Post on 18-Jul-2020
Supplementary Information
A pair of floral regulators sets critical daylength for Hd3a florigen expression in rice
Hironori Itoh1, Yasunori Nonoue2, Masahiro Yano3, Takeshi Izawa1
1 Photosynthesis and Photobiology Research Unit, National Institute of Agrobiological
Sciences, 2-1-2 Kannondai, Tsukuba 305-8602, JAPAN 2 Institute of the Society for Techno-innovation of Agriculture, Forestry and Fisheries,
Tsukuba 305-0854, JAPAN 3 QTL Genomics Research Center, National Institute of Agrobiological Sciences, 2-1-2
Kannondai, Tsukuba 305-8602, JAPAN
1Nature Genetics: doi:10.1038/ng.606
Supplementary Note
Circadian clocks in rice
To elucidate the repressive action of Ghd7, we performed a series of physiological
experiments. From the data shown in Figs. 3 and 4, we expected that interruption of morning
light would repress morning expression of Ghd7 and enable the subsequent blue-light
induction of Ehd1 the next morning, even under non-inductive LD conditions. In addition,
replacement of normal daylength with a light pulse of less than 1 h would be sufficient for the
induction of Ghd7 function and would maintain the suppressive activity of Ghd7 until the
next morning, because a short period of exposure to red light can fully activate Ghd7
expression (Supp. Fig. 9). However, replacement of normal daylength with complete
darkness (DD) or short light pulses (Supp. Fig. 12a) did not cause de-repression of Ehd1
expression the next morning (Supp. Fig. 12b). Furthermore, the same treatments disturbed
Ehd1 expression the next morning even under inductive SD conditions (Supp. Fig. 12b).
These results led us to speculate that such modification of daylength affected the circadian-
clock action in rice. We therefore examined the expression of three circadian-clock-related
genes, OsLHY, OsGI, and OsPRR1 (Supp. Fig. 12c). On the day of treatment (day 1), both
DD and short-light-period treatments primarily caused severe damping of the rhythmic
expression of OsGI and OsPRR1, but OsLHY mRNA levels during subjective day were only
slightly reduced by these alterations. However, the effects of these treatments on OsLHY
expression became obvious the next morning. Molecular genetic studies of circadian systems
in Arabidopsis have revealed that the plant circadian clock consists of interlocking
transcriptional feedback loops of LHY/CCA1, TOC1(PRR1), and other PRR genes, as
exemplified by the inhibition of TOC1 transcription by LHY/CCA1 activity and the promotion
of LHY/CCA1 transcription by TOC1 activity in a circadian-clock loop1. Our results strongly
suggest that the transcriptional induction of OsLHY requires the expression of OsGI and
OsPRR1 the previous day, but not vice versa. It is very likely that both OsGI and OsPRR1 are
gradually induced by light signals under normal daylength. Furthermore, it is possible that
OsLHY expression is gated to morning light; the gate may be set by OsGI and/or OsPRR1.
Because OsPRR1 is de-repressed in osgi-1 (Izawa, T. et al. in preparation), OsPRR1 may
compensate OsGI to make the gate for OsLHY the next morning. Although OsLHY expression
at subjective dawn of day 2 showed a damped pattern after DD or short light treatment at day
1 and did not recover rapidly in response to normal daylength treatment at day 2, OsGI and
OsPRR1 expression recovered when plants were returned to normal daylength at day 2 (Supp.
2Nature Genetics: doi:10.1038/ng.606
Fig. 12c), suggesting that the light-dependent transcriptional activation mechanisms of OsGI
and OsPRR1 differ from those of OsLHY. Accordingly, Ghd7 and Ehd1 expression was
impaired in these physiological experiments.
Control of critical daylength response of Ehd1 expression by Ghd7 function
We revealed that Ehd1 transcription was gated to light at subjective dawn and that blue light
in the morning was effective for this induction. In addition, this gated expression was
repressed by Ghd7 activity ascribed mainly to Ghd7 transcription in the morning of the
previous day. We therefore asked whether gradual changes in the expression of Ghd7 (Fig.
1g) can cause switching with an acute and accurate threshold for Ehd1 expression. In the WT,
a 25% decrease in Ghd7 mRNA levels in response to the 20-min difference from 13 h 30 m to
13 h 10 m corresponded to an approximately 400% increase in expression of Ehd1 (Supp. Fig.
