Post on 03-Feb-2018
C!
A!
B!
geneX!::kanMX6 otr::ura4+-natMX6
geneX!::kanMX6 otr::ura4+-natMX6 X
. . . Mating and sporulation Selection
cnt1 imr1L imr1R otr1L otr1R
otr::ura4+ natMX6
dcr1!::hphMX6 X
Mating and sporulation Selection
geneX!::kanMX6 otr::ura4+-natMX6 dcr1!::hphMX6
FOA
. . .
poz1!
Supplementary Figure 1: Screen of the fission yeast deletion library for mutants that rescue dcr1! defects in pericentric heterochromatin assembly. (A) A schematic diagram of the otr::ura4+-NatMX6 query strain. (B) Workflow to introduce otr::ura4+ and dcr1! into the deletion library. (C) A representative picture of strains grown on FOA-containing medium. Each box represents a single mutant in quadruplicate. The position of poz1! is indicated. The silencing of the ura4+ reporter results in increased growth on FOA-containing medium.
Tadeo_FigS1
geneX!::kanMX6 otr::ade6+-natMX6 dcr1!::hphMX6
geneX!::kanMX6 otr::ade6+-natMX6 ago1!::hphMX6
cnt1 imr1L imr1R otr1L otr1R
otr::ade6+ natMX6
A!
B!
C!
poz1!
poz1!
Supplementary Figure 2: Screens of the fission yeast deletion library for mutants that bypass RNAi for pericentric heterochromatin assembly. (A) Top, a schematic diagram of the otr::ade6+-NatMX6 query strain. Bottom, cells were grown on low adenine (YE) medium to measure otr::ade6+ expression. Red colonies indicate that otr::ade6+ was silenced, and white colonies indicate that otr::ade6+ lost silencing. (B, C) Representative pictures of strains grown on YE medium. The position of poz1! is indicated.
otr::ade6+
WT dcr1!
ago1!
Tadeo_FigS2
WT rap1! swi6!
rap1! swi6!
WT rap1! rdp1!
rap1! rdp1!
WT rap1! arb2!
rap1! arb2!
WT rap1! clr4!
rap1! clr4!
WT rap1! chp1!
rap1! chp1!
WT rap1! clr3!
rap1! clr3!
WT rap1! ago1!
rap1! ago1!
otr::ura4+ control FOA TBZ
Supplementary Figure 3: Loss of shelterin components Rap1 or Taz1 bypasses RNAi for pericentric heterochromatin assembly. Serial dilution analyses of indicated yeast strains were performed to measure otr::ura4+ expression and sensitivity to TBZ.
WT taz1!
ago1! taz1! ago1!
otr::ura4+ control FOA TBZ
A!
B!
Tadeo_FigS3
Supplementary Figure 4: Residual H3K9me in RNAi mutants is required for taz1!, rap1!, and OE-swi6+ to rescue dcr1! defects in pericentric heterochromatin assembly. Serial dilution analysis of indicated strains to measure the expression of otr::ura4+.
WT dcr1!
rap1! dcr1! rap1! clr3! dcr1!
WT dcr1!
taz1! dcr1! taz1! clr3! dcr1!
otr::ura4+ control FOA
WT OE-swi6+
dcr1! OE-swi6+ dcr1!
clr3! OE-swi6+ clr3!
dcr1! clr3! OE-swi6+ dcr1! clr3!
WT sir2!
dcr1! sir2! dcr1!
poz1! dcr1! poz1! sir2! dcr1!
OE-swi6+ dcr1! OE-swi6+ sir2! dcr1!
Tadeo_FigS4
WT GBD-Clr4 OE-swi6+
GBD-Clr4 OE-swi6+
GBD-Clr4 poz1!
