) were the exceptions exhibiting distinct
differences in protein content between the two samples analysed. In general the protein constituents of
the samples compared were complex with no single protein displaying an intensity coverage ratio vastly
greater than the other proteins. Spots 879 and 1074 were the only spots that contained a protein
species with far greater intensity coverage ratios than the other proteins in the spot. Using the
methodology outlined by Yang et. al, (108), it was possible to assess the validity of using MALDI-
TOF/TOF intensity coverage values as a crude measure of protein abundance as well as verifying of
some of the results obtained using MALDI-TOF/TOF-MS and to test whether the most abundant
proteins in the DIGE gel samples were the same as those responsible for the observed changes in
abundance. This involved the analysis of the remaining analyte samples containing peptides from the fly
lines that exhibited an increase in abundance using LC-ESI-IT-MS.
6.4.4 Summary
As in Chapter 5, this study demonstrated that significant changes in protein abundance could still be
detected in Wwox null adult flies after several rounds of back-crossing to wildtype files. Counter to
expectations, the identification of a Wwox ‘rescue’ proteomic profile was not observed in any of the
spots resolved in the DIGE experiment conducted. As a result this study was unsuccessful in identifying
any protein biomarkers that could potentially be used to assay for the restoration of Wwox function in
flies ectopically expressing Wwox constructs in a Wwox null genetic background.
Unlike the earlier proteomic studies presented in Chapters 4 and 5, improved methods for mass
spectrometry used in this work led to the detection of multiple proteins in almost half the 2D gel spots
analysed. The subsequent mass spectrometry work presented here demonstrated that quantitative
estimates of protein abundance made from DIGE gel derived samples cannot be used to identify the
individual protein(s) responsible for the specific change in abundance measured between two groups
using DIGE. It is therefore recommended that additional preparative gels containing only single sample
types be run along with DIGE gels, so in the event that multiple proteins are detected in a spot, the
same spot can be analysed from the gel containing the sample that displayed the increase in
abundance. MS/MS data obtained from such samples is likely to provide emPAI scores than can then
be used to estimate rough protein abundances. The advantage of this method is that no additional
peptide labelling is necessary, as most other quantitative mass spectrometry methodologies require (i.e.
ICPL peptide labelling).
134
Despite the high number of multi-protein spots, this study was successful in identifying a number of
different proteins that exhibited significant and consistent changes in abundance producing a Wwox null
proteomic profile and a general Wwox over-expression profile. Of great interest was the detection of two
different isoelectric isoforms of superoxide dismutase 1 (Sod1), the only protein to have exhibited
significant changes in abundance in both embryo and adult Drosophila. Preliminary unpublished studies
conducted in the Richards lab have demonstrated a likely genetic interaction between Wwox and Sod1
and given that both genes have been shown to have roles in both pro- and anti-apoptotic pathways,
Sod1 remains the most promising target for further research. Also of great interest was the increase in
abundance in Wwox null flies of a number of other proteins known to also have roles in oxidative stress
response (Aldh2, Aldh1B1 and Adh), thus strengthening the idea that WWOX / Wwox may indeed play
a role in this cellular process, perhaps through its enzyme function.
Significant changes in abundance of four different isoforms of fatbody protein 1 (Fbp1) in this study
were also of note. As Fbp1 and Adh have both been shown to be ecdysteroid regulated proteins with
Fbp1 also post-translationally modified in a steroid dependent manner, strengthening the idea that
WWOX / Wwox may indeed function as a steroid dehydrogenase. However, most intriguing was the
large number of enzyme proteins and in particular metabolic enzymes that exhibited changes in
abundance in response to the levels of Wwox expressed in adult Drosophila. This may suggest that
Wwox may function either directly or indirectly (i.e. upstream or downstream) of certain, yet to be
defined metabolic processes. Further study into the possible relationships between these enzymes and
Wwox may help to narrow down the particular pathways and processes Wwox is involved.
However, one of the great drawbacks of Drosophila as a model organism is the lack of available protein
antibodies. This makes independent testing of protein abundance changes quite difficult, nonetheless,
one of the great strengths of Drosophila is the large number of available mutant fly lines that enables
the genetic screening of possible genetic interactors to be conducted. With mutant lines available for
most of the proteins identified here, a genetic study has been initiated in the Richards lab, with each of
these mutant lines to be crossed to Wwox null flies. As Wwox null flies have no observable phenotype,
this study will assay for modifications in phenotype of the candidate mutant lines (where one exists), or
the emergence of a phenotype where none exist in either of the mutant lines examined (i.e. Wwox null
and candidate mutant). The demonstration of genetic interactions between Wwox and some of the
genes / proteins identified here, would provide some new clues to some of the processes and pathways
Wwox acts within and could therefore provide new avenues for future research work into the functional
aspects of WWOX / Wwox.
135
136
Chapter 7:
Final Discussion
137
138
Chapter 7: Final Discussion
7.1 Introduction
The primary aim of this thesis was to elucidate the normal biological function of the Wwox protein via
genetic and biochemical analyses in Drosophila melanogaster. The Drosophila model organism was
selected for this study as several null mutant lines had been generated that could provide an ideal
resource with which to study the Wwox protein. Another reason for working in Drosophila was the ability
to direct the spatio-temporal expression of proteins in the organism using the GAL4-UAS system. Initial
experiments were designed taking advantage of the GAL4-UAS system to identify regions of the Wwox
protein that are critical to its normal function. A series of Drosophila Wwox proteins specifically deleted
or mutated at positions identified as conserved functional protein motifs, or regions that are highly
conserved among WWOX / Wwox homologs were subsequently created. The expression of these
proteins in Wwox null flies were used to assay for modifications of an ionising radiation (IR) sensitivity
phenotype that was observed prior to this work being undertaken. The expected outcomes of this work
were that mutations / deletions in regions of the Wwox protein critical to its function would be expected
to abolish the ability of Wwox to rescue the Wwox null mutant phenotype following exposure to
radiation. Therefore regions required for Wwox function may be identified.
7.2 The impact of background mutations
The results of these ‘radiation rescue’ studies revealed a complete lack of IR sensitivity observed in all
Wwox mutant lines generated and tested and it was therefore not possible to identify any part of the
Wwox protein responsible for the decreased resistance to IR. Subsequently, a biochemical approach
was undertaken to examine the consequences to the proteome arising from a lack of Wwox expression.
The aim of this approach was to identify the pathway(s) in which Wwox participates by virtue of the
proteins that its altered levels perturb. The proteomic analysis of adult Wwox null mutants was
undertaken comparing three different Wwox null mutant lines (two HR mutants and one piggyBac
mutant) with wildtype flies using 2D-DIGE and MS approaches. However, this analysis revealed an
unexpectedly large amount of proteomic variation between the three different Wwox null mutant lines
examined. An alternative explanation was later found to account for this observed variation as well as
for the rescue of radiation sensitivity observed for all the Wwox variants tested earlier.
The increased sensitivity to IR observed in flies homozygous for either Wwox1 or Wwoxf04545 compared
to w1118 (74) was lost when flies were made trans-heterozygous for both Wwoxf04545 and Wwox1 (78).
139
This revealed that in the homozygous strains for each of the independent Wwox alleles, the IR
sensitivity phenotype was independent of the mutations in the Wwox gene. This was later confirmed by
backcrossing (for four rounds) both the HR and piggyBac Wwox mutant strains to the parental w1118
strain used in the targeted mutagenesis procedure. The resulting homozygous mutant strains exhibited
a significant decrease in sensitivity to IR exposure (78), thus confirming that the initial sensitivity
observed in Wwox mutants was independent of the Wwox mutations.
This finding helped explain the lack of IR sensitivity displayed by all the fly genotypes that expressed
various mutations / deletions in the Wwox protein. The observed radiation sensitivity was not the
consequence of the targeted Wwox mutations in the Wwox null lines, but due to mutation(s) elsewhere
in the Drosophila genome, that were most likely introduced during the mutagenesis performed in
creating these null lines. These background mutations were complemented by wildtype chromosomes
during the crossing of the fly lines to test the various Wwox mutant / deletion constructs that were
examined.
7.3 Summary of proteomic studies conducted
The discovery of background mutations helped explain the unexpectedly large amount of variation
observed between the adult Wwox null lines examined via DIGE analysis in Chapter 4. However, this
study did identify four 2D gel spots that exhibited consistent and significant changes between all the
Wwox null mutants examined and wildtype flies. Of the four spots, successful MS protein identifications
were obtained for only two of these spots. This study also demonstrated the 2D-DIGE approach to be a
robust and reliable way of identifying biological changes between various Wwox mutant fly genotypes in
the absence of a detectable phenotype. This approach therefore formed the basis for the proteomic
studies that were to follow.
As the 2D-DIGE approach had proved effective in identifying proteomic changes between different fly
lines that possess identical phenotypes, this approach was again used to compare Wwox1 and w1118
flies. This time an earlier developmental time point was chosen for this study in an effort to identify the
earliest possible consequences of Wwox loss of expression and thus the primary pathway(s) that Wwox
may be involved in. This study revealed that significant changes in protein abundance were still
detected in 2-4 hour Drosophila embryos following four rounds of backcrossing Wwox1 flies to w1118.
The number of spots that exhibited significant changes between these two lines was lower than that
observed in the adult flies prior to backcrossing, with roughly half the number identified. 11 spots were
identified that exhibited significant changes as a result of a lack of Wwox expression in Wwox1 embryos.
Protein identifications for 8 of these spots subsequently revealed proteins involved in a broad range of
140
biological functions and processes. Of the protein spots resolved from the Drosophila embryo
proteomes, the magnitude of changes in protein abundance detected between w1118 and Wwox1 was
also not as great as that observed in adult flies prior to backcrossing. It is not known if this was due to
the backcrossing or the different developmental time point examined.