4). A 50% decrease in Ghd7 mRNA levels in response to the 30-min change from 13 h 30 m
to 13 h corresponded to a 1000% increase in the expression of Ehd1 (Fig. 1d, g). In our
system of Ghd7 transcription induction by using heat-shock promoter (Fig. 5b), the 25%
reduction in Ghd7 mRNA levels caused by shortening the duration of heat-shock from 10 to 5
min enabled a 200% increase in Ehd1 expression the next morning. The 65% reduction in
Ghd7 mRNA levels with the change in heat-shock induction from 7.5 min to 2.5 min enabled
a 300% increase in Ehd1 mRNA. Thus, our reconstitution experiments demonstrated that a
relatively small change in the levels of Ghd7 mRNA can trigger a greater change in Ehd1
mRNA levels the next morning. However, we cannot rule out the involvement of post-
transcriptional regulation of Ghd7 and Ehd1 activity, depending on the photoperiod, in the
setting of critical daylength, because the changes in Ehd1 expression were still higher with
typical daylength changes than with these heat-shock treatments. In addition, de-repressed
Ehd1 mRNA levels were much higher in both se5 plants and the ghd7-deficient cultivar
(HOS) than in the wild-type plants under SD (Fig. 1 e,f), suggesting that basal repression by
Ghd7 exists independently of transcriptional regulation by these gating mechanisms.
Furthermore, Ehd1 encodes a member of a subfamily of B-type response regulators involved
in the plant two-component signaling cascade2 (His-to-Asp phosphor-relay), implying post-
transcriptional modification of Ehd1 activity.
Supplementary References
1. Harmer, S.L. The circadian system in higher plants. Annu. Rev. Plant Biol. 60, 357–
377 (2009).
3Nature Genetics: doi:10.1038/ng.606
2. Doi, K. et al. Ehd1, a B-type response regulator in rice, confers short-day promotion
of flowering and controls FT-like gene expression independently of Hd1. Genes Dev.
18, 926–936 (2004).
4Nature Genetics: doi:10.1038/ng.606
Supplementary Figures
Supplementary Figure 1 Morning Hd3a expression is dependent on Ehd1 activity.
Taichung 65 (T65) is a rice cultivar deficient in both Hd1 and Ehd1. #1-16 is a transgenic line
harboring a functional Ehd1 allele, and #7-1 is a transgenic line harboring a functional Hd1
allele. Plants were entrained under SD (12 h light, 12 h dark) for 12 days. Samples were
collected at dawn and 2 h after application of blue or red light at dawn. Representative results
of two independent experiments. Average values and standard deviations from three RT-PCR
data are shown.
5Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 2 Diurnal expression of Ehd1, Ghd7, and Hd3a mRNAs under SD
and LD. (a) Ehd1, (b) Ghd7, (c) Hd3a. Wild-type plants were grown under LD (14.5 h light,
9.5 h dark) or SD (10 h light, 14 h dark) for 14 days. Samples were collected every 3 h from
dawn (08:00). Red and blue lines represent expression patterns of plants grown under LD and
SD, respectively. White and black bars at the bottom represent the light and dark periods,
respectively. Average values and standard deviations from three RT-PCR data are shown.
6Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 3 Effects of Hd1 activity on expression of Hd3a, Ehd1, and Ghd7
in the morning. (a) Hd3a, (b) Ehd1, (c) Ghd7. Nipponbare, a japonica cultivar, was used as
control. NIL(Hd1) is a nearly isogenic line harboring the loss-of-function allele of Hd1 of an
indica rice, Kasalath. After entrainment with different daylengths (numbers of hours of
daylight are marked on the x-axis), samples were collected 3 h after dawn. (a, b) Relative
expression values are shown on a log scale. (a–c) Average values and standard deviations
from three RT-PCR data are shown. Results are representative of three independent
experiments. ‘n.t.’ indicates ‘not tested’.
7Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 4 Changes in Hd3a, Ehd1, and Ghd7 mRNA levels in response to
10-min differences in daylength between 13 and 13.5 h. (a) Hd3a, (b) Ehd1, (c) Ghd7.
Hours and minutes of daylight are indicated on the x-axis. After entrainment with these
different daylengths for 5 days, wild-type plants were collected 3 h after dawn. (a, b) Relative
expression values are shown on a log scale. (a–c) Average values and standard deviations
from three RT-PCR data are shown. Results are representative of three independent
experiments. P values (ANOVA) for 13:00-13:10-13:20; 2.2E-3 (Hd3a), 9.3E-3 (Ehd1), 4.8E-
4 (Ghd7); P values (ANOVA) for 13:10-13:20-13:30; 2.1E-4 (Hd3a), 6.1E-4 (Ehd1), 2.3E-2
(Ghd7).
8Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 5 Analysis of RFT1 expression under different daylength
conditions. Numbers of hours of daylight are indicated on the x-axis. After entrainment with
the different daylengths for 5 days, the wild-type plants were collected 6 h after dawn.
Relative expression values are shown on a log scale. Average values and standard deviations
from three RT-PCR data are shown. Results are representative of three independent
experiments.
9Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 6 Graphical genotype of a nearly isogenic line, NIL(Ghd7). Lines
indicate chromosomes. Small bars on the chromosomes are landmarks used for genotyping
the materials obtained during repeated backcrossing. Thick red bar indicates introgressed
region of the Kasalath genomic region containing the functional Ghd7 locus. Only the small
genomic region of chromosome 7 of Kasalath containing the functional Ghd7 (in red) was
fixed in the line 03HF2-9B-128.
10Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 7 Diurnal protein profile of HA-OsGI in rice plants expressing
HA-OsGI under endogenous promoter regulation. Plants were entrained under SD
conditions (10 h light, 14 h dark, subjective dawn at 08:00). Samples were then collected at
the indicated times. Twenty micrograms of protein extract was loaded per lane and probed
with α-HA antibody. Arrowhead indicates the position of HA-OsGI. Non-specific bands of
RbcS protein were used as loading controls (RbcS). We confirmed that introduction of this
construct complemented the late-flowering phenotype of the osgi-1 mutant in the T0
generation (data not shown). Photoperiod: 08:00–18:00.
11Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 8 Gated expression of Ehd1 expression responsive to blue light in
wild-type plants. Wild-type (N8) plants were entrained under SD for 14 days. Plants were
transferred to continuous dark at dusk (0 on the y-axis). Replicate samples were then exposed
once to 2 h of blue light at times differing by 3 h. Black and gray bars in the panel at left
represent subjective night and day. Blue bands represent the 2 h of blue light. Arrowheads
represent the timing of harvest for RNA extraction. Average values and standard deviations
from three RT-PCR data are shown. Data are representative of two independent experiments.
12Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 9 A 10-min red-light pulse is sufficient for induction of Ghd7.
Wild-type plants were grown under LD. A red-light pulse of different durations was then
applied at dawn. Samples were collected 2 h after dawn. Average values and standard
deviations from three RT-PCR data are shown. Data are representative of two independent
experiments.
13Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 10 Characterization of blue-light-dependent induction of Ehd1.
Wild-type plants grown under SD were exposed to blue light for different lengths of time at
subjective dawn. Induction of Ehd1 mRNA was analyzed 2 h after the start of treatment.
Average values and standard deviations from three RT-PCR data are shown.
14Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 11 Ghd7 expression in osgi-1 mutants grown under LD or SD.
osgi-1 plants were entrained by LD (a) or SD (b) for 14 days. Plants were transferred to
darkness at dusk (22:00 in a, 18:00 in b). Replicate samples were then exposed to a single 10-
min red-light pulse at times differing by 2 h. Red-light pulses given at the different times are
indicated in the panel at left; subjective dawn was at 08:00. Acute response of Ghd7
expression was analyzed 2 h after the beginning of exposure. Black and gray bars in the panel
at left represent subjective night and day, respectively. Red bands in the panel represent the
10-min red-light pulses. Arrowheads represent the timing of harvest for RNA extraction.
Average values and standard deviations from three RT-PCR data are shown. Data are
representative of two independent experiments.
15Nature Genetics: doi:10.1038/ng.606
Supplementary Fig. 12
16Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 12 Effects of light in diurnal cycles on circadian-clock-related
gene expression. (a) Schematic representation of modifications of daylength conditions in
this experiment. Wild-type plants were entrained by SD (10 h light, 14 h dark) or LD (14.5 h
light, 9.5 h dark). The day before sampling (day 1), replicate samples that had received SD or
LD entrainment were subjected to one of three conditions: (1) normal light conditions as
control (SD or LD); (2) darkness after the application of a 1-h (for SD) or 0.5-h (for LD) light
pulse (SD-1 or LD-0.5); or (3) complete darkness from subjective dawn (SD-DD or LD-DD).
