ResearchArticle Veronicastrum axillare Alleviates Ethanol-Induced Injury on Gastric Epithelial Cells...

Post on 01-Nov-2020

6 views 0 download

Transcript of ResearchArticle Veronicastrum axillare Alleviates Ethanol-Induced Injury on Gastric Epithelial Cells...

Research ArticleVeronicastrum axillare Alleviates Ethanol-InducedInjury on Gastric Epithelial Cells via Downregulation ofthe NF-kB Signaling Pathway

Wei-chun Zhao1 Yan-shan Xu1 Gang Chen2 Yan Guo1 Dan-yi Wang1 and Gui-bin Meng1

1College of Life Sciences Zhejiang Chinese Medical University Hangzhou 310053 China2Department of Chemistry Simon Fraser University Burnaby BC Canada V5A 1S6

Correspondence should be addressed to Wei-chun Zhao weichunzhaohotmailcom

Received 27 September 2016 Revised 22 November 2016 Accepted 6 December 2016 Published 15 January 2017

Academic Editor Kazuhiko Uchiyama

Copyright copy 2017 Wei-chun Zhao et alThis is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

We used human gastric epithelial cells (GES-1) line in an ethanol-induced cell damage model to study the protective effect ofVeronicastrum axillare and its modulation to NF-120581B signal pathway The goal was to probe the molecular mechanism of V axillaredecoction in the prevention of gastric ulcer and therefore provide guidance in the clinical application of V axillare on treatinginjuries from chronic nephritis pleural effusion gastric ulcer and other ailments The effects of V axillare-loaded serums on cellviability were detected by MTT assays Enzyme-linked immunosorbent assay (ELISA) and Real-Time PCR methods were used toanalyze the protein and mRNA expression of TNF-120572 NF-120581B I120581B120572 and IKK120573 The results showed that V axillare-loaded serumpartially reversed the damaging effects of ethanol and NF-120581B activator (phorbol-12-myristate-13-acetate PMA) and increased cellviabilityThe protein andmRNA expressions of TNF-120572 NF-120581B I120581B120572 and IKK120573were significantly upregulated by ethanol and PMAwhile they were downregulated byV axillare-loaded serum In summaryV axillare-loaded serumhas significantly protective effecton GES-1 against ethanol-induced injury The protective effect was likely linked to downregulation of TNF-120572 based NF-120581B signalpathway

1 Introduction

Gastric ulcer is one of the most common clinical conditionsof the digestive system Globally more than 14 million peopleare diagnosedwith gastric ulcer annually and about 4millionpeople would die from related complications [1] Humangastric epithelial tissue is in constant turn-over maintaininga balance between cell death and new cell formation It hassome capacity to repair food-oriented chemical and physicaldamage [2ndash4] However when the damage exceeds the self-repair capacity the structure and function of the gastricepithelial tissue can be compromised leading to an imbalancebetween cell generation and cell death which in turn cancause gastric inflammation and ulcer

Alcohol is an indispensable part in many peoplersquos life Itis even dubbed as catalyst to build relationships and makedeals amongst businessmen Although alcohol inmoderationhas health benefits elevated alcohol consumption has been

linked to GI track disorders and acute GI epithelial tissuealcohol damage is on the rise [5] Excessive consumption ofhard liquor can directly cause gastric epithelial cell damageresulting in inflammation congestion edema bleeding ero-sion and ulcer in the GI track Chronic alcoholism has strongties to GI disorders atrophic gastritis and cancer [5 6]Therefore alcohol has been recognized as a key pathogen ingastric epithelial tissue damage Methods for the preventionand treatment of such damage and deduction of protectivemechanisms have been the focus of many research projects[7]

Veronicastrum axillare (Sieb et Zucc) Yamazaki (Scro-phulariaceae) has been widely used both alone and inconjugation with other herbs in Chinese folk medicines totreat injuries from chronic nephritis pleural effusion gastriculcer furunculosis burns snake bites and other ailments [8ndash13] Our preliminary studies showed that the water extractof V axillare significantly reduced ethanol-induced gastric

HindawiGastroenterology Research and PracticeVolume 2017 Article ID 7395032 8 pageshttpsdoiorg10115520177395032

2 Gastroenterology Research and Practice

damage in a rat model and downregulation of the expressionof the key factors of NF-120581B signaling pathway [14ndash19] Inthis study we used human GES-1 cell line in an ethanol-induced cell damage model to study the protective effect ofV axillare and its modulation to NF-120581B signal pathway Thegoal was to probe the molecular mechanism of V axillaredecoction in the prevention of gastric ulcer and thereforeprovide guidance in the clinical application of V axillareon treating injuries from chronic nephritis pleural effusiongastric ulcer furunculosis and other ailments

2 Materials and Methods

21 Materials and Reagents V axillare was picked fromLishui in Zhejiang province of China which was identifiedas ScrophulariaceaeV axillare plant by Professor ZhenshengYao (Zhejiang Chinese Medical University) The prepara-tion of high-dose decoction (014 g dried plant per mL)followed the protocol of Du [6] The high-dose decoctionwas diluted 1 1 and 1 3 with water to prepare medium-dose and low-dose solutions respectively Ranitidine cap-sule (Shanghai Modern HaSen (Shangqiu) PharmaceuticalCo Ltd lot 14071604) was made into 018 suspensionbased on the labeled API content just before use Otherreagents and supplies were obtained from their respectivecommercial suppliers absolute ethanol Hangzhou ShuanglinChemicals (lot 20140820) GES-1 cell line immortalizedhuman gastric epithelial cell line Cancer Hospital ChineseAcademy of Medical Sciences DMEM high glucose culturemedium HyClone PMA (phorbol-12-myristate-13-acetate)Sigma-Aldrich NF-120581BTNF-120572 ELISA kit (lot 20150701A) andI120581B120572IKK120573 ELISA kit (lot 20150801A) Shanghai YuanyeBiotech Ltd PrimeScript RT Master Mix (RR036A) andSYBR Premix Ex Taq II (lot RR820A) Takara

22 Equipment Thermo 3111 CO2 incubator (Thermo USA)TE2000-S inverted phase differential microscope (NikonJapan) Milli-Q water purification station (Millipore) 3K15refrigerated centrifuge (Sigma Germany) Tanon 2500 gelimaging station (Tianneng Scientific Co Ltd) Q5000 microUV-Vis spectrophotometer (Quawell USA) StepOnePlusReal-Time PCR system (ABI Co) and Multiskan Flashmicroplate reader (Thermo USA) were used