The small amount of information obtained from the examination of Drosophila embryos consequently
made it difficult to ascertain any possible pathways or processes Wwox may act within. Hence, a study
was undertaken to compare the proteomic consequences that result not only from a lack of Wwox
expression (as examined in Chapters 4 and 5) but also from the ectopic over-expression of Wwox. The
aim of this study was to identify a larger number of proteins that are altered, either quantitatively and/or
qualitatively in response to differing levels of Wwox expression in Drosophila. In this study, the
quantitative analysis of nine different fly lines, comprising three different experimental groups was
undertaken. The proteomic changes that were of most interest in this study were the changes brought
about by null expression (Table 6.2) and the changes resulting from the ectopic over-expression of
Wwox protein (Table 6.4). The comparison of proteins derived from Wwox null flies to endogenous fly
proteins revealed a total of 16 spots that exhibited a statistically significant change in abundance
common to both Wwox null genotypes (Wwox1 and Wwoxf04545) compared to endogenous (w1118) that
were selected for MS protein identification. A further 16 spots were identified that exhibited significant
changes between endogenous-GAL4 (w1118; da>GAL4) and endogenous-ectopic (w1118; da>Wwox)
genotypes that were also selected for MS analysis.
7.4 Biological significance of proteins identified by proteomic
analysis
The initial proteomic study conducted in this thesis (presented in Chapter 4), compared the proteomes
of three different Wwox null lines with wildtype adult Drosophila. Of the 2D gel spots found to exhibit
significant changes between the fly lines examined, successful MS protein identifications were obtained
for nine spots. However, as the existence of background mutations was discovered after this work was
performed it was not possible to know which changes may have been caused by these background
mutations. Despite this four 2D gel spots were identified that exhibited consistent and significant
changes between all the Wwox null mutants examined and wildtype flies making these changes far less
likely to be the result of any background mutations. Of these four spots, successful MS protein
identifications were obtained for only two of these spots, Ferritin 2 light chain homologue protein and
CG7460. It remains unclear how Ferritin 2 light chain homologue protein, which exhibited a decrease in
abundance in all of the mutant lines, may relate to Wwox function at this point. However, the
identification of CG7460, a Drosophila oxidoreductase enzyme protein, was of more interest as this
141
protein exhibited an increase in abundance in all the Wwox null lines examined, suggesting that this
oxidoreductase enzyme may be up-regulated to compensate for the lack of Wwox expression.
Unfortunately, this protein has only one known homologue (in Anopheles gambiae) and little is known
about its function. As no antibodies or mutant fly lines were available for this protein, further study into
the relationship between Wwox and CG7460 was not possible.
In the second proteomic study, presented in Chapter 5, almost all the proteins identified that exhibited
significant 2D gel spot changes in backcrossed Wwox1 embryos, were proteins involved in protein
expression, turnover and transport. Proteins involved in mRNA degradation (CG4279), mitochondrial
protein synthesis (mRpS23) and organellular transport (GDI1) increased in abundance in the absence of
Wwox expression. On the other hand, proteins involved in mRNA export to the cytoplasm (Hel25E),
protein translation (Ef1�48D) and protein degradation (CG17331) showed a decrease in Wwox1
embryos. In addition to these proteins, two different isoforms of Sod1 were also identified, making this
the only protein that was also identified in adult flies prior to backcrossing (Chapter 4). As all of the
proteins identified function in quite broad, non-specific molecular and biological processes, they
provided very few clues as to a possible functional role for the WWOX / Wwox protein. Consequently,
the results of this study illustrated one of the main limitations of the 2D gel approach used, that of
insufficient resolution of proteins comprising a complex proteome.
As large format 2D gels are only capable of resolving around 4000 spots on average, only a small
fraction of the complete Drosophila proteome (that is likely to contain well over 50,000 proteins or
protein variants), is able to be resolved in enough detail to identify a sufficient number of key protein
changes. Therefore, studies of this kind are only likely to identify a fraction of the proteins that change in
response to altered levels of Wwox expression. Hence, the third proteomic study (Chapter 6) was
undertaken to compare the proteomic consequences resulting from both the lack of Wwox expression
(as examined in Chapters 4 and 5) but also from the ectopic over-expression of Wwox. The aim being to
identify a larger number of proteins that are altered, either quantitatively and/or qualitatively in response
to differing levels of Wwox expression in Drosophila.
Of the 26 proteins positively identified in this study (summarised in Tables 6.11 and 6.12), 22 were
found to be enzymatic proteins with 15 assigned as metabolic enzymes. Given that Wwox is an
oxidoreductase enzyme with homology to steroid dehydrogenases, it is interesting that so many
metabolic enzymes were identified. Among the proteins that changed in abundance in response to an
absence of Wwox expression (Table 6.11), were two isoelectric isoforms of superoxide dismutase
(Sod1). The Sod1 protein was identified in every DIGE experiment comparing Wwox null with wildtype
flies and was the only consistently identified protein that exhibited changes in abundance in response to
142
a lack of Wwox expression. In a subsequent study, Wwox and Sod1 double mutant flies were found to
exhibit significant decreases in survival and lifespan (Chen, Q. personal communication). Although a
direct biological relationship between Wwox and Sod1 is yet to be substantiated, it does appear from
this initial evidence that a genetic interaction and therefore functional relationship between the two
proteins may exist. Due to the known roles these genes play in pro and anti-apoptotic pathways
(Chapters 1.3.2 and 5.4.2), it is possible that Sod1 and Wwox may work in concert to regulate the
delicate balance of response mechanisms to environmental stresses, particularly oxidative stress.
Intriguingly, a number of other proteins known to be involved in oxidative stress response were also
increased in flies not expressing Wwox. These include two different aldehyde dehydrogenase enzymes
(Aldh2 and Aldh1B1 isoforms) identified in three spots and an alcohol dehydrogenase enzyme in
another (Adh). Aldh enzymes have been shown to oxidise a number of toxic aldehydes to acids (109,
110), with Aldh2 shown to be important in the metabolism of acetaldehyde, a product of alcohol
metabolism by alcohol dehydrogenase. The Adh enzyme identified in spot 2485 has not yet been fully
characterised and does not possess a human ortholog, but has been shown to be an ecdysteroid-
regulated protein (111) that is localised mainly to the adult fly fat body (112). This protein has been
shown by Anderson et al. (113) to play a role in alcohol and aldehyde metabolism in Drosophila. It plays
an essential role in the detoxification of acetaldehyde (114). Interestingly, Fbp1 protein that was
identified in 4 different spots in this study is also localised to the Drosophila fat body and its synthesis
and processing is regulated by ecdysone hormone in Drosophila larvae (103). Together this data
indicates that 6 of the 11 proteins identified that exhibited changes in protein abundance due to lack of
Wwox expression have enzymatic functions involved in the metabolism of various reactive molecules
produced in cells through normal metabolic processes. As there was an increase in the abundance of
these enzymes observed in Wwox null flies, this suggests that Wwox may also play a role in the
oxidation of reactive molecules. Alternatively, the pro-apoptotic role played by Wwox may involve the
down regulation of these types of enzymes thus leading to an increase in reactive oxygen species
(ROS). This is particularly likely in the mitochondria where the majority of these enzymes are localised.
Mitochondria have also been shown to play a critical role in apoptosis (115, 116). As for the other two
proteins that exhibited an increase in abundance in flies not expressing Wwox, cytoplasmic Glycerol 3
phosphate dehydrogenase and CG11089 (ATIC), it is unclear how they may relate to Wwox function at
this point.
Fifteen proteins were found to change in abundance in response to ectopic Wwox expression (Table
6.12), and 12 of these were enzymes of which 6 are metabolic enzymes. The detection of Wwox protein
in spots 1074 and 1382 (see Table 6.10) was the first time this protein had been identified on 2D gels,
and the fact that it could only be detected once over-expressed using the daughterless (da) promoter
143
illustrates the very low level of endogenous protein normally expressed. Both the spots in which Wwox
protein was detected were relatively low abundance spots (see Figure 6.7) suggesting that the levels of
protein expression produced by the da promoter are still relatively low or that the Wwox protein itself is
very highly turned over. Most intriguing in this regard was the detection of what appears to be a
truncated form of Wwox in spot 1382. This protein was approximately 10 kDa smaller than the full length
protein detected in spot 1074, and inspection of the peptides detected from this protein showed that
none were found that corresponded to the N-terminal region of Wwox (see Appendix H). This suggests
that the Wwox protein in spot 1382 represents a cleaved form, perhaps lacking the N-terminal WW
domain region of the protein. Without further MS analysis of the Wwox protein found in spot 1382, the
exact nature of the apparent modification remains unclear.
The largest average ratio changes in abundance detected in the DIGE analysis were in spots 1055 and
1074 (-2.2 and 3.04 fold changes respectively) that were both found to contain Fbp1 protein.
Interestingly, Fbp1 expression and processing is known to be regulated by the insect steroid hormone
20-hydroxy-ecdysone (20E) for which different concentrations of this steroid have been shown to induce
cleavage of the protein in at least two different cleavage steps, producing proteins of 68.8 kDa, 49.8
kDa, 48.8 kDa and 19 kDa (103). All of the Fbp1 proteins identified in this study were around the 47-49
kDa size range suggesting that Wwox expression levels appear to have some influence on the post-
translational processing of Fbp1. As there is some evidence for Wwox functioning as a steroid
dehydrogenase enzyme, it is possible that Wwox expression may affect Fbp1 processing by modulating
the level of 20E. Future studies could be conducted to test this hypothesis by measuring the relative
levels of 20E in Drosophila expressing differing levels of Wwox to see if it does affect the level of 20E in
the organism. This could provide the first identification of a Wwox enzyme substrate that could in turn
provide clues to possible WWOX substrates in mammalian species.