3xgbs
ade6+
Supplementary Figure 5: Overexpression of Swi6 enhances ectopic heterochromatin assembly. (A) Western blot analyses were performed to measure Swi6 protein levels. The OE-swi6+ strain also contains endogenous swi6+. (B) Top, schematic diagram of the 3xgbs-ade6+ reporter construct where 3 copies of Gal4 binding sites were inserted near the promoter of ade6+. Bottom, Serial dilution analysis of indicated strains grown on low adenine medium to measure the expression of 3xgbs-ade6+. Note that GBD-Clr4 is insufficient to induce silencing of the 3xgbs-ade6+ reporter unless Swi6 is overexpressed or in poz1! cells. GBD-Clr4 can also induce silencing of 3xgbs-ade6+ reporter in dcr1! or GBD-Clr4-!CD, which results in pericentric heterochromatin defects and the release of Swi6 at these regions (Kagansky et al., 2009).
WT Rap1-GBD
OE-swi6+ Rap1-GBD OE-swi6+
1 1/2
1/4
1 1/2
1/4
1/8
OE-swi6+ WT
"-Swi6
Ponceau S
A
B
3xgbs-ade6+ YE
Tadeo_FigS5
Rap1-GBD OE-swi6+ clr4!
Supplementary Figure 6. Isolation of Poz1 separation-of-function mutants. (A) Sequence alignment of Poz1 from four fission yeast species. The mutated residues are highlighted in red. (B) All mutations were introduced into the endogenous poz1+ locus. Silencing of TEL::ura4+ was measured by growth on medium without uracil. Telomere length was measured by Southern blot analyses of EcoRI digested DNA with a telomere probe. Poz1 protein levels were measured by Western blot analyses with a myc antibody.
Genotype TEL::ura4+ telomere length Protein levels
WT + + +++
poz1! ++++ ++++ -
E158R + + +++
I162R + + +++
F170A ++ + +++
L188R ++ + +++
W209A ++++ + +++
L216R ++++ ++++ ++
I220R ++++ ++++ +
Tadeo_FigS6
A
B
Supplementary Figure 7: Heterochromatin assembly pathways near telomeres. (A) Schematic diagram of pathways that regulate silencing at native telomeres. The tlh1+ gene, telomeric repeats, and TAS sequence independently nucleate heterochromatin assembly, which then spreads into neighboring regions. (B) Schematic diagram of the TEL::ura4+ reporter, which is located on mini-chromosome Ch16. Due to the lack of redundant mechanisms, the effect of shelterin on heterochromatin silencing is more apparent.
A
B
RNAi Shelterin ?
Telomere repeats tlh1+ TAS
Native Telomere
ura4+
TEL::ura4+
spreading
Tadeo_FigS7
control FOA otr::ura4+ TBZ WT
OE-swi6+ ago1!
OE-swi6+ ago1!
WT OE-swi6+
rdp1! OE-swi6+ rdp1!
WT OE-swi6+
clr4! OE-swi6+ clr4!
WT OE-swi6+
swi6! OE-swi6+ swi6!
Supplementary Figure 8: Overexpression of Swi6 rescues RNAi mutants’ defects in pericentric heterochromatin assembly. Serial dilution analyses of indicated yeast strains were performed to measure otr::ura4+ expression and sensitivity to TBZ. All strains containing OE-swi6+ also contain endogenous swi6+, except for swi6!. 2xswi6+ and 2xchp2+ strains contain additional copies of swi6+ and chp2+, respectively, inserted at the ars1 locus and driven under the control of their endogenous promoters.
Tadeo_FigS8
WT 2xswi6+
dcr1! 2xswi6+ dcr1!
WT 2xchp2+
dcr1! 2xchp2+ dcr1!
control FOA otr::ura4+ TBZ
A
B
EMM-Leu EMM-Leu+FOA otr::ura4+
pREP41 pREP41-chp2+
pREP41-clr3+ pREP41-clr4+
pREP41 dcr1! pREP41-chp2+ dcr1!
pREP41-clr3+ dcr1! pREP41-clr4+ dcr1!
C
Position in library
Annotated identity
Real identity
otr::ura4+
dcr1! otr::ade6+
dcr1! otr::ade6+
ago1!