23 Drug-Loaded Serum Preparation 20 male SD rats (SPFgrade 200 plusmn 20 g Shanghai Sciple Biky Company certificateSCXK (Hu) 2013-0003) were randomly divided into normalgroup Ranitidine group V axillare high-dose medium-dose and low-dose groups four in each group The ratswere hosted at 23 plusmn 2∘C 50ndash70 RH The rats were dailyintragastrically given at 20mLkg the following solutionsrespectively 09 saline 0027 gkg Ranitidine (equivalent to3 times the human clinical dose) and V axillare decoction(0140 gmL 0070 gmL and 0035 gmL for high-medium-low-dose group resp) The animals had access to water andfood ad libitum during the first 13 days and were denied foodfor the 14th day while they still have free access to waterTwo hours after the final dosing the animals were euthanizedby giving 30mLkg of 10 chloral hydrate subcutaneously

and blood was taken from the abdominal aorta The bloodsamples were left at room temperature for 1 h and then cen-trifuged at 3500 rpm for 10min The resulting supernatantswere passed through 022120583m sterile filters to yield the drug-loaded serums (4-5mLrat) which were divided into smallaliquots and stored at minus20∘C

24 Cell Subculture GES-1 cell lines were cultured in 10FBS supplemented DMEM medium in 25T culturing flasksat 37∘C5 CO2 and the medium was changed every otherday When the cells have fully covered the flask bottom 1mLof 025 Trypsin was added to digest the monolayer and cellswere subcultured at 1 3 ratio

25 In Vitro Model Cultured GES-1 were aliquoted to 10groups that is normal group model group Ranitidinegroup (positive control)V axillare high-medium-low-dosegroups PMA group and V axillare high-medium-low-dose + PMA groups GES-1 culture in its logarithmic growthphase was used to inoculate normal growth medium in acell cultural plate (six-well plate 2mLwell 12 times 106 cells96-well plate 100120583Lwell 4 times 104 cells) After the cells haveadhered to the bottom of the wells for 24 h themediumswereremoved washed twice with PBS and then replaced withDMEM medium supplemented with 10 drug-loaded ratserum prepared above (drug-loaded DMEM medium) Thecells were further cultured for 24 h and then the mediumsin all but the normal group wells were replaced with drug-loaded DMEMmedium containing 5 ethanol [3] After 4 hcells in wells were used for the subsequent experiments [3]

26 Cell Viability Assay MTT stock solution (5mgmL20120583Lwell) was added toGES-1 cell cultures in a 96-well plateprepared in 25 and the cells were further cultured for 4 hThesupernatants were removed and 150 120583L of DMSO was addedto each well The optical absorption was measured at 490 nmon a microplate reader

27 Measurement of NF-120581B TNF-120572 I120581B120572 and IKK120573 ProteinExpression by ELISA Thesupernatants fromdifferent groupsof GES-1 cell cultures in a 6-well plate described in 25 wereplaced in sterile microcentrifuge tubes and centrifuged at3000 rpm for 10min The supernatants were transferred tonew tubes and the amounts of NF-kB TNF-120572 I120581B120572 andIKK120573 were measured according to manufacturersrsquo protocols

28 Measurement of NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNAExpression by RT-PCR After removing the supernatant thecells remaining in the 6-well plate (described in 27) weretreated with Trizol reagent to extract the total RNA [20 21]A 05 120583g aliquot of each RNA sample was reverse transcribedwith PrimeScript RT Master Mix kit (Takara Co) A 2120583Laliquot of each reverse transcription product was amplifiedwith SYBR Prime Ex Tag II kit following the manufac-turerrsquos protocol to obtain target cDNA (primer sequences seeTable 1) predenature at 95∘C for 30 sec followed by 40 cyclesof 95∘C 5 sec then 60∘C 30 sec The relative amounts of

Gastroenterology Research and Practice 3

Table 1 Forward and reverse primers for 120573-actin NF-120581B TNF-120572 I120581B120572 and IKK120573

Forward primer 51015840ndash31015840 Reverse primer 51015840ndash31015840 Fragment (bp)120573-actin CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATAC 144NF-120581B ACTGTGAGGATGGGATCTGC TCTGTCATTCGTGCTTCCAG 127TNF-120572 GGCGTGGAGCTGAGAGATAA GTGTGGGTGAGGAGCACAT 119I120581B120572 CCACTCCATCCTGAAGGCTA CATTGACATCAGCACCCAAG 116IKK120573 CCTGGTAGAACGGATGATGG GTACAGCTCCCTTGCTTGCT 118

(a) (b) (c) (d)

(e) (f) (g) (h)

(i) (j)

Figure 1 Effect of Veronicastrum axillare-loaded serum on cellular morphology of GES-1 injured by ethanol Note (a) normal (b) model(c) PMA (d) low dosage of V axillare + PMA (e) medium dosage of V axillare + PMA (f) high dosage of V axillare + PMA (g) Ranitidine(h) low dosage of V axillare (i) medium dosage of V axillare (j) high dosage of V axillare

NF-120581B TNF-120572 I120581B120572 and IKK120573mRNAwere calculated with2minusΔΔCt method using 120573-actin as the internal standard

29 Statistical Analysis All results were analyzed using SPSSv 180 (IBM) and expressed as averageplusmn standard error (119909plusmn119878)Intergroup differences were analyzed by one-way ANOVAand group-wise comparisons were made using Tukey HSDprotocol with 119875 lt 005 as being statistically significant

3 Results

31 Effect of V axillare-Loaded Serum on Cell Viability afterEthanol Damage As seen in Figure 1 normal cells appearedas a dense monolayer that adhered to the bottom andmaintained their healthy cuboidal shapes In the ethanolmodel group most cells had swollen to round shape andsignificant numbers dissociated from the wall Intercellularspace increased connections decreased and cells separated

4 Gastroenterology Research and PracticeO

D (4

90nm

)

lowastlowast

lowastlowast

lowastlowast

lowastlowast

lowastlowastΔnablanablalowastlowastΔnablanabla lowastlowastΔnablanabla

ΔΔnablanabla

ΔΔnablanabla

000005010015020025030035040045

2 3 4 5 6 7 8 9 101Groups

Figure 2 Effect of Veronicastrum axillare-loaded serum on cellviability in GES-1 injured by ethanol test by MTT method Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosageof V axillare 10 high dosage of V axillare Compared with normallowast119875 lt 005 lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt001 compared with PMA 998810998810119875 lt 001 compared with low dosageof V axillare + PMA II