The possible relationship that the high proportion of metabolic enzymes identified in this thesis have to
Wwox function remains unclear, as a common feature of metabolic enzymes is the high degree of
functional overlap that exists between them. As many of these enzymes share identical substrates and
cofactors, as well as overlapping metabolic processes, it is therefore difficult to comment on the possible
relationships of many of the proteins identified here to Wwox without being overly speculative.
144
7.5 Future directions
A major drawback of conducting proteomic studies in Drosophila is the lack of available antibodies that
makes it difficult to independently test changes in protein abundance detected via DIGE using western
blots. Since the completion of this study, a subsequent microarray study was conducted by the Richards
lab comparing Wwox1 with wildtype w1118 adult flies and found no significant differences in the transcript
levels for the for the proteins identified by the proteomic work presented in this thesis. As a result qRT-
PCR analysis was not undertaken to independently verify the results obtained here. However, the major
strength of Drosophila as a model organism is that it is highly amenable to genetic manipulation and this
has formed the basis of a study that is currently being undertaken in the Richards laboratory to
ascertain whether any genetic interactions and therefore functional relationships exist between a
number of the proteins identified here and Wwox. RNAi knockdown fly lines have been obtained for
most of the genes coding for the proteins identified by the proteomics and these lines will each be
crossed to Wwox null flies. The aim of this work is to ascertain if there is a detectable biological
interaction between Wwox and the proteins identified via proteomics, which would be manifest via the
modification of any knockdown phenotype observed or the creation of a new phenotype in these flies.
However, RNAi may not reduce RNA levels to below the threshold required for producing or modifying
a phenotype. In a subsequent study, Sod1 RNAi knockdown / Wwox deletion double mutant strains did
not display the phenotype to that of the Sod1 ; Wwox double knockout mutants described in Chapter
6.4.4 (Choo, A. University of Adelaide, Genetics Honours Thesis 2008). A way around this problem is to
examine knockout mutant fly strains as has already been described for Sod1 (Chen, Q. University of
Adelaide, Genetics Honours Thesis 2007). As discussed earlier in Chapter 6.4.4, a likely biological
interaction between Sod1 and Wwox was indicated by the enhanced phenotype of Sod1 mutants due to
Wwox deletion, namely reduced survival of Wwox ; Sod1 double mutants (Chen, Q. University of
Adelaide, Genetics Honours Thesis 2007). The examination of gene knockout double mutant strains
would offer an orthogonal approach where gene knockdown studies fail to produce an observable
phenotype. However, as knockout mutant lines are not readily available for all the genes identified in
this thesis, may of the required mutant strains would need to be generated representing a considerable
investment in time and resources and as such is yet to be done.
145
7.6 Conclusion
In this study, the Drosophila model organism was used in the genetic and biochemical analysis of Wwox
protein function. Despite the discovery of background mutations present in the initial Wwox null lines
utilised for this work, the most significant outcome of this work was identification of proteomic changes
that resulted from differences in the Wwox gene expression status. The proteomic studies presented
here identified changes in a wide variety of proteins, with a significant number of metabolic proteins as
well as proteins involved in oxidative stress response detected. Of particular interest, consistent
changes in different isoforms of superoxide dismutase 1 (Sod1) were identified in all the proteomic
studies conducted. Due to the known roles these proteins play in pro and anti-apoptotic pathways, it is
possible that Sod1 and Wwox may work together in regulating the response to environmental stresses,
particularly oxidative stress. The protein/gene targets identified in this thesis therefore offer some novel
insights into normal functioning of the Wwox protein.
This study uncovered evidence that indicated changes in a significant number of metabolic enzymes
and mitochondrial proteins in response to Wwox levels. These findings support the hypothesis that
genes spanning Common Fragile Sites (CFS) may act as sensors of cellular stress (117, 118). A
number of genes found to span CFS’s have been observed as having undergone extensive
chromosomal deletions and rearrangements (119), many of which occur in intronic regions thus
resulting in a number of altered transcripts and perhaps proteins. The production of these altered gene
products have been proposed to play an active role in the cellular sensing of environmental stress, thus
leading to the triggering of various response pathways (117). Therefore the discovery of changes in the
proteins identified in this thesis supports the hypothesis that the Wwox protein may function as a sensor
of cellular stress with alternate splice forms of the protein first being produced as a result of
chromosomal rearrangements that occur at the FRA16D fragile site situated in the eighth intron of the
gene. These alternate forms of Wwox may therefore function to induce specific sets of metabolic
enzymes to neutralise the reactive compounds associated with cellular stress. Levels of environmental
stress too great for these pathways to effectively respond are manifest in even greater levels of DNA
instability at the fragile site, thus resulting in the total or partial abrogation of Wwox enzyme function.
Such losses of Wwox expression/function are a common outcome observed in many human cancers,
suggesting that Wwox may play an important role in influencing the regulation of key metabolic enzymes
and pathways that are critical in the cell biology of certain cancers.
146
Appendix
147
8 Appendix
Appendix A
Survival of Drosophila in conditions of reduced larval dessication. The percentage survival
to adulthood of third instar larvae (N=600) after exposure to 20 Grays of IR is shown for w1118
(green), Wwox1 (red), da>Wwox (purple) and da>Wwox�WW1 (blue) fly lines. Following exposure
to IR, dishes holding the larvae were sealed with paraffin film to prevent desiccation and flies left
to develop to adulthood at 25°C..
0
10
20
30
40
50
60
70
80
90
100
w1118 Wwox
1 da>Wwox da> Wwox�WW1
Fly lines
% S
urviv
al
(2
0 G
y)
148
Appendix B
Survival of Drosophila at three different ionising radiation exposures. The percentage
survival to adulthood of third instar larvae (N=100) following exposure to 22.5 (blue), 25 (red) or
30 (yellow) Grays of IR is shown for w1118 and Wwox1 fly lines.
0 10 20 30 40 50 60 70 80 90
100
w1118 Wwox1
% S
urviv
al
Fly Lines
22.5 Gy
25 Gy
30 Gy
149
Appendix C
Effect of 30 Grays of ionising radiation on all fly lines examined in Chapter 3. The percentage
survival to adulthood of third instar larvae (N=350) following exposure to 30 Grays of IR is shown
for the following lines: w1118 (green), Wwox1 (red), Wwox over expression (purple), two independent
WwoxT127A lines (dark blue), two independent WwoxY288F lines (dark blue), two independent
Wwox�WW1 lines (orange) and two independent Wwox�WW2 lines (yellow).
0 10 20 30 40 50 60 70 80 90
100
% S
urviv
al
30
Fly Lines
w1118
Wwox1
da>
Wwox
da>W
woxT127A
da>
WwoxY288F
da>
Wwox�W
W1
da>
Wwox�W
W2
150
Appendix D
Table A. Spots that exhibited a significant change in abundance between w1118 & Wwox1only.
Master # T-test Ave Ratio
1 475 0.0013 6.7
2 902 0.00048 2.41
3 957 0.004 2.24
4 900 0.011 1.89
5 845 0.007 1.53
6 1044 0.0016 1.52
7 785 0.0039 1.52
8 818 0.029 1.47
9 1034 0.018 1.41
10 880 0.0034 1.33
11 920 0.041 1.29
12 904 0.037 1.22
13 590 0.014 -1.24
14 719 0.018 -1.25
15 232 0.038 -1.3
16 727 0.0095 -1.35
17 924 0.000051 -1.53
18 669 0.000031 -1.78
19 1212 0.013 -2.41
20 1257 0.0023 -2.54
21 786 0.01 -2.62
Table B. Spots that exhibited a significant change in abundance between w1118, Wwox1 &
Wwoxf04545 only.
Master # T-test Ave Ratio T-test Ave Ratio 1-ANOVA
1 1349 0.0014 2.04 0.018 1.54 0.005
2 266 0.0054 1.55 0.0019 1.65 0.024
3 438 0.02 1.45 0.02 1.44 0.007
4 77 0.017 1.39 0.018 1.48 0.023
5 913 0.018 -1.36 0.0029 -1.73 0.012
Wwox1
Wwoxf04545
Table C. Spots that exhibited a significant change in abundance between w1118 & all Wwox mutant lines.
Master # T-test Ave Ratio T-test Ave Ratio T-test Ave Ratio 1-ANOVA
1 656 0.0023 1.52 0.0047 1.44 0.033 1.34 0.0017
2 968 0.0091 -1.26 0.038 -1.42 0.016 -1.23 0.022
3 1381 0.0062 -3.6 0.008 -3.1 0.0014 -3.6 0.0015
4 1491 0.0025 -4.06 0.05 -1.58 0.001 -3.03 0.0003
Wwox1
Wwox1-2
Wwoxf04545
151
Table D. Spots that exhibited a significant change in abundance between w1118, Wwox1 &
Wwox1-2 only.
Master # T-test Ave Ratio T-test Ave Ratio
1 1510 0.0074 7.87 0.044 7.35
2 1045 0.0023 2.5 0.0066 2.14
3 632 0.0017 2.17 0.0061 1.87
4 674 0.0052 1.54 0.0086 1.34
5 691 0.035 1.45 0.025 1.21
6 85 0.032 1.23 0.0021 1.33
7 1001 0.044 -1.23 0.032 -1.34
8 1462 0.00097 -1.33 0.044 -1.35
9 1100 0.014 -1.61 0.00025 -1.68
10 1241 0.019 -1.84 0.00057 -3.24
11 1060 0.00079 -2.9 0.037 -1.49
Wwox1
Wwox1-2
Table E. Spots that exhibited a significant change in abundance between w1118 & Wwoxf04545 only.