B22-F02 poz1! poz1! Yes Yes Yes
B31-F10 rap1! rap1! Yes Yes Yes
B35-E12 taz1! N.A. No No No
B16-A02 ccq1! ccq1! No Yes Yes
B29-E01 sde2! sde2! Yes Yes Yes
B25-D04 ppm1! poz1! Yes Yes Yes
B29-B12 SPAC27E2.11c! sde2! Yes Yes Yes
Supplementary Table 1: Identification of telomere regulator mutants that bypass RNAi for pericentric heterochromatin assembly.
Among shelterin components, poz1! and rap1! were consistently identified in three independent screens. Position B35-E12 in the library was annotated as taz1!, but our PCR analyses indicated that the taz1+ gene is intact, explaining why it was not identified in our screen. Two other positions, annotated as ppm1! and SPAC27E2.11c!, were confirmed by barcode sequencing and PCR analyses to be poz1! and sde2!, respectively.
Tadeo_Table S1
Tadeo_Table S2
Table S2: Yeast strains used in this study Name Genotype Used in Figure
BR172 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+
1A, 1B, 1C, 1D, 1E, 2A, 2B, 3A, 3B, 3C, 4D, 5E, 6A, 6B, 6C, 6D, 4C, S3A, S3B, S4, S5A, S8A, S8B
XT477 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ poz1∆::KanMX6 1A, 1B, 1C, 1D, 1E, 2A, 2B, 5C, 5D
BR177 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ dcr1∆::HphMX6
1A, 1B, 1C, 1D, 1E, 3C, 4D, 5E, 6A, 6B, 6C, 6D, 4C, S4, S8B
XT252 mat1Msmt0 leu1-32 his2 ura4-D18 ade6-210 otr1R::ura4+ dcr1∆::hphMX6 poz1∆::KanMX6
1A, 1B, 1C, 1D, 1E, 3C, 4C, S4
SPJ3116 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ ago1∆::HphMX6 2A, S3A, S3B, S8A
XT440 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ ago1∆::KanMX6 poz1∆::KanMX6 2A
BR229 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ chp1∆::kanMX6 2A,S3A
XT681 mat1Msmt0 leu1-32 his2 ura4 ade6-216 otr1R::ura4+ chp1∆::KanMX6 poz1∆::KanMX6 2A
BR284 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ rdp1∆::KanMX6 2A, S3A, S8A
XT677 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ rdp1∆::KanMX6 poz1∆::KanMX6 2A
BR910 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ clr4∆::KanMX6 2B, S3A, S8A
XT675 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ clr4∆::KanMX6 poz1∆::KanMX6 2B
BR378 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ swi6∆::KanMX6 2B, S3A
XT682 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ura4+ swi6∆::KanMX6 poz1∆::KanMX6 2B
BR298 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ clr3∆::KanMX6 2B, S3A, S4
SPJ4213 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ clr3∆::KanMX6 poz1∆::KanMX6 2B
XT243 h+ leu1-32 ura4 ade6-210 dcr1∆::hphMX6 poz1∆::KanMX6 3A
SPJ4164 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ poz1∆::HphMX6 dcr1∆::NatMX6 clr4∆::KanMX6 3A, 3B
XT252 mat1Msmt0 leu1-32 his2 ura4-D18 ade6-210 otr1R::ura4+ dcr1∆::HphMX6 poz1∆::KanMX6 (maintenance cross) 3A, 3B
SPJ4185 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ poz1∆::HphMX6 dcr1∆::NatMX6 (establishment cross) 3A, 3B