119875 lt 001 compared with medium dosageof V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with highdosage ofV axillare + PMA ◼◼119875 lt 001 compared with Ranitidine998771119875 lt 005 compared with low dosage of V axillare e119875 lt 005

from each other In the PMA group cells formed globularaggregates and almost completely floated to the surface Cellmorphology was even worse than the ethanol model groupsuggesting PMA could further stimulate dissociation of cellsfrom each other InV axillare groups as the dosing increasedcell morphology improved and eventually got close to normalcells In low-dose V axillare group although cells werestill swollen the severity was reduced and they remainedadhered to the culturing dish In the medium-dose groupcell swelling was greatly reduced and half of the view fieldshowed normal cell morphology In the high-dose groupalmost no cell swelling was observed The high-dose groupappeared better than the Ranitidine group (positive control)In V axillare + PMA groups there were also improvementsto cell morphology and cell adhesion as the dose increasedbut overall cells appeared weaker than the V axillare groupswithout PMA Compared with the normal group cell in themodel group PMA group and V axillare + PMA groupsall showed significant lower viability (Figure 2 119875 lt 005119875 lt 001) Cell viabilities for V axillare high- and medium-dose groups Ranitidine group and V axillare high-dose+ PMA group were significantly higher than those for thePMA group V axillare low-dose + PMA group and Vaxillare medium-dose + PMA group (119875 lt 005 119875 lt001) Cell viability enhancement in the V axillare high-dosegroup was much better than those in the V axillare + PMAgroups Ranitidine group and V axillare low-dose groupThis indicated V axillare-loaded serum reduced GES-1 celldamage from PMA treatment

32 Effect of V axillare-Loaded Serum on NF-120581B TNF-120572I120581B120572 and IKK120573Level As shown in Figure 3 when comparedwith the normal group the NF-120581B TNF-120572 I120581B120572 and IKK120573levels in the model group and the PMA group all increased

(119875 lt 005 119875 lt 001) Compared with the model groupV axillare groups and Ranitidine group had significantdownregulation of NF-120581B TNF-120572 I120581B120572 and IKK120573 (119875 lt005 119875 lt 001) the effects in the V axillare groups tend tobe dose-dependent with the high-dose group being the mostsignificant V axillare high-dose + PMA group V axillaregroups and Ranitidine group all had significant inhibitionon the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 whencompared with the PMA group (119875 lt 005 119875 lt 001)The inhibition of TNF-120572 was stronger in the V axillarehigh- and medium-dose groups compared with that of Vaxillare low-dose + PMA group (119875 lt 005 Figure 3(b)) Thedownregulation of IkB120572 in theV axillare high- andmedium-dose groups andV axillare high-dose +PMAgroupwasmoresignificant than that ofV axillaremedium-dose+PMAgroup(119875 lt 005 119875 lt 001 Figure 3(c)) The downregulation ofIKK120573 in the V axillare high- and medium-dose groups Vaxillare medium-dose + PMA group and Ranitidine groupwas stronger than that of the V axillare low-dose + PMAgroup (119875 lt 001 119875 lt 005 Figure 3(d))

33 Extraction of Total RNA and Analysis of the DNAAmplification Product The extracted RNA was subjected tonondenaturing agarose gel electrophoresis (2) and the 5S18S and 28S RNA bands were well defined proving theintegrity of the extracted RNA (Figure 4) Electrophoresis ofthe PCR products and subsequent fluorescent quantificationshowed the PCR products were uniform and in agreementwith the expected product size indicating NF-120581B TNF-120572IkB120572 and IKK120573 gene and 120573-actin primers participated inthe reactions and the PCR amplifications were successful(Figure 5)

34 Effect of V axillare-Loaded Serum on the Expression ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA Figure 6 showedthat the model group and PMA group had upregulation ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA compared with thenormal group (119875 lt 001) Moreover the upregulation ofNF-120581B in the PMA group was significantly higher than thatof the model group (119875 lt 001 Figure 6(a)) indicating theactivation of NF-120581B by PMAThe expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA were significantly downregulatedby highmediumlow dose of V axillare and Ranitidine (119875 lt005 119875 lt 001 Figures 6(a) and 6(c)) Compared with thePMA group the expression of NF-120581B TNF-120572 I120581B120572 andIKK120573mRNA was significantly reduced in V axillare groupsV axillare + PMA groups and Ranitidine group (119875 lt 001Figures 6(a)ndash6(c)) Compared with the V axillare high-dose+ PMA group V axillare high-dose group further reducedthe expression of TNF-120572 I120581B120572 and IKK120573mRNA (119875 lt 005119875 lt 001 Figures 6(b)ndash6(d)) and the downregulation of NF-120581B and IKK120573 was more than that of the V axillare low-dosegroup (119875 lt 005 Figures 6(a) and 6(d))

4 Discussion

Alcoholic gastric epithelial injury refers to conditions causedby excessive alcohol consumption that induced damage to

Gastroenterology Research and Practice 5

lowastlowastlowast

0

200

400

600

800

1000

NF-

B co

nten

t (pg

mL)

2 3 4 5 6 7 8 9 101

Groups

(a)

lowastlowast lowastlowastlowastlowastlowast

0

10

20

30

40

50

60

70

TNF-

cont

ent (

pgm

L)

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowast lowastlowast lowastlowast

0

2

4

6

8

10

12

14

IB

cont

ent (

ngm

L)

2 3 4 5 6 7 8 9 101

Groups

(c)

lowast lowastlowastlowast

0

100

200

300

400

500

600

700

IKK

cont

ent (

UL

)

2 3 4 5 6 7 8 9 101

Groups

(d)

Figure 3 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 content in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare + PMA7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normal lowast119875 lt 005lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810119875 lt 005 998810998810119875 lt 001 compared with low dosage of V

axillare + PMA I119875 lt 005 II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001

28S18S

5S

Figure 4 RNA integrity check nondenaturing agarose gel elec-trophoresis

the gastric epithelial tissues (such as gastric ulcer and gas-trorrhagia) The clinical symptoms include abdominal painfullness vomiting and heartburn [3] The injury caused byalcohol is typically exerted by inducing epithelial cell damageand apoptosis Our preliminary in vivo results showed thatthe water extract ofV axillare significantly inhibited ethanol-induced gastric epithelial cell damage [14 15 19] The ulcer