Plants were returned to normal light conditions at the next subjective dawn (day 2). White and
black bars indicate light and dark periods, respectively. Hatched bars indicate the replacement
of normal daylength with darkness. (b) Single 24-h continuous dark (DD) treatment causes a
severe failure of Ehd1 induction the next morning. Samples were collected every 3 h from
dawn on day 2. (c) Extremely short light periods or DD treatment impairs the rhythmic
expression of circadian-clock-related genes. Wild-type plants entrained under LD were
transferred to three different conditions, as shown in a. OsLHY (i), OsGI (ii), OsPRR1 (iii).
Samples were collected every 3 h from the beginning of the treatment day (day 1) to the end
of the next day (day 2). White and black bars represent light and dark periods, respectively.
Hatched bars indicate the replacement of normal daylength with darkness. Average values
and standard deviations from three RT-PCR data are shown.
17Nature Genetics: doi:10.1038/ng.606
Supplementary Figure 13 Molecular basis of critical daylength recognition for Hd3a
expression. (a) Network diagram of the photoperiodic regulation of Hd3a expression. The
blue-light-mediated floral promotion and red-light (or phytochrome) -mediated floral
repression pathways characterized in this study are indicated by blue and red lines,
respectively. The blue-light receptor for Ehd1 induction has not yet been determined. The
light signaling pathways were gated differently by circadian clocks in rice. The Hd1 pathway
(gray lines) is not essential for Ehd1-dependent regulation of Hd3a expression. (b) SD-
dependent Hd3a expression in the morning is controlled by both Ehd1 and Ghd7. Photo-
inducible phases of Ehd1 (blue dotted lines) and Ghd7 (red dotted lines) are shown. Because
the Ghd7 peak of the photo-inducible phase is set at midnight and the Ehd1 peak of the photo-
inducible phase is set at about dawn under SD conditions, Ehd1 expression is preferentially
induced by blue-light signals in the sunlight at subjective dawn. In turn, Hd3a expression is
activated (centre, left panel). If a single, short exposure to light is given in the middle of the
night (+NB (night break)), Ghd7 is induced through phytochrome signaling and the Ghd7
product suppresses Ehd1 induction by the morning light (centre, right panel). Under LD,
although both Ghd7 and Ehd1 expression can be induced at the same time, Ghd7 expressed in
the morning can suppress blue-light induction of Ehd1 the next morning (bottom panels),
leading to stable suppression of Hd3a expression under LD.
18Nature Genetics: doi:10.1038/ng.606
19
Supplementary Table 1 Primer and probe sequences used in this study Gene Forward (5′–3′) Reverse (5′–3′) Probe
Hd3a GCTAACGATGATCCCGAT CCTGCAATGTATAGCATGC CTGCTGCATGCTCACTATCATCAT
CC
Ehd1 GCGCTTTTGATTTCCTGC TTCGGAATATGTGCTGCC GTGAGGATCGAAGAGCTGAGCAA
CA
Ghd7 GTACGCGTCCAGAAAAGCT TTGGCGAAGCGACCTCTC TGCCGAGATGAGGCCCCGA
RFT1 CGTCCATGGTGACCCAACA CCGGGTCTACCATCACGAGT CGGTGGCAATGACATGAGGACGT
TC
OsLHY GGGTCGTCTGGCTTTTGAT CGGTACCCTGTTCTCCTTC AAAGGAGATTAGCAAGGAGGAA
GAAG
OsPRR1 ACCCATGTGTGGCGGC GCCAACTCGAAATGTCATTGA
A
CGGATGCTTGGTTTGTCGGAGAA
AAA
OsGI GCATAAGTTGTGGGTGCTTCC GAAAATACGCAGCTGGTGGAG AGATCCTCGGCTGTAAGTTGTTGG
AGGC
UBQ GAGCCTCTGTTCGTCAAGTA ACTCGATGGTCCATTAAACC TTGTGGTGCTGATGTCTACTTGTG
TC
Oshsp16
.9C
GGAAGCTTCAGTGAAAGCAGT
GAATTG
GGGGATCCAGCTCGATCAAAT
GCTTCAGT
(For cloning)
Ghd7 GGGGTACCGCTAGCTCTAGCT
AGTTGTTG
GGGAATTCAGTGGTATATACG
CACTGTA
(For cloning)
Nature Genetics: doi:10.1038/ng.606