Master # T-test Ave Ratio Master # T-test Ave Ratio
1 273 0.0013 2.95 32 678 0.0089 1.22
2 994 0.01 2.85 33 1452 0.022 1.21
3 979 0.008 2.32 34 314 0.0057 1.2
4 164 0.00037 2.23 35 964 0.048 -1.21
5 262 0.0092 2.09 36 902 0.047 -1.23
6 1002 0.008 1.98 37 848 0.0023 -1.26
7 754 0.0019 1.73 38 328 0.029 -1.27
8 1007 0.0071 1.66 39 893 0.0089 -1.27
9 696 0.02 1.61 40 1003 0.035 -1.27
10 1404 0.042 1.6 41 349 0.014 -1.3
11 410 0.0011 1.57 42 1000 0.035 -1.31
12 626 0.000073 1.53 43 1344 0.024 -1.33
13 571 0.00048 1.51 44 288 0.018 -1.35
14 592 0.0037 1.49 45 898 0.004 -1.45
15 1338 0.032 1.49 46 1389 0.043 -1.49
16 809 0.016 1.48 47 371 0.025 -1.53
17 557 0.00052 1.46 48 824 0.018 -1.54
18 719 0.017 1.43 49 1376 0.01 -1.54
19 567 0.0034 1.41 50 1271 0.033 -1.57
20 589 0.018 1.41 51 1211 0.012 -1.58
21 709 0.014 1.41 52 356 0.00044 -1.63
22 746 0.0059 1.36 53 661 0.017 -1.63
23 1241 0.032 1.36 54 1129 0.01 -1.63
24 272 0.014 1.35 55 1395 0.0052 -1.63
25 135 0.02 1.32 56 689 0.0028 -1.64
26 401 0.035 1.31 57 855 0.0012 -1.84
27 1095 0.0032 1.3 58 753 0.0026 -1.93
28 198 0.017 1.27 59 1387 0.04 -2.12
29 459 0.038 1.27 60 165 0.0054 -2.6
30 578 0.0043 1.27 61 851 0.00028 -4.01
31 342 0.026 1.23 62 1233 0.015 -4.61
152
Table F. Spots that exhibited a significant change in abundance between w1118, Wwox1-2 &
Wwoxf04545 only.
Master # T-test Ave Ratio T-test Ave Ratio
1 673 0.014 1.3 0.023 1.45
2 765 0.033 1.3 0.011 1.31
3 113 0.0066 1.21 0.00017 1.76
4 949 0.0033 -1.36 0.05 -1.29
5 920 0.023 -1.44 0.029 -1.38
6 680 0.0043 -4.15 0.0035 -4.42
Wwox1-2
Wwoxf04545
Table G. Spots that exhibited a significant change in abundance between w1118 & Wwox1-2 only.
Master # T-test Ave Ratio
1 1233 0.032 2.62
2 1204 0.029 2.2
3 661 0.00056 1.96
4 1270 0.035 1.61
5 620 0.01 1.53
6 595 0.035 1.39
7 650 0.0017 1.23
8 254 0.0098 -1.21
9 922 0.02 -1.28
10 1452 0.021 -1.28
11 980 0.008 -1.45
12 1090 0.029 -1.68
13 923 0.0092 -1.79
14 1288 0.021 -1.84
15 464 0.0044 -5
16 1507 0.0073 -9.27
153
Appendix E
MS identification of proteins in multi-protein spots that displayed changes in abundance between w1118 and Wwox
null flies by LC-ESI-MS/MS
* Number in parentheses represents number of queries over the peptide identity threshold score # Number in parentheses represents the protein identification threshold score
Spot Accession NameQueries*
Matched
Seq
Coverage
Combined#
MOWSE
Score
Observed mol.
mass (Da)/pI
29
8
- - - - - -
gi|24640557 NADH:ubiquinone
reductase 75kD subunit
precursor
12(10) 17% 584(32) 78,631 / 6.82
gi|17136630 Black cells 11(8) 17% 447(32) 79,092 / 6.57
gi|21357965 Glycyl-tRNA synthetase 5(4) 9% 222(32) 75,805 / 6.34
gi|45553389 Peroxidase 4(3) 8% 165(32) 76,720 / 6.28
70
9
- - - - - -
gi|21358499 CG7430 9(4) 22% 247(35) 53,085 / 6.87gi|24650465 CG31075 10(3) 21% 249(35) 52,607 / 6.64
86
9
- - - - - -
gi|20129399Aldehyde
dehydrogenase14(7) 22% 487(35) 57,020 / 6.79
gi|24650465 CG31075 15(5) 27% 371(35) 52,607 / 6.64
gi|21358499 CG7430 4(1) 8% 125(35) 53,085 / 6.87
13
08
- - - - - -
gi|22023983Glyceraldehyde 3
phosphate
dehydrogenase 1
7(5) 19% 272(33) 35,351 / 8.42
gi|157560sn-glycerol-3-phosphate
dehydrogenase6(5) 17% 215(33) 36,177 / 5.94
gi|24643268 lethal (1) isoform A 4(3) 9% 187(33) 38,902 / 6.96gi|24639740 lethal (1) isoform C 5(2) 13% 155(33) 49,415 / 8.39
gi|6636407membrane import
protein3(2) 8% 127(33) 36,614 / 6.13
gi|24662781 CG6084 3(2) 11% 120(33) 36,185 / 6.21gi|24645325 CG18473 2(2) 7% 119(33) 39,557 / 6.16gi|24585514 CG9331 2(2) 7% 95(33) 35,748 / 6.27
gi|24647881 CG7998 14(10) 44% 733(35) 35,524 / 9.2
gi|19922568 CG15093 isoform B 1(1) 4% 63(35) 34,260 / 8.37
22
18
- - - - - -
24
84
- - - - - -
~37,000 / 6.1
~35,000 / 7.5
~75,000 / 5.7
~54,000 / 5.85
~54,000 / 5.6
-
-
-
13
85
14
68
-
Theoretical mol.
mass (Da)/pI
45
78
67
87
9
-
-
154
Appendix F
MS identification of proteins in multi-protein spots that displayed changes in abundance between w1118; da>GAL4
and w1118; da>Wwox null flies by LC-ESI-MS/MS
* Number in parentheses represents number of queries over the peptide identity threshold score # Number in parentheses represents the protein identification threshold score
Spot Accession NameQueries*
Matched
Sequence
Coverage
Combined
MOWSE#
Score
Observed mol.
mass (Da)/pI
gi|19921864 CG8193 20 (11) 32% 705(32) 79520/ 6.49
gi|24643010 transferrin 1 17 (9) 32% 557(32) 72964/ 6.69
gi|20130025 lethal (2) k05713 isoform C 11 (7) 20% 419(32) 80423/ 7.71
gi|24645384 Hrp59 2 (1) 3% 54(32) 66732/ 8.03
gi|24646388 Malic enzyme 10 (1) 12% 230(35) 84368/ 7.23
gi|17864244 Phosphogluconate mutase 3 (1) 5% 57(35) 60767/ 6.68
gi|24646388 Malic enzyme 15 (3) 18% 264(35) 84368/ 7.23
gi|21356279 Malate dehydrogenase 9 (4) 14% 243(35) 68594/ 6.69
gi|17864244 Phosphogluconate mutase 2 (1) 4% 39(35) 60767/ 6.68
gi|24664081 Fat body protein 1 14 (5) 9% 357(35) 119591/ 6.06
gi|1168232Phosphogluconate
dehydrogenase8 (4) 17% 318(35) 52492/ 6.25
gi|38570267 troponin T-5 9 (3) 17% 242(35) 44874/ 4.69
gi|7961 Fat body protein 1 11 (3) 8% 225(35)
gi|1200230S-adenosyl-L-homocysteine
hydrolase3 (2) 8% 117(35) 47367/ 6.14
gi|24582947 CG9510 2 (2) 6% 148(35) 54746/ 6.4
gi|17137654 Enolase 2 (1) 6% 97(35) 46663/ 6.52
gi|17137738 Rpt1 1 (1) 2% 46(35) 48542/ 5.82
gi|17136394 Phosphoglycerate kinase 22 (11) 34% 723(35) 44119/ 7.01
gi|21357673 CG5590 9 (5) 25% 300(35) 44354/ 8.19
gi|24640177 lethal (1) G0030 5 (2) 10% 136(35) 53576/ 8.67
gi|24640177 lethal (1) G0255 2 (1) 5% 86(35) 50460/ 7.62
gi|1246511Sterol carrier protein X-related
thiolase1 (1) 2% 52(35) 59008/ 7.87
gi|21356033 CG17273 1 (1) 2% 50(35) 48935/ 6.83
gi|24657813 CG3074 1 (1) 3% 36(35) 39523/ 7.5
13
82
- - - - - -
gi|22023983Glyceraldehyde 3 phosphate
dehydrogenase 16 (4) 19% 252(36) 35351/ 8.42
gi|24640397Translocase of outer membrane
403 (3) 9% 160(36) 36337/ 7.11
gi|21355239 CG6767 3 (1) 11% 87(36) 38280/ 7.5
gi|24662781 CG6084 1 (1) 3% 69(36) 35923/ 6.63
22
18
- - - - - -
~47,000 / 5.65
~46,000 / 6.45
~35,000 / 6.4
~80,000 / 6.3
~60,000 / 5.8
~60,000 / 5.65
-
10
27
10
74
13
87
-
Theoretical mol.
mass (Da)/pI
51
56
87
69
9
155
Appendix G
MS identification of proteins in multi-protein spots obtained from DIGE gels and gels containing the protein from
single fly line(s). The data obtained from genotypes that exhibited an increase in protein abundance are shaded
grey. All data was obtained using LC-ESI-MS/MS.