XT611 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ clr3∆::KanMX6 dcr1∆::NatMX6 3C, S4
XT641 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ura4+sir2∆::KanMX6 dcr1∆::HphMX6 3C, S4
XT745 h+ leu1-32 ura4 ade6-210 otr1R::ura4+ sir2∆::KanMX6 dcr1∆::HphMX6 poz1∆::KanMX6 3C, S4
XT742 mat1Msmt0 leu1-32 his2 ura4 ade6-216 otr1R::ura4+ dcr1∆::HphMX6 poz1∆::KanMX6 clr3∆::KanMX6 3C
Tadeo_Table S2 SPJ3693 h- leu1-32 ura4-DS/E or D18 Poz1-3Flag::LEU2 4B
SPJ3972 mat1Msmt0 leu1-32 his2 ura4-DS/E or D18 ade6-216 Poz1-Flag::LEU2 dcr1∆::NatMX6 4B
SPJ649 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 4B, 5B, 5C
XT149 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ura4+-NatMX6 rap1∆::KanMX4 4D, S3A
XT156 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+-NatMX6 dcr1∆::HphMX6 rap1∆::KanMX6 4D, 4C, S4
XT424 h+ leu1-32 ura4-DS/E ade6-210 otr1R::ura4+ taz1∆::NatMX6 4D, S3B
XT475 h+ leu1-32 ura4-DS/E ade6-210 otr1R::ura4+ dcr1∆::HphMX6 taz1∆::NatMX6 4D, 4C, S4
XT083 h+ leu1-32 ura4-DS/E ade6-210 otr1R::ura4+ trt1∆::KanMX6 4D XT090 h+ leu1-32 ura4-DS/E ade6-210 otr1R::ura4+ trt1∆::KanMX6 dcr1∆::HphMX6 4D SPJ4031 h- leu1-32 ura4-DS/E ade6-210 otr1R::ura4+ ccq1-T93A-5Flag::KanMX6 4D
SPJ4088 h- leu1-32 ura4 ade6-210 otr1R::ura4+ ccq1-T93A-5Flag::KanMX6 dcr1∆::NatMX6 4D
XT1233 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ tpz1∆::kanMX6 4D XT1175 h+ leu1-32 ura4-DS/E ade6-216 otr1R::ura4+ pot1∆::kanMX6 4D XT1231 h+ leu1-32 ura4-DS/E ade6-216 otr1R::ura4+ tpz1∆::kanMX6 dcr1∆::NatMX6 4D
XT1174 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pot1∆::kanMX6 dcr1∆::NatMX6 4D
XT661 mat1Msmt0 leu1-32 his2 ura4 ade6-216 otr1R::ura4+sde2∆::KanMX6 4D
XT659 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ura4+sde2∆::KanMX6 dcr1∆::NatMX6 4D
SPJ3601 h+ leu1-32 ura4::3GBS-ade6+ ade6∆::Swi6-HphMX6 5A, S5A,S5B
SPJ4045 mat1Msmt0 leu1-32 his2 rap1-GBD::NatMX6 ura4::3GBS-ade6+ ade6∆::Swi6-HphMX6 5A
XT736 mat1Msmt0 leu1-32 his2 rap1-GBD::NatMX6 ura4::3GBS-ade6+ ade6∆::Swi6-HphMX6 poz1∆::NatMX6 5A
XT673 h+ leu1-32 rap1-GBD::NatMX6 ura4::3GBS-ade6+ ade6∆::Swi6-HphMX6 taz1∆::natMX6 5A
SPJ4180 mat1Msmt0 leu1-32 his2 rap1-GBD::NatMX6 ura4::3GBS-ade6+ ade6∆::Swi6-HphMX6 poz1-W209A-13myc::KanMX6 5A
XT805 mat1Msmt0 leu1-32 his2 rap1-GBD::NatMX6 ura4::3GBS-ade6+ ade6∆::Swi6-HphMX6 clr4∆::KanMX6 5A, S5B
SPJ4064 h+ leu1-32 his3 ura4-D18 ade6-216 poz1-13myc::KanMX6 5B, 5C, S6B SPJ4006 h+ leu1-32 his3 ura4-D18 ade6-210 poz1-W209A-13myc::KanMX6 5B, 5C
SPJ529 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 Ch16 (m23::ura4 Tel72 ade6-216) 5D, S6B
XT588 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 poz1∆::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) 5D,S6B
SPJ4005 h+ leu1-32 ura4 poz1-W209A-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) 5D, S6B