10987654321 181715 1614131211

Figure 5 Agarose gel electrophoresis of qRT-PCR products NoteLanes 5 and 12 DL500 DNA Ladder Marker (500 400 300 200150 100 and 50 bp in turn from the top down) Lanes 1ndash4 120573-actin(144 bp) Lanes 6ndash8 NF-120581B (127 bp) Lanes 9ndash11 TNF-120572 (119 bp)Lanes 13ndash15 I120581B120572 (116 bp) Lanes 16ndash18 IKK120573 (118 bp)

inhibition rates of low middle and high dosage (07 gkg14 gkg and 28 gkg) group were 479 714 and 894respectively [15] The current study used MTT assay toexamine the effect on cell viability under ethanol assault bypretreatment of GES-1 with V axillare-loaded serum Theresults showed that V axillare-loaded serum had protectiveeffects and reduced the damage caused by ethanolThis is thefirst evidence at the cellular level thatV axillare-loaded serum

6 Gastroenterology Research and Practice

lowastlowastΔΔlowastlowastΔΔ

lowastlowastnablanabla

ΔΔnablanabla ΔΔnablanablaΔΔnablanabla

ΔΔnablanabla

00

05

10

15

20

25

30

35

40N

F-

B m

RNA

expr

essio

n

2 3 4 5 6 7 8 9 101

Groups

lowastlowastΔΔnablanabla

lowastlowast

(a)

lowastlowastΔΔ

lowastlowast

lowastlowastΔΔnablanablalowastlowastΔΔnablanablalowastlowastnablanabla

nablanablanablanabla

nablanablaΔnablanablaΔΔ

0005101520253035404550

TNF-

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowastΔΔ

lowastlowast

lowastlowast

nablanablaΔΔ

lowastlowastnablanabla

lowastlowastnablanabla

ΔnablanablanablanablaΔnablanabla

0005101520253035404550

IB

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(c)

lowastlowast

lowastlowastΔΔ

lowastlowastnablanablalowastlowastnablanabla lowastlowastnablanabla lowastlowastnablanabla

nablanablanablanablaΔΔnablanabla

2 3 4 5 6 7 8 9 101

Groups

00

05

10

15

20

25

30

35

40

IKK

mRN

A ex

pres

sion

(d)

Figure 6 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normallowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810998810119875 lt 001 compared with low dosage of V axillare +

PMA II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with high dosage of V axillare +PMA ◼119875 lt 005 ◼◼119875 lt 001 compared with Ranitidine 998771998771119875 lt 001 compared with low dosage of V axillare e119875 lt 005

is effective against damage induced by ethanol as a model ofalcoholic gastric ulcer [14ndash19]

Alcohol can cause gastric epithelial injury by inducingapoptosis through the TNF-120572 pathway and through the for-mation of ROS which causes cellular damage through oxida-tive stress [3] At the same time the expression of TNF-120572 isunder the control of NF-120581B signal pathway NF-120581B signalingpathway is involved in controlling the gene expression ofmultiple factors and plays an important role in immuneresponse inflammation stress response cell apoptosis can-cer and ontogenetic development [22ndash24] Excessive acti-vation of the NF-120581B pathway will trigger bodyrsquos specificand nonspecific immune response and cause tissue damageand organ dysfunction The three key factors in the NF-120581Bpathway are I120581B120572 IKK120573 and NF-120581B [25] When IKK120573 isactivated by inter- or intracellular stimulations it causes I120581B120572phosphorylation and ubiquitination Ubiquitinated I120581B120572 canbe degraded by a 28S small proteasome which causes thenucleic acid binding domain in NF-120581B to be exposed andthe translocation of NF-120581B into the nucleus This in turnwill change the chemical structure of I120581B causing a seriesof biological responses thus controlling the gene expressionof TNF-120572 [17 26] Studies have shown that Tong Xin LuoCapsule can protect the retina in a mouse diabetic modelby downregulating I120581B120572 IKK120573 and NF-120581B expressions[27] Severe liver damage was observed in IKK120573-knockoutmice and IL-1120573 and TNF-120572 induced NF-120581B activity was

significantly reduced [28] An earlier in vivo study hasshown that the protective effect of V axillare on ethanol-induced gastric ulcer of SD rats is intimately linked to TNF-120572mediated NF-120581B signaling pathway [15 17] Compared withthe ethanol injury model group the expressions of TNF-120572 NF-120581B TNFR-1 RIP1 I120581B120572 and IL-1120573 in rats gastrictissue are downregulated by V axillare The current studyhas shown that in the model group the mRNA expressionof NF-120581B TNF-120572 I120581B120572 and IKK120573 of GES-1 cell linesincreased significantly and the protein concentrations ofthem in GES-1 supernatant also increased remarkably whiledifferent doses of V axillare downregulated these factors inGES-1 and supernatant to various degrees Those indicatedthat V axillare likely exerted the protective effect on GES-1 against ethanol damage through the NF-120581B pathway bydownregulating the expressions of NF-120581B TNF-120572 I120581B120572and IKK120573 The concentrations of NF-120581B I120581B120572 and IKK120573in supernatant increased after the GES-1 were damaged by5 ethanol This increase was likely due to increased cellmembrane permeability from the swelling and cell damagealthough there is possibility that these factors are activelysecreted Further studies will be needed to discern the exactmechanism

PMA can activate protein kinase C (PKC) thus activatingNF-120581B [29] Under resting conditions NF-120581B and I120581B existas an inactive complex in the cytoplasm When cells arestimulated by a PKC agonist PKC is activated with the

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 Gastroenterology Research and Practice

damage in a rat model and downregulation of the expressionof the key factors of NF-120581B signaling pathway [14ndash19] Inthis study we used human GES-1 cell line in an ethanol-induced cell damage model to study the protective effect ofV axillare and its modulation to NF-120581B signal pathway Thegoal was to probe the molecular mechanism of V axillaredecoction in the prevention of gastric ulcer and thereforeprovide guidance in the clinical application of V axillareon treating injuries from chronic nephritis pleural effusiongastric ulcer furunculosis and other ailments