* Number in parentheses represents number of queries over the peptide identity threshold score # Number in parentheses represents the protein identification threshold score
Spot Protein Sample Accession Name MOWSE#
Score
Queries*
Matched
Seq
CoverageemPAI mol%
gi|19921864 CG8193 708(34) 17(10) 16% 0.83 38.07
gi|20130025 transferrin 1 567(34) 14(8) 14% 0.85 38.99
gi|24643010 lethal (2) k05713 421(34) 8(7) 18% 0.43 19.72
gi|24645384 Hrp59 54(34) 2(1) 3% 0.07 3.21
gi|19921864 CG8193-PA 79(35) 3(1) 4% 0.1 66.67
gi|3786400 transferrin precursor 50(35) 3(1) 5% 0.05 33.33
gi|7248650 malic enzyme 230(35) 10(1) 2% 0.21 80.77
gi|11991593 phosphoglucomutase 57(35) 3(1) 2% 0.05 19.23
w1118 / da>Wwox gi|7248650 malic enzyme 128(36) 4(1) 9% 0.15 100.00
gi|7248650 malic enzyme 246(35) 13(3) 24% 0.23 38.98
gi|6634090 malate dehydrogenase
gi|21356279 Mdh CG5889
gi|11991593 phosphoglucomutase 39(35) 2(1) 4% 0.06 10.17
gi|6634088 malate dehydrogenase
gi|7248650 malic enzyme
gi|6634090 malate dehydrogenase
gi|21356279 Mdh CG5889
gi|24655582 CG7461 36(35) 1(1) 1% 0.05 5.56
gi|24650465 CG31075 311(35) 10(3) 21% 0.27 17.88
gi|21358499 CG7430 247(35) 9(2) 22% 0.35 23.18
gi|24650465 CG31075 311(35) 9(5) 22% 0.59 39.07
gi|21358499 CG7430 157(35) 5(3) 15% 0.19 12.58
gi|24661120 Paramyosin 113(35) 3(1) 7% 0.06 3.97
gi|24658560 bellwether 64(35) 2(1) 4% 0.05 3.31
gi|20129399Aldehyde
dehydrogenase487(35) 14(7) 23% 0.48 61.54
gi|24650465 CG31075 371(35) 15(4) 28% 0.53 47.32
gi|21358499 CG7430 125(35) 4(1) 8% 0.27 20.30
gi|24650465 CG31075 315(35) 8(4) 18% 0.45 54.22
gi|20129399 Aldehyde dehydrogenase 138(35) 3(2) 7% 0.12 14.46
gi|21358499 CG7430 116(35) 3(2) 10% 0.13 15.66
gi|10953881 thioredoxin reductase-1 75(35) 3(1) 6% 0.06 7.23
gi|24641811 upheld 38(35) 1(1) 3% 0.07 8.43
243(35)
0.5
5(4)
14% 0.3
0.3514%
699
867
DIGE Gels
w1118 / da>Wwox
879
DIGE Gels
Wwox Null
DIGE Gels
Wwox Null
9(4)
19%192(35) 9(4)
141(35)
50.85
55.56
38.89
515
w1118 / da>Wwox
DIGE Gels
687
DIGE Gels
156
Appendix G (continued)
* Number in parentheses represents number of queries over the peptide identity threshold score # Number in parentheses represents the protein identification threshold score
Spot Protein Sample Accession Name MOWSE#
Score
Queries*
Matched
Seq
CoverageemPAI mol%
gi|24664081
Fat body protein 1
CG17285 isoform Agi|24664085 Fat body protein 1
CG17285 isoform B
gi|1168232
6-phosphogluconate
dehydrogenase,
decarboxylating
gi|24639279 Phosphogluconate
dehydrogenase CG3724
gi|38570267 troponin T-5 242(35) 4(3) 17% 0.33 18.23
gi|7961 fat body protein 1 225(35) 6(3) 8% 0.21 11.60
gi|1200230S-adenosyl-L-homocysteine
hydrolase gi|20976844 GM02466p
gi|24642172Adenosylhomocysteinase at
13 CG11654gi|24582947 CG9510 148(35) 4(2) 10% 0.12 6.63
gi|17137654 Enolase CG17654 97(35) 2(1) 6% 0.15 8.29
gi|17137738 Rpt1 CG1341 46(35) 1(1) 2% 0.07 3.87
gi|7961 fat body protein 1 273(34) 6(4) 6% 0.18 13.53
gi|24664081Fat body protein 1 CG17285
isoform A
gi|24664085 Fat body protein 1 CG17285
isoform B
gi|20129399Aldehyde dehydrogenase
CG3752214(34) 5(3) 15% 0.25 18.80
gi|24650465 CG31075 192(34) 5(3) 14% 0.2 15.04gi|21358499 CG7430 155(34) 5(2) 13% 0.27 20.30
gi|10953881thioredoxin reductase-1
splice variant64(34) 3(0) 8% 0.2 15.04
gi|24661038 CG32351 52(34) 1(1) 1% 0.05 3.76
gi|24647881 CG7998 733(35) 14(10) 44% 2.49 96.14gi|19922568 CG15093 isoform B 63(35) 1(1) 4% 0.1 3.86
gi|24647881 CG7998 138(35) 6(1) 26% 0.44 81.48gi|17737731 CG7490 44(35) 1(1) 5% 0.1 18.52
DIGE Gels - - - - - - -
Wwox null gi|8647 Cu-Zn superoxide dismutase 94(35) 2(2) 20% 0.47 100.00
w1118
DIGE Gels
1468
w1118 / da>Wwox
DIGE Gels
12.15
13.53
24.31
14.92
177(35)
318(35) 6(3)
357(35) 8(5)
0.18256(34) 6(3) 6%
8%
1027
0.44
0.278%
2218
0.223(2)
17%
157
Appendix H
The amino acid sequence alignment of Wwox with the regions corresponding to identified peptides
represented by grey bars and the MS/MS amino acid identifications of these peptides marked by red
boxes, whereby the upper series of boxes represents the b-ions and the lower the y-ions. The black
boxes represent peptides with MOWSE scores exceeding the peptide identity threshold.
158
Appendix I
Supplementary mass spectrometry and database search results are presented on the accompanying
CD. A list of the files contained and their contents is presented below.
Supplementary MS data CD Table of contents:
Description File Name
Supplementary data for results presented in Table 4.3................................................... Supp. MS Data #1
Supplementary data for results presented in Table 5.3................................................... Supp. MS Data #2
Supplementary data for results presented in Table 6.7................................................... Supp. MS Data #3
Supplementary data for results presented in Table 6.8................................................... Supp. MS Data #4
Supplementary data for results presented in Table 6.9................................................... Supp. MS Data #5
Supplementary data for results presented in Table 6.10................................................. Supp. MS Data #6
Supplementary data for results presented in Figure 6.10................................................ Supp. MS Data #7
159
9 References
1. Yunis, J.J. and Soreng, A.L. (1984) Constitutive fragile sites and cancer. Science (New York, N.Y, 226, 1199-204.
2. Sutherland, G.R. (1979) Heritable fragile sites on human chromosomes I. Factors affecting expression in lymphocyte culture. American journal of human genetics, 31, 125-35.
3. Sutherland, G.R., Jacky, P.B. and Baker, E.G. (1984) Heritable fragile sites on human chromosomes. XI. Factors affecting expression of fragile sites at 10q25, 16q22, and 17p12. American journal of human genetics, 36, 110-22.
4. Glover, T.W., Berger, C., Coyle, J. and Echo, B. (1984) DNA polymerase alpha inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Human genetics, 67, 136-42.
5. Knight, S.J., Flannery, A.V., Hirst, M.C., Campbell, L., Christodoulou, Z., Phelps, S.R., Pointon, J., Middleton-Price, H.R., Barnicoat, A., Pembrey, M.E. et al. (1993) Trinucleotide repeat amplification and hypermethylation of a CpG island in FRAXE mental retardation. Cell, 74, 127-34.
6. Mulley, J.C., Yu, S., Loesch, D.Z., Hay, D.A., Donnelly, A., Gedeon, A.K., Carbonell, P., Lopez, I., Glover, G., Gabarron, I. et al. (1995) FRAXE and mental retardation. Journal of medical genetics, 32, 162-9.
7. Nancarrow, J.K., Holman, K., Mangelsdorf, M., Hori, T., Denton, M., Sutherland, G.R. and Richards, R.I. (1995) Molecular basis of p(CCG)n repeat instability at the FRA16A fragile site locus. Human molecular genetics, 4, 367-72.
8. Hewett, D.R., Handt, O., Hobson, L., Mangelsdorf, M., Eyre, H.J., Baker, E., Sutherland, G.R., Schuffenhauer, S., Mao, J.I. and Richards, R.I. (1998) FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis. Molecular cell, 1, 773-81.
9. Yu, S., Mangelsdorf, M., Hewett, D., Hobson, L., Baker, E., Eyre, H.J., Lapsys, N., Le Paslier, D., Doggett, N.A., Sutherland, G.R. et al. (1997) Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat. Cell, 88, 367-74.
10. Egeli, U., Karadag, M., Tunca, B. and Ozyardimci, N. (1997) The expression of common fragile sites and genetic predisposition to squamous cell lung cancers. Cancer genetics and cytogenetics, 95, 153-8.
11. Subhadra, N.V., Sundareshan, T.S. and Satyanarayana, M. (2003) Genetic susceptibility to oral cancer and the expression of common fragile sites. a study of 100 patients. Cancer genetics and cytogenetics, 140, 70-2.