SPJ2242 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 clr4∆::KanMX6; Ch16 (m23:::ura4 Tel72 ade6-216) 5D
SPJ4124 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ura4+ poz1-W209A-13myc::KanMX6
5E, 6A, 6B, 6C, S6B
SPJ4126 mat1Msmt0 leu1-32 his2 ura4-DS/E or D18 ade6-210 otr1R::ura4+ poz1-W209A-13myc::KanMX6 dcr1∆::NatMX6 5E, 6A 6B, 6C
SPJ3560 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6∆::Swi6-HphMX6 otr1R::ura4+ 6D, S4, S8A
SPJ3628 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6∆::Swi6-HphMX6 otr1R::ura4+
dcr1∆::NatMX6 6D, S4
SPJ2988 mat1Msmt0 leu1-32 ura4-D18 ade6-210 Mat1M-cyhs, rpl42::cyhR; otr::ura4+-NatMX6 S1A, S1B
Tadeo_Table S2 XT150 mat1Msmt0 leu1-32 ura4-DS/E ade6-210 dcr1∆::hphMX6 Mat1Msmto-cyhS S1B SPJ2976 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ade6+ S2A SPJ2980 mat1Msmt0 leu1-32 his2 ura4 ade6-210 otr1R::ade6+ dcr1∆::NatMX6 S2A
XT269 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+-Nat, ago1∆::HphMX6 rap1∆::KanMX4 S3A
XT385 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ arb2∆::KanMX6 S3A
XT332 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ arb2∆::KanMX6 rap1∆::HphMX4 S3A
XT469 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ chp1∆::KanMX6 rap1∆::HphMX4 S3A
XT372 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ rdp1∆::KanMX6 rap1∆::HphMX4 S3A
XT375 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ clr4∆::KanMX6 rap1∆::HphMX4 S3A
XT360 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ swi6∆::KanMX4 rap1∆::HphMX4 S3A
XT417 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 otr1R::ura4+ rap1∆::HphMX4 clr3∆::KanMX6 S3A
XT420 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ taz1∆::NatMX6 ago1∆::KanMX6 S3B
XT623 h+ leu1-32 his3 ura4-DS/E ade6-216 otr1R::ura4 rap1∆::HphMX4 dcr1∆::NatMX6 clr3∆::KanMX6 S4
XT667 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+dcr1∆::HphMX6 taz1∆::NatMX6 clr3∆::KanMX6 S4
BR579 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+sir2∆::KanMX4 S4
SPJ4216 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6∆::Swi6-HphMX6 otr1R::ura4+ sir2∆::KanMX4 dcr1∆::NatMX6 S4
SPJ3748 h+ leu1-32 ura4-DS/E ade6∆::Swi6-HphMX6 otr1R::ura4+clr3∆::kanMX6 S4
SPJ4020 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6∆::Swi6-HphMX6 otr1R::ura4+
dcr1∆::NatMX6 clr3∆::kanMX6 S4
SPJ2944 h- ade6-DN/N ura4::3GBS-ade6+ S5B SPJ2971 h- ade6-DN/N ura4::3GBS-ade6+ GBD-Clr4-HphMX6 S5B SPJ3603 h+ leu1-32 ade6∆::Swi6-HphMX6 ura4::3GBS-ade6+ GBD-Clr4-HphMX6 S5B XT657 mat1Msmt0 leu1-32 his2 ade6∆ rap1-GBD::KanMX6 ura4::3GBS-ade6+ S5B
XT655 mat1Msmt0 leu1-32 his2 ade6∆ rap1-GBD::KanMX6 ura4::3GBS-ade6+
ade6∆::Swi6-HphMX6 S5B
XT905 h? leu1-32 his? ade6-210 ura4::3GBS-ade6+ GBD-clr4-HphMX6 poz1∆::KanMX6 S5B