2 Materials and Methods

21 Materials and Reagents V axillare was picked fromLishui in Zhejiang province of China which was identifiedas ScrophulariaceaeV axillare plant by Professor ZhenshengYao (Zhejiang Chinese Medical University) The prepara-tion of high-dose decoction (014 g dried plant per mL)followed the protocol of Du [6] The high-dose decoctionwas diluted 1 1 and 1 3 with water to prepare medium-dose and low-dose solutions respectively Ranitidine cap-sule (Shanghai Modern HaSen (Shangqiu) PharmaceuticalCo Ltd lot 14071604) was made into 018 suspensionbased on the labeled API content just before use Otherreagents and supplies were obtained from their respectivecommercial suppliers absolute ethanol Hangzhou ShuanglinChemicals (lot 20140820) GES-1 cell line immortalizedhuman gastric epithelial cell line Cancer Hospital ChineseAcademy of Medical Sciences DMEM high glucose culturemedium HyClone PMA (phorbol-12-myristate-13-acetate)Sigma-Aldrich NF-120581BTNF-120572 ELISA kit (lot 20150701A) andI120581B120572IKK120573 ELISA kit (lot 20150801A) Shanghai YuanyeBiotech Ltd PrimeScript RT Master Mix (RR036A) andSYBR Premix Ex Taq II (lot RR820A) Takara

22 Equipment Thermo 3111 CO2 incubator (Thermo USA)TE2000-S inverted phase differential microscope (NikonJapan) Milli-Q water purification station (Millipore) 3K15refrigerated centrifuge (Sigma Germany) Tanon 2500 gelimaging station (Tianneng Scientific Co Ltd) Q5000 microUV-Vis spectrophotometer (Quawell USA) StepOnePlusReal-Time PCR system (ABI Co) and Multiskan Flashmicroplate reader (Thermo USA) were used

23 Drug-Loaded Serum Preparation 20 male SD rats (SPFgrade 200 plusmn 20 g Shanghai Sciple Biky Company certificateSCXK (Hu) 2013-0003) were randomly divided into normalgroup Ranitidine group V axillare high-dose medium-dose and low-dose groups four in each group The ratswere hosted at 23 plusmn 2∘C 50ndash70 RH The rats were dailyintragastrically given at 20mLkg the following solutionsrespectively 09 saline 0027 gkg Ranitidine (equivalent to3 times the human clinical dose) and V axillare decoction(0140 gmL 0070 gmL and 0035 gmL for high-medium-low-dose group resp) The animals had access to water andfood ad libitum during the first 13 days and were denied foodfor the 14th day while they still have free access to waterTwo hours after the final dosing the animals were euthanizedby giving 30mLkg of 10 chloral hydrate subcutaneously

and blood was taken from the abdominal aorta The bloodsamples were left at room temperature for 1 h and then cen-trifuged at 3500 rpm for 10min The resulting supernatantswere passed through 022120583m sterile filters to yield the drug-loaded serums (4-5mLrat) which were divided into smallaliquots and stored at minus20∘C

24 Cell Subculture GES-1 cell lines were cultured in 10FBS supplemented DMEM medium in 25T culturing flasksat 37∘C5 CO2 and the medium was changed every otherday When the cells have fully covered the flask bottom 1mLof 025 Trypsin was added to digest the monolayer and cellswere subcultured at 1 3 ratio

25 In Vitro Model Cultured GES-1 were aliquoted to 10groups that is normal group model group Ranitidinegroup (positive control)V axillare high-medium-low-dosegroups PMA group and V axillare high-medium-low-dose + PMA groups GES-1 culture in its logarithmic growthphase was used to inoculate normal growth medium in acell cultural plate (six-well plate 2mLwell 12 times 106 cells96-well plate 100120583Lwell 4 times 104 cells) After the cells haveadhered to the bottom of the wells for 24 h themediumswereremoved washed twice with PBS and then replaced withDMEM medium supplemented with 10 drug-loaded ratserum prepared above (drug-loaded DMEM medium) Thecells were further cultured for 24 h and then the mediumsin all but the normal group wells were replaced with drug-loaded DMEMmedium containing 5 ethanol [3] After 4 hcells in wells were used for the subsequent experiments [3]

26 Cell Viability Assay MTT stock solution (5mgmL20120583Lwell) was added toGES-1 cell cultures in a 96-well plateprepared in 25 and the cells were further cultured for 4 hThesupernatants were removed and 150 120583L of DMSO was addedto each well The optical absorption was measured at 490 nmon a microplate reader

27 Measurement of NF-120581B TNF-120572 I120581B120572 and IKK120573 ProteinExpression by ELISA Thesupernatants fromdifferent groupsof GES-1 cell cultures in a 6-well plate described in 25 wereplaced in sterile microcentrifuge tubes and centrifuged at3000 rpm for 10min The supernatants were transferred tonew tubes and the amounts of NF-kB TNF-120572 I120581B120572 andIKK120573 were measured according to manufacturersrsquo protocols

28 Measurement of NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNAExpression by RT-PCR After removing the supernatant thecells remaining in the 6-well plate (described in 27) weretreated with Trizol reagent to extract the total RNA [20 21]A 05 120583g aliquot of each RNA sample was reverse transcribedwith PrimeScript RT Master Mix kit (Takara Co) A 2120583Laliquot of each reverse transcription product was amplifiedwith SYBR Prime Ex Tag II kit following the manufac-turerrsquos protocol to obtain target cDNA (primer sequences seeTable 1) predenature at 95∘C for 30 sec followed by 40 cyclesof 95∘C 5 sec then 60∘C 30 sec The relative amounts of

Gastroenterology Research and Practice 3

Table 1 Forward and reverse primers for 120573-actin NF-120581B TNF-120572 I120581B120572 and IKK120573

Forward primer 51015840ndash31015840 Reverse primer 51015840ndash31015840 Fragment (bp)120573-actin CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATAC 144NF-120581B ACTGTGAGGATGGGATCTGC TCTGTCATTCGTGCTTCCAG 127TNF-120572 GGCGTGGAGCTGAGAGATAA GTGTGGGTGAGGAGCACAT 119I120581B120572 CCACTCCATCCTGAAGGCTA CATTGACATCAGCACCCAAG 116IKK120573 CCTGGTAGAACGGATGATGG GTACAGCTCCCTTGCTTGCT 118

(a) (b) (c) (d)

(e) (f) (g) (h)

(i) (j)

Figure 1 Effect of Veronicastrum axillare-loaded serum on cellular morphology of GES-1 injured by ethanol Note (a) normal (b) model(c) PMA (d) low dosage of V axillare + PMA (e) medium dosage of V axillare + PMA (f) high dosage of V axillare + PMA (g) Ranitidine(h) low dosage of V axillare (i) medium dosage of V axillare (j) high dosage of V axillare

NF-120581B TNF-120572 I120581B120572 and IKK120573mRNAwere calculated with2minusΔΔCt method using 120573-actin as the internal standard