12. Tunca, B., Egeli, U., Zorluoglu, A., Yilmazlar, T., Yerci, O. and Kizil, A. (2000) The expression frequency of common fragile sites and genetic predisposition to colon cancer. Cancer genetics and cytogenetics, 119, 139-45.
160
13. Tunca, B., Egeli, U., Zorluoglu, A., Yilmazlar, T., Yerci, O. and Kizil, A. (2000) The expression of fragile sites in lymphocytes of patients with rectum cancer and their first-degree relatives. Cancer letters, 152, 201-9.
14. Boldog, F., Gemmill, R.M., West, J., Robinson, M., Robinson, L., Li, E., Roche, J., Todd, S., Waggoner, B., Lundstrom, R. et al. (1997) Chromosome 3p14 homozygous deletions and sequence analysis of FRA3B. Human molecular genetics, 6, 193-203.
15. Inoue, H., Ishii, H., Alder, H., Snyder, E., Druck, T., Huebner, K. and Croce, C.M. (1997) Sequence of the FRA3B common fragile region: implications for the mechanism of FHIT deletion. Proceedings of the National Academy of Sciences of the United States of America, 94, 14584-9.
16. Mangelsdorf, M., Ried, K., Woollatt, E., Dayan, S., Eyre, H., Finnis, M., Hobson, L., Nancarrow, J., Venter, D., Baker, E. et al. (2000) Chromosomal fragile site FRA16D and DNA instability in cancer. Cancer research, 60, 1683-9.
17. Paige, A.J., Taylor, K.J., Stewart, A., Sgouros, J.G., Gabra, H., Sellar, G.C., Smyth, J.F., Porteous, D.J. and Watson, J.E. (2000) A 700-kb physical map of a region of 16q23.2 homozygously deleted in multiple cancers and spanning the common fragile site FRA16D. Cancer research, 60, 1690-7.
18. Corbin, S., Neilly, M.E., Espinosa, R., 3rd, Davis, E.M., McKeithan, T.W. and Le Beau, M.M. (2002) Identification of unstable sequences within the common fragile site at 3p14.2: implications for the mechanism of deletions within fragile histidine triad gene/common fragile site at 3p14.2 in tumors. Cancer research, 62, 3477-84.
19. Ohta, M., Inoue, H., Cotticelli, M.G., Kastury, K., Baffa, R., Palazzo, J., Siprashvili, Z., Mori, M., McCue, P., Druck, T. et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell, 84, 587-97.
20. Mimori, K., Druck, T., Inoue, H., Alder, H., Berk, L., Mori, M., Huebner, K. and Croce, C.M. (1999) Cancer-specific chromosome alterations in the constitutive fragile region FRA3B. Proceedings of the National Academy of Sciences of the United States of America, 96, 7456-61.
21. Wilke, C.M., Hall, B.K., Hoge, A., Paradee, W., Smith, D.I. and Glover, T.W. (1996) FRA3B extends over a broad region and contains a spontaneous HPV16 integration site: direct evidence for the coincidence of viral integration sites and fragile sites. Human molecular genetics, 5, 187-95.
22. Zanesi, N., Fidanza, V., Fong, L.Y., Mancini, R., Druck, T., Valtieri, M., Rudiger, T., McCue, P.A., Croce, C.M. and Huebner, K. (2001) The tumor spectrum in FHIT-deficient mice. Proceedings of the National Academy of Sciences of the United States of America, 98, 10250-5.
23. Siprashvili, Z., Sozzi, G., Barnes, L.D., McCue, P., Robinson, A.K., Eryomin, V., Sard, L., Tagliabue, E., Greco, A., Fusetti, L. et al. (1997) Replacement of Fhit in cancer cells suppresses tumorigenicity. Proceedings of the National Academy of Sciences of the United States of America, 94, 13771-6.
24. Cesari, R., Martin, E.S., Calin, G.A., Pentimalli, F., Bichi, R., McAdams, H., Trapasso, F., Drusco, A., Shimizu, M., Masciullo, V. et al. (2003) Parkin, a gene implicated in autosomal recessive juvenile parkinsonism, is a candidate tumor suppressor gene on chromosome 6q25-
161
q27. Proceedings of the National Academy of Sciences of the United States of America, 100, 5956-61.
25. Krummel, K.A., Roberts, L.R., Kawakami, M., Glover, T.W. and Smith, D.I. (2000) The characterization of the common fragile site FRA16D and its involvement in multiple myeloma translocations. Genomics, 69, 37-46.
26. Bednarek, A.K., Laflin, K.J., Daniel, R.L., Liao, Q., Hawkins, K.A. and Aldaz, C.M. (2000) WWOX, a novel WW domain-containing protein mapping to human chromosome 16q23.3-24.1, a region frequently affected in breast cancer. Cancer research, 60, 2140-5.
27. Ried, K., Finnis, M., Hobson, L., Mangelsdorf, M., Dayan, S., Nancarrow, J.K., Woollatt, E., Kremmidiotis, G., Gardner, A., Venter, D. et al. (2000) Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Human molecular genetics, 9, 1651-63.
28. Yakicier, M.C., Legoix, P., Vaury, C., Gressin, L., Tubacher, E., Capron, F., Bayer, J., Degott, C., Balabaud, C. and Zucman-Rossi, J. (2001) Identification of homozygous deletions at chromosome 16q23 in aflatoxin B1 exposed hepatocellular carcinoma. Oncogene, 20, 5232-8.
29. Watanabe, A., Hippo, Y., Taniguchi, H., Iwanari, H., Yashiro, M., Hirakawa, K., Kodama, T. and Aburatani, H. (2003) An opposing view on WWOX protein function as a tumor suppressor. Cancer research, 63, 8629-33.
30. Chang, N.S., Schultz, L., Hsu, L.J., Lewis, J., Su, M. and Sze, C.I. (2005) 17beta-Estradiol upregulates and activates WOX1/WWOXv1 and WOX2/WWOXv2 in vitro: potential role in cancerous progression of breast and prostate to a premetastatic state in vivo. Oncogene, 24, 714-23.
31. Sze, C.I., Su, M., Pugazhenthi, S., Jambal, P., Hsu, L.J., Heath, J., Schultz, L. and Chang, N.S. (2004) Down-regulation of WW domain-containing oxidoreductase induces Tau phosphorylation in vitro. A potential role in Alzheimer's disease. The Journal of biological chemistry, 279, 30498-506.
32. Mahajan, N.P., Whang, Y.E., Mohler, J.L. and Earp, H.S. (2005) Activated tyrosine kinase Ack1 promotes prostate tumorigenesis: role of Ack1 in polyubiquitination of tumor suppressor Wwox. Cancer research, 65, 10514-23.
33. Chang, N.S., Hsu, L.J., Lin, Y.S., Lai, F.J. and Sheu, H.M. (2007) WW domain-containing oxidoreductase: a candidate tumor suppressor. Trends in molecular medicine, 13, 12-22.
34. Chang, N.S., Pratt, N., Heath, J., Schultz, L., Sleve, D., Carey, G.B. and Zevotek, N. (2001) Hyaluronidase induction of a WW domain-containing oxidoreductase that enhances tumor necrosis factor cytotoxicity. The Journal of biological chemistry, 276, 3361-70.
35. Bednarek, A.K., Keck-Waggoner, C.L., Daniel, R.L., Laflin, K.J., Bergsagel, P.L., Kiguchi, K., Brenner, A.J. and Aldaz, C.M. (2001) WWOX, the FRA16D gene, behaves as a suppressor of tumor growth. Cancer research, 61, 8068-73.
36. Chang, N.S. (2002) Transforming growth factor-beta1 blocks the enhancement of tumor necrosis factor cytotoxicity by hyaluronidase Hyal-2 in L929 fibroblasts. BMC cell biology, 3, 8.
37. Chang, N.S. (2002) A potential role of p53 and WOX1 in mitochondrial apoptosis (review). International journal of molecular medicine, 9, 19-24.
162
38. Chen, S.T., Chuang, J.I., Cheng, C.L., Hsu, L.J. and Chang, N.S. (2005) Light-induced retinal damage involves tyrosine 33 phosphorylation, mitochondrial and nuclear translocation of WW domain-containing oxidoreductase in vivo. Neuroscience, 130, 397-407.
39. Rechsteiner, M. and Rogers, S.W. (1996) PEST sequences and regulation by proteolysis. Trends in biochemical sciences, 21, 267-71.
40. Rogers, S., Wells, R. and Rechsteiner, M. (1986) Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science (New York, N.Y, 234, 364-8.
41. Oppermann, U.C., Filling, C. and Jornvall, H. (2001) Forms and functions of human SDR enzymes. Chemico-biological interactions, 130-132, 699-705.
42. Moore, S., Pritchard, C., Lin, B., Ferguson, C. and Nelson, P.S. (2002) Isolation and characterization of the murine prostate short-chain dehydrogenase/reductase 1 (Psdr1) gene, a new member of the short-chain steroid dehydrogenase/reductase family. Gene, 293, 149-60.
43. Jornvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J. and Ghosh, D. (1995) Short-chain dehydrogenases/reductases (SDR). Biochemistry, 34, 6003-13.
44. Persson, B., Krook, M. and Jornvall, H. (1995) Short-chain dehydrogenases/reductases. Advances in experimental medicine and biology, 372, 383-95.
45. Kallberg, Y., Oppermann, U., Jornvall, H. and Persson, B. (2002) Short-chain dehydrogenases/reductases (SDRs). European journal of biochemistry / FEBS, 269, 4409-17.
46. Kallberg, Y., Oppermann, U., Jornvall, H. and Persson, B. (2002) Short-chain dehydrogenase/reductase (SDR) relationships: a large family with eight clusters common to human, animal, and plant genomes. Protein Sci, 11, 636-41.
