RNA Structure

1. RNA = DNA

2. Elements & Motifs : RNA ::

Helices : DNA

3. Sequence Dependence

Element No

Motif Yes

/

RNA: Methods & HistoryMethods

•X-ray diffraction

•Fiber

•Crystal

•NMR

•Chemical probing

•Mutation

•Modeling (constraints)

History

• A-helix

• Ricin-Sarcin loop

• tRNA

• Self-splicing intron

• ribosomes

RNA: Constraints

•Electron density

•NMR nuclear interactions

•Chemical reactivities

•Evolutionary covariation

•Stability prediction

RNA Constraints: Covariation

ACGTAATTGCGTAACAGCGTAACAACGTAATCACGTAATGGCGTAGCGGCGTAGCA

ACGTAATTGCGTAACAGCGTAACAACGTAATCACGTAATGGCGTAGCGGCGTAGCA

RNA Constraints: RNA folding

Copyright restrictions may apply.

Jossinet, F. et al. Bioinformatics 2005 21:3320-3321; doi:10.1093/bioinformatics/bti504

An S2S screenshot displaying the S2SViewer core tool (on the left), Rnalign (middle low), Rna3DViewer using PyMOL (middle up) and Rna2DViewer (on the right)

RNA ElementsRNA Elements

• are recognized, commonly occurring features of RNA 3-D structure that are not dictated by the sequence.

• are principally assembled by Watson-Crick base pairing and stacking.

• A-helix

• Stems

• Coaxially stacked helices

• Cross-strand helices

• Pseudoknots

• Kissing loops

• Backbone zippers

RNA Element: A-Helix

Figure 4.01a: A-DNA

Protein Data Bank ID: 213D. Ramakrishnan, B., and Sundaralingam, M., Biophys. J. 69 (1995): 553-558 (top).

RNA Element: Stem

RNA Element: Coaxially Stacked Helices

RNA Element: Cross-strand Helices

RNA Element: Pseudoknot

Image from Staple et al.

Hepatitis Delta Virus (Image from Ke et al.).

RNA Element: Kissing Loops

RNA Element: Backbone Zipper

RNA MotifsRNA Motifs

• are recognized, commonly occurring features of RNA 3-D structure that depend, in part, on the nucleotide sequence.

• often involve non-Watson-Crick pairings and higher order base interactions.

• Tetraloops

• Turns

• Interstrand structures

• Distant interactions

RNA Motifs: Tetraloops

• UNCG

• GNRA

• CUYG

• U-turn (YUNR)

RNA Motif: UNCG Tetraloop

RNA Motif: GNRA Tetraloop

RNA Motif: CUYG Tetraloop

U-turn

RNA Motifs: Turns

• K-turn

• Bulge-helix-bulge

• S-turn

• Hook turn

RNA Motif: K-turn

RNA Motif: K-turn

TERRY A. GOODY et al. RNA 2004; 10: 254-264

FIGURE 2. Anomalous electrophoretic migration of K-turn RNA is dependent on the presence of magnesium ions

RNA Motif: Bulge-helix-bulge

RNA Motif: S-turn

SZILVIA SZEP et al. RNA 2003; 9: 44-51

RNA Motif: Hook Turn

SZILVIA SZEP et al. RNA 2003; 9: 44-51

FIGURE 5. Stereodiagrams of some

hook-turns found in rRNAs

RNA Motifs: Cross-strand Structures

• A-platforms

• bulged G

• T-loop

RNA Motif: A Platform

RNA Motif: Bulged G motif

RNA Motif: T-loop

RNA Motifs: Distant Interactions

• A-minor

• Receptor--GNRA Tetraloop

RNA Motif: A minor motif

RNA Motif: GNRA Tetraloop & Receptor

RNA Structure: Classification

Sarver, M., Zirbel, C.L., Stombaugh, J., Mokdad, A. and Leontis, N.B., 2008. FR3D: finding local and composite recurrent structural motifs in RNA 3D structures. Journal of mathematical biology 56, 215-52.

RNA Structure

1. RNA = DNA

2. Elements & Motifs : RNA ::

Helices : DNA

3. Sequence Dependence

Element No

Motif Yes

/

FUNCTION: next