29 Statistical Analysis All results were analyzed using SPSSv 180 (IBM) and expressed as averageplusmn standard error (119909plusmn119878)Intergroup differences were analyzed by one-way ANOVAand group-wise comparisons were made using Tukey HSDprotocol with 119875 lt 005 as being statistically significant

3 Results

31 Effect of V axillare-Loaded Serum on Cell Viability afterEthanol Damage As seen in Figure 1 normal cells appearedas a dense monolayer that adhered to the bottom andmaintained their healthy cuboidal shapes In the ethanolmodel group most cells had swollen to round shape andsignificant numbers dissociated from the wall Intercellularspace increased connections decreased and cells separated

4 Gastroenterology Research and PracticeO

D (4

90nm

)

lowastlowast

lowastlowast

lowastlowast

lowastlowast

lowastlowastΔnablanablalowastlowastΔnablanabla lowastlowastΔnablanabla

ΔΔnablanabla

ΔΔnablanabla

000005010015020025030035040045

2 3 4 5 6 7 8 9 101Groups

Figure 2 Effect of Veronicastrum axillare-loaded serum on cellviability in GES-1 injured by ethanol test by MTT method Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosageof V axillare 10 high dosage of V axillare Compared with normallowast119875 lt 005 lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt001 compared with PMA 998810998810119875 lt 001 compared with low dosageof V axillare + PMA II

119875 lt 001 compared with medium dosageof V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with highdosage ofV axillare + PMA ◼◼119875 lt 001 compared with Ranitidine998771119875 lt 005 compared with low dosage of V axillare e119875 lt 005

from each other In the PMA group cells formed globularaggregates and almost completely floated to the surface Cellmorphology was even worse than the ethanol model groupsuggesting PMA could further stimulate dissociation of cellsfrom each other InV axillare groups as the dosing increasedcell morphology improved and eventually got close to normalcells In low-dose V axillare group although cells werestill swollen the severity was reduced and they remainedadhered to the culturing dish In the medium-dose groupcell swelling was greatly reduced and half of the view fieldshowed normal cell morphology In the high-dose groupalmost no cell swelling was observed The high-dose groupappeared better than the Ranitidine group (positive control)In V axillare + PMA groups there were also improvementsto cell morphology and cell adhesion as the dose increasedbut overall cells appeared weaker than the V axillare groupswithout PMA Compared with the normal group cell in themodel group PMA group and V axillare + PMA groupsall showed significant lower viability (Figure 2 119875 lt 005119875 lt 001) Cell viabilities for V axillare high- and medium-dose groups Ranitidine group and V axillare high-dose+ PMA group were significantly higher than those for thePMA group V axillare low-dose + PMA group and Vaxillare medium-dose + PMA group (119875 lt 005 119875 lt001) Cell viability enhancement in the V axillare high-dosegroup was much better than those in the V axillare + PMAgroups Ranitidine group and V axillare low-dose groupThis indicated V axillare-loaded serum reduced GES-1 celldamage from PMA treatment

32 Effect of V axillare-Loaded Serum on NF-120581B TNF-120572I120581B120572 and IKK120573Level As shown in Figure 3 when comparedwith the normal group the NF-120581B TNF-120572 I120581B120572 and IKK120573levels in the model group and the PMA group all increased

(119875 lt 005 119875 lt 001) Compared with the model groupV axillare groups and Ranitidine group had significantdownregulation of NF-120581B TNF-120572 I120581B120572 and IKK120573 (119875 lt005 119875 lt 001) the effects in the V axillare groups tend tobe dose-dependent with the high-dose group being the mostsignificant V axillare high-dose + PMA group V axillaregroups and Ranitidine group all had significant inhibitionon the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 whencompared with the PMA group (119875 lt 005 119875 lt 001)The inhibition of TNF-120572 was stronger in the V axillarehigh- and medium-dose groups compared with that of Vaxillare low-dose + PMA group (119875 lt 005 Figure 3(b)) Thedownregulation of IkB120572 in theV axillare high- andmedium-dose groups andV axillare high-dose +PMAgroupwasmoresignificant than that ofV axillaremedium-dose+PMAgroup(119875 lt 005 119875 lt 001 Figure 3(c)) The downregulation ofIKK120573 in the V axillare high- and medium-dose groups Vaxillare medium-dose + PMA group and Ranitidine groupwas stronger than that of the V axillare low-dose + PMAgroup (119875 lt 001 119875 lt 005 Figure 3(d))

33 Extraction of Total RNA and Analysis of the DNAAmplification Product The extracted RNA was subjected tonondenaturing agarose gel electrophoresis (2) and the 5S18S and 28S RNA bands were well defined proving theintegrity of the extracted RNA (Figure 4) Electrophoresis ofthe PCR products and subsequent fluorescent quantificationshowed the PCR products were uniform and in agreementwith the expected product size indicating NF-120581B TNF-120572IkB120572 and IKK120573 gene and 120573-actin primers participated inthe reactions and the PCR amplifications were successful(Figure 5)

34 Effect of V axillare-Loaded Serum on the Expression ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA Figure 6 showedthat the model group and PMA group had upregulation ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA compared with thenormal group (119875 lt 001) Moreover the upregulation ofNF-120581B in the PMA group was significantly higher than thatof the model group (119875 lt 001 Figure 6(a)) indicating theactivation of NF-120581B by PMAThe expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA were significantly downregulatedby highmediumlow dose of V axillare and Ranitidine (119875 lt005 119875 lt 001 Figures 6(a) and 6(c)) Compared with thePMA group the expression of NF-120581B TNF-120572 I120581B120572 andIKK120573mRNA was significantly reduced in V axillare groupsV axillare + PMA groups and Ranitidine group (119875 lt 001Figures 6(a)ndash6(c)) Compared with the V axillare high-dose+ PMA group V axillare high-dose group further reducedthe expression of TNF-120572 I120581B120572 and IKK120573mRNA (119875 lt 005119875 lt 001 Figures 6(b)ndash6(d)) and the downregulation of NF-120581B and IKK120573 was more than that of the V axillare low-dosegroup (119875 lt 005 Figures 6(a) and 6(d))

4 Discussion

Alcoholic gastric epithelial injury refers to conditions causedby excessive alcohol consumption that induced damage to

Gastroenterology Research and Practice 5

lowastlowastlowast

0

200

400

600

800

1000

NF-

B co

nten

t (pg

mL)

2 3 4 5 6 7 8 9 101

Groups

(a)

lowastlowast lowastlowastlowastlowastlowast

0

10

20

30

40

50

60

70

TNF-

cont

ent (

pgm

L)