47. Filling, C., Nordling, E., Benach, J., Berndt, K.D., Ladenstein, R., Jornvall, H. and Oppermann, U. (2001) Structural role of conserved Asn179 in the short-chain dehydrogenase/reductase scaffold. Biochemical and biophysical research communications, 289, 712-7.
48. Persson, B., Kallberg, Y., Oppermann, U. and Jornvall, H. (2003) Coenzyme-based functional assignments of short-chain dehydrogenases/reductases (SDRs). Chemico-biological interactions, 143-144, 271-8.
49. Aqeilan, R.I., Donati, V., Palamarchuk, A., Trapasso, F., Kaou, M., Pekarsky, Y., Sudol, M. and Croce, C.M. (2005) WW domain-containing proteins, WWOX and YAP, compete for interaction with ErbB-4 and modulate its transcriptional function. Cancer research, 65, 6764-72.
50. Aqeilan, R.I., Palamarchuk, A., Weigel, R.J., Herrero, J.J., Pekarsky, Y. and Croce, C.M. (2004) Physical and functional interactions between the Wwox tumor suppressor protein and the AP-2gamma transcription factor. Cancer research, 64, 8256-61.
51. Aqeilan, R.I., Pekarsky, Y., Herrero, J.J., Palamarchuk, A., Letofsky, J., Druck, T., Trapasso, F., Han, S.Y., Melino, G., Huebner, K. et al. (2004) Functional association between Wwox tumor suppressor protein and p73, a p53 homolog. Proceedings of the National Academy of Sciences of the United States of America, 101, 4401-6.
52. Jin, C., Ge, L., Ding, X., Chen, Y., Zhu, H., Ward, T., Wu, F., Cao, X., Wang, Q. and Yao, X. (2006) PKA-mediated protein phosphorylation regulates ezrin-WWOX interaction. Biochemical and biophysical research communications, 341, 784-91.
163
53. Ludes-Meyers, J.H., Kil, H., Bednarek, A.K., Drake, J., Bedford, M.T. and Aldaz, C.M. (2004) WWOX binds the specific proline-rich ligand PPXY: identification of candidate interacting proteins. Oncogene, 23, 5049-55.
54. Chang, N.S., Doherty, J. and Ensign, A. (2003) JNK1 physically interacts with WW domain-containing oxidoreductase (WOX1) and inhibits WOX1-mediated apoptosis. The Journal of biological chemistry, 278, 9195-202.
55. Chang, N.S., Doherty, J., Ensign, A., Schultz, L., Hsu, L.J. and Hong, Q. (2005) WOX1 is essential for tumor necrosis factor-, UV light-, staurosporine-, and p53-mediated cell death, and its tyrosine 33-phosphorylated form binds and stabilizes serine 46-phosphorylated p53. The Journal of biological chemistry, 280, 43100-8.
56. Paige, A.J., Taylor, K.J., Taylor, C., Hillier, S.G., Farrington, S., Scott, D., Porteous, D.J., Smyth, J.F., Gabra, H. and Watson, J.E. (2001) WWOX: a candidate tumor suppressor gene involved in multiple tumor types. Proceedings of the National Academy of Sciences of the United States of America, 98, 11417-22.
57. Driouch, K., Prydz, H., Monese, R., Johansen, H., Lidereau, R. and Frengen, E. (2002) Alternative transcripts of the candidate tumor suppressor gene, WWOX, are expressed at high levels in human breast tumors. Oncogene, 21, 1832-40.
58. Kuroki, T., Trapasso, F., Shiraishi, T., Alder, H., Mimori, K., Mori, M. and Croce, C.M. (2002) Genetic alterations of the tumor suppressor gene WWOX in esophageal squamous cell carcinoma. Cancer research, 62, 2258-60.
59. Ishii, H., Vecchione, A., Furukawa, Y., Sutheesophon, K., Han, S.Y., Druck, T., Kuroki, T., Trapasso, F., Nishimura, M., Saito, Y. et al. (2003) Expression of FRA16D/WWOX and FRA3B/FHIT genes in hematopoietic malignancies. Mol Cancer Res, 1, 940-7.
60. Aqeilan, R.I., Kuroki, T., Pekarsky, Y., Albagha, O., Trapasso, F., Baffa, R., Huebner, K., Edmonds, P. and Croce, C.M. (2004) Loss of WWOX expression in gastric carcinoma. Clin Cancer Res, 10, 3053-8.
61. Guler, G., Uner, A., Guler, N., Han, S.Y., Iliopoulos, D., Hauck, W.W., McCue, P. and Huebner, K. (2004) The fragile genes FHIT and WWOX are inactivated coordinately in invasive breast carcinoma. Cancer, 100, 1605-14.
62. Nunez, M.I., Ludes-Meyers, J., Abba, M.C., Kil, H., Abbey, N.W., Page, R.E., Sahin, A., Klein-Szanto, A.J. and Aldaz, C.M. (2005) Frequent loss of WWOX expression in breast cancer: correlation with estrogen receptor status. Breast cancer research and treatment, 89, 99-105.
63. Nunez, M.I., Rosen, D.G., Ludes-Meyers, J.H., Abba, M.C., Kil, H., Page, R., Klein-Szanto, A.J., Godwin, A.K., Liu, J., Mills, G.B. et al. (2005) WWOX protein expression varies among ovarian carcinoma histotypes and correlates with less favorable outcome. BMC cancer, 5, 64.
64. Gourley, C., Paige, A.J., Taylor, K.J., Scott, D., Francis, N.J., Rush, R., Aldaz, C.M., Smyth, J.F. and Gabra, H. (2005) WWOX mRNA expression profile in epithelial ovarian cancer supports the role of WWOX variant 1 as a tumour suppressor, although the role of variant 4 remains unclear. International journal of oncology, 26, 1681-9.
65. Chang, N.S., Carey, G., Pratt, N., Chu, E. and Ou, M. (1998) p53 overexpression and downregulation of inter-alpha-inhibitor are associated with hyaluronidase enhancement of TNF cytotoxicity in L929 fibroblasts. Cancer letters, 131, 45-54.
164
66. Hong, Q., Hsu, L.J., Schultz, L., Pratt, N., Mattison, J. and Chang, N.S. (2007) Zfra affects TNF-mediated cell death by interacting with death domain protein TRADD and negatively regulates the activation of NF-kappaB, JNK1, p53 and WOX1 during stress response. BMC molecular biology, 8, 50.
67. Lokeshwar, V.B., Cerwinka, W.H., Isoyama, T. and Lokeshwar, B.L. (2005) HYAL1 hyaluronidase in prostate cancer: a tumor promoter and suppressor. Cancer research, 65, 7782-9.
68. Chang, N.S., Doherty, J., Ensign, A., Lewis, J., Heath, J., Schultz, L., Chen, S.T. and Oppermann, U. (2003) Molecular mechanisms underlying WOX1 activation during apoptotic and stress responses. Biochemical pharmacology, 66, 1347-54.
69. Derijard, B., Hibi, M., Wu, I.H., Barrett, T., Su, B., Deng, T., Karin, M. and Davis, R.J. (1994) JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 76, 1025-37.
70. Fabbri, M., Iliopoulos, D., Trapasso, F., Aqeilan, R.I., Cimmino, A., Zanesi, N., Yendamuri, S., Han, S.Y., Amadori, D., Huebner, K. et al. (2005) WWOX gene restoration prevents lung cancer growth in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America, 102, 15611-6.
71. Qin, H.R., Iliopoulos, D., Semba, S., Fabbri, M., Druck, T., Volinia, S., Croce, C.M., Morrison, C.D., Klein, R.D. and Huebner, K. (2006) A role for the WWOX gene in prostate cancer. Cancer research, 66, 6477-81.
72. Aqeilan, R.I., Trapasso, F., Hussain, S., Costinean, S., Marshall, D., Pekarsky, Y., Hagan, J.P., Zanesi, N., Kaou, M., Stein, G.S. et al. (2007) Targeted deletion of Wwox reveals a tumor suppressor function. Proceedings of the National Academy of Sciences of the United States of America, 104, 3949-54.
73. Ludes-Meyers, J.H., Kil, H., Nunez, M.I., Conti, C.J., Parker-Thornburg, J., Bedford, M.T. and Aldaz, C.M. (2007) WWOX hypomorphic mice display a higher incidence of B-cell lymphomas and develop testicular atrophy. Genes, chromosomes & cancer, 46, 1129-36.
74. O'Keefe, L.V., Liu, Y., Perkins, A., Dayan, S., Saint, R. and Richards, R.I. (2005) FRA16D common chromosomal fragile site oxido-reductase (FOR/WWOX) protects against the effects of ionizing radiation in Drosophila. Oncogene, 24, 6590-6.
75. Rong, Y.S. and Golic, K.G. (2000) Gene targeting by homologous recombination in Drosophila. Science (New York, N.Y, 288, 2013-8.
76. Rong, Y.S., Titen, S.W., Xie, H.B., Golic, M.M., Bastiani, M., Bandyopadhyay, P., Olivera, B.M., Brodsky, M., Rubin, G.M. and Golic, K.G. (2002) Targeted mutagenesis by homologous recombination in D. melanogaster. Genes & development, 16, 1568-81.
77. Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development (Cambridge, England), 118, 401-15.
78. O'Keefe, L.V., Smibert, P., Colella, A., Chataway, T.K., Saint, R. and Richards, R.I. (2007) Know thy fly. Trends Genet, 23, 238-42.
79. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-5.
165
80. Healthcare, G. (2004) 2-D Electrophoresis - Principles and Methods.
81. Unlu, M., Morgan, M.E. and Minden, J.S. (1997) Difference gel electrophoresis: a single gel method for detecting changes in protein extracts. Electrophoresis, 18, 2071-7.