SPJ3991 h+ leu1-32 ura4 ade6-210 poz1-E158R-13myc::KanMX6 S6B SPJ3993 h+ leu1-32 ura4 ade6-210 poz1-E162R-13myc::KanMX6 S6B SPJ3995 h+ leu1-32 ura4 ade6-216 poz1-F170A-13myc::KanMX6 S6B SPJ3999 h+ leu1-32 ura4 ade6-210 poz1-L188R-13myc::KanMX6 S6B SPJ4009 h+ leu1-32 ura4 ade6-210 poz1-L216R-13myc::KanMX6 S6B SPJ4011 h+ leu1-32 ura4 ade6-210 poz1-I220R-13myc::KanMX6 S6B
SPJ3992 h? leu1-32 his? ura4 ade6-210 poz1-E158R-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) S6B
SPJ3994 h+ leu1-32 ura4 ade6-210 poz1-E162R-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) S6B
SPJ3995 h+ leu1-32 ura4 ade6-216 poz1-F170A-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) S6B
SPJ4000 h+ leu1-32 ura4 ade6-210 poz1-L188R-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) S6B
SPJ4010 h+ leu1-32 ura4 ade6-210 poz1-L216R-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) S6B
Tadeo_Table S2
SPJ4012 h+ leu1-32 ura4 ade6-210 poz1-I220R-13myc::KanMX6 Ch16 (m23::ura4 Tel72 ade6-216) S6B
SPJ3743 mat1Msmt0 leu1-32 his2 ura4-DS/E otr1R::ura4+ ade6∆::Swi6-HphMX6 ago1∆::KanMX6 S8A
SPJ3740 h+ leu1-32 ura4-DS/E otr1R::ura4+ ade6∆::Swi6-HphMX6 rdp1∆::KanMX6 S8A
SPJ3746 mat1Msmt0 leu1-32 his2 ura4-DS/E otr1R::ura4+ ade6∆::Swi6-HphMX6
clr4∆::KanMX6 S8A
SPJ3562 mat1Msmt0 leu1-32 his2 ura4-DS/E otr1R::ura4+ ade6∆::Swi6-HphMX6
swi6∆::KanMX6 S8A
XT1199 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 ars1::pREsw-swi6+-LEU2, otr1R::ura4+ S8B
XT1176 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 ars1::pREsw-swi6+-LEU2, otr1R::ura4+ dcr1∆::NatMX6 S8B
XT1201 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 ars1::pREch-chp2+-LEU2, otr1R::ura4+ S8B
XT1186 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-216 ars1::pREch-chp2+-LEU2, otr1R::ura4+ dcr1∆::NatMX6 S8B
XT521 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pREP41-GFP dcr1∆::hphMX6 S8C
XT1195 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pREP41-chp2+ S8C XT1188 h+ leu1-32 ura4-DS/E ade6-216 otr1R::ura4+ pREP41-chp2+ dcr1∆::NatMX6 S8C XT1198 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pREP41-clr3+ S8C
XT1192 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pREP41-clr3+ dcr1∆::NatMX6 S8C
XT524 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pREP41-clr4 S8C
XT522 mat1Msmt0 leu1-32 his2 ura4-DS/E ade6-210 otr1R::ura4+ pREP41-clr4 dcr1∆::hphMX6
S8C
Tadeo_Table S3
Primer name Sequence Purpose
act1-RT-A AACCCTCAGCTTTGGGTCTT ChIP and RT-PCR of act1
act1-RT-B TTTGCATACGATCGGCAATA ChIP and RT-PCR of act1
dh-RT-3 AATGACAAAGGTGCCGAATC ChIP and RT-PCR of dh
dh-RT-4 CGTTGAATGTTGTTGCTTTCA ChIP and RT-PCR of dh
tlh-RT-1 GAGAGAGCGGGTAGTTGACG ChIP and RT-PCR of tlh1
tlh-RT-2 CCAGCTCTTTCGTTCAGGAC ChIP and RT-PCR of tlh1
ura4-RT-1 TACCTTTGGGACGTGGTCTC ChIP of ura4
ura4-RT-2 AGGAAATCGACGACCAGCTA ChIP of ura4
Tel-RT-1 GGGGGCATTGTATTTGTGAA ChIP of tel
Tel-RT-2 GGGAATTTAGGAAGTGCGGTA ChIP of tel
Supplementary Table 3: Primers used for ChIP and RT-PCR analyses