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowast lowastlowast lowastlowast

0

2

4

6

8

10

12

14

IB

cont

ent (

ngm

L)

2 3 4 5 6 7 8 9 101

Groups

(c)

lowast lowastlowastlowast

0

100

200

300

400

500

600

700

IKK

cont

ent (

UL

)

2 3 4 5 6 7 8 9 101

Groups

(d)

Figure 3 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 content in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare + PMA7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normal lowast119875 lt 005lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810119875 lt 005 998810998810119875 lt 001 compared with low dosage of V

axillare + PMA I119875 lt 005 II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001

28S18S

5S

Figure 4 RNA integrity check nondenaturing agarose gel elec-trophoresis

the gastric epithelial tissues (such as gastric ulcer and gas-trorrhagia) The clinical symptoms include abdominal painfullness vomiting and heartburn [3] The injury caused byalcohol is typically exerted by inducing epithelial cell damageand apoptosis Our preliminary in vivo results showed thatthe water extract ofV axillare significantly inhibited ethanol-induced gastric epithelial cell damage [14 15 19] The ulcer

10987654321 181715 1614131211

Figure 5 Agarose gel electrophoresis of qRT-PCR products NoteLanes 5 and 12 DL500 DNA Ladder Marker (500 400 300 200150 100 and 50 bp in turn from the top down) Lanes 1ndash4 120573-actin(144 bp) Lanes 6ndash8 NF-120581B (127 bp) Lanes 9ndash11 TNF-120572 (119 bp)Lanes 13ndash15 I120581B120572 (116 bp) Lanes 16ndash18 IKK120573 (118 bp)

inhibition rates of low middle and high dosage (07 gkg14 gkg and 28 gkg) group were 479 714 and 894respectively [15] The current study used MTT assay toexamine the effect on cell viability under ethanol assault bypretreatment of GES-1 with V axillare-loaded serum Theresults showed that V axillare-loaded serum had protectiveeffects and reduced the damage caused by ethanolThis is thefirst evidence at the cellular level thatV axillare-loaded serum

6 Gastroenterology Research and Practice

lowastlowastΔΔlowastlowastΔΔ

lowastlowastnablanabla

ΔΔnablanabla ΔΔnablanablaΔΔnablanabla

ΔΔnablanabla

00

05

10

15

20

25

30

35

40N

F-

B m

RNA

expr

essio

n

2 3 4 5 6 7 8 9 101

Groups

lowastlowastΔΔnablanabla

lowastlowast

(a)

lowastlowastΔΔ

lowastlowast

lowastlowastΔΔnablanablalowastlowastΔΔnablanablalowastlowastnablanabla

nablanablanablanabla

nablanablaΔnablanablaΔΔ

0005101520253035404550

TNF-

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowastΔΔ

lowastlowast

lowastlowast

nablanablaΔΔ

lowastlowastnablanabla

lowastlowastnablanabla

ΔnablanablanablanablaΔnablanabla

0005101520253035404550

IB

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(c)

lowastlowast

lowastlowastΔΔ

lowastlowastnablanablalowastlowastnablanabla lowastlowastnablanabla lowastlowastnablanabla

nablanablanablanablaΔΔnablanabla

2 3 4 5 6 7 8 9 101

Groups

00

05

10

15

20

25

30

35

40

IKK

mRN

A ex

pres

sion

(d)

Figure 6 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normallowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810998810119875 lt 001 compared with low dosage of V axillare +

PMA II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with high dosage of V axillare +PMA ◼119875 lt 005 ◼◼119875 lt 001 compared with Ranitidine 998771998771119875 lt 001 compared with low dosage of V axillare e119875 lt 005

is effective against damage induced by ethanol as a model ofalcoholic gastric ulcer [14ndash19]

Alcohol can cause gastric epithelial injury by inducingapoptosis through the TNF-120572 pathway and through the for-mation of ROS which causes cellular damage through oxida-tive stress [3] At the same time the expression of TNF-120572 isunder the control of NF-120581B signal pathway NF-120581B signalingpathway is involved in controlling the gene expression ofmultiple factors and plays an important role in immuneresponse inflammation stress response cell apoptosis can-cer and ontogenetic development [22ndash24] Excessive acti-vation of the NF-120581B pathway will trigger bodyrsquos specificand nonspecific immune response and cause tissue damageand organ dysfunction The three key factors in the NF-120581Bpathway are I120581B120572 IKK120573 and NF-120581B [25] When IKK120573 isactivated by inter- or intracellular stimulations it causes I120581B120572phosphorylation and ubiquitination Ubiquitinated I120581B120572 canbe degraded by a 28S small proteasome which causes thenucleic acid binding domain in NF-120581B to be exposed andthe translocation of NF-120581B into the nucleus This in turnwill change the chemical structure of I120581B causing a seriesof biological responses thus controlling the gene expressionof TNF-120572 [17 26] Studies have shown that Tong Xin LuoCapsule can protect the retina in a mouse diabetic modelby downregulating I120581B120572 IKK120573 and NF-120581B expressions[27] Severe liver damage was observed in IKK120573-knockoutmice and IL-1120573 and TNF-120572 induced NF-120581B activity was

significantly reduced [28] An earlier in vivo study hasshown that the protective effect of V axillare on ethanol-induced gastric ulcer of SD rats is intimately linked to TNF-120572mediated NF-120581B signaling pathway [15 17] Compared withthe ethanol injury model group the expressions of TNF-120572 NF-120581B TNFR-1 RIP1 I120581B120572 and IL-1120573 in rats gastrictissue are downregulated by V axillare The current studyhas shown that in the model group the mRNA expressionof NF-120581B TNF-120572 I120581B120572 and IKK120573 of GES-1 cell linesincreased significantly and the protein concentrations ofthem in GES-1 supernatant also increased remarkably whiledifferent doses of V axillare downregulated these factors inGES-1 and supernatant to various degrees Those indicatedthat V axillare likely exerted the protective effect on GES-1 against ethanol damage through the NF-120581B pathway bydownregulating the expressions of NF-120581B TNF-120572 I120581B120572and IKK120573 The concentrations of NF-120581B I120581B120572 and IKK120573in supernatant increased after the GES-1 were damaged by5 ethanol This increase was likely due to increased cellmembrane permeability from the swelling and cell damagealthough there is possibility that these factors are activelysecreted Further studies will be needed to discern the exactmechanism