82. Hatzopoulos, P., Craddock, E.M. and Kambysellis, M.P. (1989) DNA length variants contiguous to the 3' end of a vitellogenin gene in Drosophila grimshawi laboratory stocks from different Hawaiian Islands. Biochemical genetics, 27, 367-77.
83. Thibault, S.T., Singer, M.A., Miyazaki, W.Y., Milash, B., Dompe, N.A., Singh, C.M., Buchholz, R., Demsky, M., Fawcett, R., Francis-Lang, H.L. et al. (2004) A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nature genetics, 36, 283-7.
84. Radyuk, S.N., Klichko, V.I. and Orr, W.C. (2004) Profiling Cu,Zn-superoxide dismutase expression in Drosophila melanogaster--a critical regulatory role for intron/exon sequence within the coding domain. Gene, 328, 37-48.
85. Blander, G., de Oliveira, R.M., Conboy, C.M., Haigis, M. and Guarente, L. (2003) Superoxide dismutase 1 knock-down induces senescence in human fibroblasts. The Journal of biological chemistry, 278, 38966-9.
86. Bubici, C., Papa, S., Pham, C.G., Zazzeroni, F. and Franzoso, G. (2004) NF-kappaB and JNK: an intricate affair. Cell cycle (Georgetown, Tex, 3, 1524-9.
87. Yamamoto, A., Miyazaki, T., Kadono, Y., Takayanagi, H., Miura, T., Nishina, H., Katada, T., Wakabayashi, K., Oda, H., Nakamura, K. et al. (2002) Possible involvement of IkappaB kinase 2 and MKK7 in osteoclastogenesis induced by receptor activator of nuclear factor kappaB ligand. J Bone Miner Res, 17, 612-21.
88. Li, D., Ueta, E., Kimura, T., Yamamoto, T. and Osaki, T. (2004) Reactive oxygen species (ROS) control the expression of Bcl-2 family proteins by regulating their phosphorylation and ubiquitination. Cancer science, 95, 644-50.
89. Streicher, K.L., Yang, Z.Q., Draghici, S. and Ethier, S.P. (2007) Transforming function of the LSM1 oncogene in human breast cancers with the 8p11-12 amplicon. Oncogene, 26, 2104-14.
90. Lyng, H., Brovig, R.S., Svendsrud, D.H., Holm, R., Kaalhus, O., Knutstad, K., Oksefjell, H., Sundfor, K., Kristensen, G.B. and Stokke, T. (2006) Gene expressions and copy numbers associated with metastatic phenotypes of uterine cervical cancer. BMC genomics, 7, 268.
91. Shisheva, A., Sudhof, T.C. and Czech, M.P. (1994) Cloning, characterization, and expression of a novel GDP dissociation inhibitor isoform from skeletal muscle. Molecular and cellular biology, 14, 3459-68.
92. Allcock, R.J., Price, P., Gaudieri, S., Leelayuwat, C., Witt, C.S. and Dawkins, R.L. (1999) Characterisation of the human central MHC gene, BAT1: genomic structure and expression. Experimental and clinical immunogenetics, 16, 98-106.
93. Allcock, R.J., Williams, J.H. and Price, P. (2001) The central MHC gene, BAT1, may encode a protein that down-regulates cytokine production. Genes Cells, 6, 487-94.
94. Moon, H.M., Redfield, B. and Weissbach, H. (1972) Interaction of eukaryote elongation factor EF 1 with guanosine nucleotides and aminoacyl-tRNA. Proceedings of the National Academy of Sciences of the United States of America, 69, 1249-52.
166
95. Shikama, N., Ackermann, R. and Brack, C. (1994) Protein synthesis elongation factor EF-1 alpha expression and longevity in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America, 91, 4199-203.
96. Stearns, S.C. and Kaiser, M. (1993) The effects of enhanced expression of elongation factor EF-1 alpha on lifespan in Drosophila melanogaster. IV. A summary of three experiments. Genetica, 91, 167-82.
97. Elenich, L.A., Nandi, D., Kent, A.E., McCluskey, T.S., Cruz, M., Iyer, M.N., Woodward, E.C., Conn, C.W., Ochoa, A.L., Ginsburg, D.B. et al. (1999) The complete primary structure of mouse 20S proteasomes. Immunogenetics, 49, 835-42.
98. Kramer, J.M. and Staveley, B.E. (2003) GAL4 causes developmental defects and apoptosis when expressed in the developing eye of Drosophila melanogaster. Genet Mol Res, 2, 43-7.
99. Rezaval, C., Werbajh, S. and Ceriani, M.F. (2007) Neuronal death in Drosophila triggered by GAL4 accumulation. The European journal of neuroscience, 25, 683-94.
100. Ishihama, Y., Oda, Y., Tabata, T., Sato, T., Nagasu, T., Rappsilber, J. and Mann, M. (2005) Exponentially modified protein abundance index (emPAI) for estimation of absolute protein amount in proteomics by the number of sequenced peptides per protein. Mol Cell Proteomics, 4, 1265-72.
101. Lim, H., Eng, J., Yates, J.R., 3rd, Tollaksen, S.L., Giometti, C.S., Holden, J.F., Adams, M.W., Reich, C.I., Olsen, G.J. and Hays, L.G. (2003) Identification of 2D-gel proteins: a comparison of MALDI/TOF peptide mass mapping to mu LC-ESI tandem mass spectrometry. Journal of the American Society for Mass Spectrometry, 14, 957-70.
102. Sanders, W.S., Bridges, S.M., McCarthy, F.M., Nanduri, B. and Burgess, S.C. (2007) Prediction of peptides observable by mass spectrometry applied at the experimental set level. BMC bioinformatics, 8 Suppl 7, S23.
103. Burmester, T., Antoniewski, C. and Lepesant, J.A. (1999) Ecdysone-regulation of synthesis and processing of fat body protein 1, the larval serum protein receptor of Drosophila melanogaster. European journal of biochemistry / FEBS, 262, 49-55.
104. Adessi, C., Miege, C., Albrieux, C. and Rabilloud, T. (1997) Two-dimensional electrophoresis of membrane proteins: a current challenge for immobilized pH gradients. Electrophoresis, 18, 127-35.
105. Wilkins, M.R., Gasteiger, E., Sanchez, J.C., Bairoch, A. and Hochstrasser, D.F. (1998) Two-dimensional gel electrophoresis for proteome projects: the effects of protein hydrophobicity and copy number. Electrophoresis, 19, 1501-5.
106. Ishii, N., Nakahigashi, K., Baba, T., Robert, M., Soga, T., Kanai, A., Hirasawa, T., Naba, M., Hirai, K., Hoque, A. et al. (2007) Multiple high-throughput analyses monitor the response of E. coli to perturbations. Science (New York, N.Y, 316, 593-7.
107. Ludes-Meyers, J.H., Bednarek, A.K., Popescu, N.C., Bedford, M. and Aldaz, C.M. (2003) WWOX, the common chromosomal fragile site, FRA16D, cancer gene. Cytogenetic and genome research, 100, 101-10.
108. Yang, Y., Thannhauser, T.W., Li, L. and Zhang, S. (2007) Development of an integrated approach for evaluation of 2-D gel image analysis: impact of multiple proteins in single spots on comparative proteomics in conventional 2-D gel/MALDI workflow. Electrophoresis, 28, 2080-94.
167
109. Vasiliou, V., Pappa, A. and Estey, T. (2004) Role of human aldehyde dehydrogenases in endobiotic and xenobiotic metabolism. Drug metabolism reviews, 36, 279-99.
110. Mitchell, D.Y. and Petersen, D.R. (1987) The oxidation of alpha-beta unsaturated aldehydic products of lipid peroxidation by rat liver aldehyde dehydrogenases. Toxicology and applied pharmacology, 87, 403-10.
111. Andres, A.J., Fletcher, J.C., Karim, F.D. and Thummel, C.S. (1993) Molecular analysis of the initiation of insect metamorphosis: a comparative study of Drosophila ecdysteroid-regulated transcription. Developmental biology, 160, 388-404.
112. Anderson, S.M., Brown, M.R. and McDonald, J.F. (1991) Tissue specific expression of the Drosophila Adh gene: a comparison of in situ hybridization and immunocytochemistry. Genetica, 84, 95-100.
113. Anderson, S.M. and Barnett, S.E. (1991) The involvement of alcohol dehydrogenase and aldehyde dehydrogenase in alcohol/aldehyde metabolism in Drosophila melanogaster. Genetica, 83, 99-106.
114. Leal, J.F. and Barbancho, M. (1993) Aldehyde dehydrogenase (ALDH) activity in Drosophila melanogaster adults: evidence for cytosolic localization. Insect biochemistry and molecular biology, 23, 543-7.
115. Simon, H.U., Haj-Yehia, A. and Levi-Schaffer, F. (2000) Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis, 5, 415-8.
116. Salganik, R.I. (2001) The benefits and hazards of antioxidants: controlling apoptosis and other protective mechanisms in cancer patients and the human population. Journal of the American College of Nutrition, 20, 464S-472S; discussion 473S-475S.
117. Smith, D.I., McAvoy, S., Zhu, Y. and Perez, D.S. (2007) Large common fragile site genes and cancer. Seminars in cancer biology, 17, 31-41.
118. Zhu, Y., McAvoy, S., Kuhn, R. and Smith, D.I. (2006) RORA, a large common fragile site gene, is involved in cellular stress response. Oncogene, 25, 2901-8.
119. Smith, D.I., Zhu, Y., McAvoy, S. and Kuhn, R. (2006) Common fragile sites, extremely large genes, neural development and cancer. Cancer letters, 232, 48-57.
168
169
170