PMA can activate protein kinase C (PKC) thus activatingNF-120581B [29] Under resting conditions NF-120581B and I120581B existas an inactive complex in the cytoplasm When cells arestimulated by a PKC agonist PKC is activated with the

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Gastroenterology Research and Practice 3

Table 1 Forward and reverse primers for 120573-actin NF-120581B TNF-120572 I120581B120572 and IKK120573

Forward primer 51015840ndash31015840 Reverse primer 51015840ndash31015840 Fragment (bp)120573-actin CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATAC 144NF-120581B ACTGTGAGGATGGGATCTGC TCTGTCATTCGTGCTTCCAG 127TNF-120572 GGCGTGGAGCTGAGAGATAA GTGTGGGTGAGGAGCACAT 119I120581B120572 CCACTCCATCCTGAAGGCTA CATTGACATCAGCACCCAAG 116IKK120573 CCTGGTAGAACGGATGATGG GTACAGCTCCCTTGCTTGCT 118

(a) (b) (c) (d)

(e) (f) (g) (h)

(i) (j)

Figure 1 Effect of Veronicastrum axillare-loaded serum on cellular morphology of GES-1 injured by ethanol Note (a) normal (b) model(c) PMA (d) low dosage of V axillare + PMA (e) medium dosage of V axillare + PMA (f) high dosage of V axillare + PMA (g) Ranitidine(h) low dosage of V axillare (i) medium dosage of V axillare (j) high dosage of V axillare

NF-120581B TNF-120572 I120581B120572 and IKK120573mRNAwere calculated with2minusΔΔCt method using 120573-actin as the internal standard

29 Statistical Analysis All results were analyzed using SPSSv 180 (IBM) and expressed as averageplusmn standard error (119909plusmn119878)Intergroup differences were analyzed by one-way ANOVAand group-wise comparisons were made using Tukey HSDprotocol with 119875 lt 005 as being statistically significant

3 Results

31 Effect of V axillare-Loaded Serum on Cell Viability afterEthanol Damage As seen in Figure 1 normal cells appearedas a dense monolayer that adhered to the bottom andmaintained their healthy cuboidal shapes In the ethanolmodel group most cells had swollen to round shape andsignificant numbers dissociated from the wall Intercellularspace increased connections decreased and cells separated

4 Gastroenterology Research and PracticeO

D (4

90nm

)

lowastlowast

lowastlowast

lowastlowast

lowastlowast

lowastlowastΔnablanablalowastlowastΔnablanabla lowastlowastΔnablanabla

ΔΔnablanabla

ΔΔnablanabla

000005010015020025030035040045

2 3 4 5 6 7 8 9 101Groups

Figure 2 Effect of Veronicastrum axillare-loaded serum on cellviability in GES-1 injured by ethanol test by MTT method Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosageof V axillare 10 high dosage of V axillare Compared with normallowast119875 lt 005 lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt001 compared with PMA 998810998810119875 lt 001 compared with low dosageof V axillare + PMA II

119875 lt 001 compared with medium dosageof V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with highdosage ofV axillare + PMA ◼◼119875 lt 001 compared with Ranitidine998771119875 lt 005 compared with low dosage of V axillare e119875 lt 005

from each other In the PMA group cells formed globularaggregates and almost completely floated to the surface Cellmorphology was even worse than the ethanol model groupsuggesting PMA could further stimulate dissociation of cellsfrom each other InV axillare groups as the dosing increasedcell morphology improved and eventually got close to normalcells In low-dose V axillare group although cells werestill swollen the severity was reduced and they remainedadhered to the culturing dish In the medium-dose groupcell swelling was greatly reduced and half of the view fieldshowed normal cell morphology In the high-dose groupalmost no cell swelling was observed The high-dose groupappeared better than the Ranitidine group (positive control)In V axillare + PMA groups there were also improvementsto cell morphology and cell adhesion as the dose increasedbut overall cells appeared weaker than the V axillare groupswithout PMA Compared with the normal group cell in themodel group PMA group and V axillare + PMA groupsall showed significant lower viability (Figure 2 119875 lt 005119875 lt 001) Cell viabilities for V axillare high- and medium-dose groups Ranitidine group and V axillare high-dose+ PMA group were significantly higher than those for thePMA group V axillare low-dose + PMA group and Vaxillare medium-dose + PMA group (119875 lt 005 119875 lt001) Cell viability enhancement in the V axillare high-dosegroup was much better than those in the V axillare + PMAgroups Ranitidine group and V axillare low-dose groupThis indicated V axillare-loaded serum reduced GES-1 celldamage from PMA treatment

32 Effect of V axillare-Loaded Serum on NF-120581B TNF-120572I120581B120572 and IKK120573Level As shown in Figure 3 when comparedwith the normal group the NF-120581B TNF-120572 I120581B120572 and IKK120573levels in the model group and the PMA group all increased

(119875 lt 005 119875 lt 001) Compared with the model groupV axillare groups and Ranitidine group had significantdownregulation of NF-120581B TNF-120572 I120581B120572 and IKK120573 (119875 lt005 119875 lt 001) the effects in the V axillare groups tend tobe dose-dependent with the high-dose group being the mostsignificant V axillare high-dose + PMA group V axillaregroups and Ranitidine group all had significant inhibitionon the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 whencompared with the PMA group (119875 lt 005 119875 lt 001)The inhibition of TNF-120572 was stronger in the V axillarehigh- and medium-dose groups compared with that of Vaxillare low-dose + PMA group (119875 lt 005 Figure 3(b)) Thedownregulation of IkB120572 in theV axillare high- andmedium-dose groups andV axillare high-dose +PMAgroupwasmoresignificant than that ofV axillaremedium-dose+PMAgroup(119875 lt 005 119875 lt 001 Figure 3(c)) The downregulation ofIKK120573 in the V axillare high- and medium-dose groups Vaxillare medium-dose + PMA group and Ranitidine groupwas stronger than that of the V axillare low-dose + PMAgroup (119875 lt 001 119875 lt 005 Figure 3(d))

33 Extraction of Total RNA and Analysis of the DNAAmplification Product The extracted RNA was subjected tonondenaturing agarose gel electrophoresis (2) and the 5S18S and 28S RNA bands were well defined proving theintegrity of the extracted RNA (Figure 4) Electrophoresis ofthe PCR products and subsequent fluorescent quantificationshowed the PCR products were uniform and in agreementwith the expected product size indicating NF-120581B TNF-120572IkB120572 and IKK120573 gene and 120573-actin primers participated inthe reactions and the PCR amplifications were successful(Figure 5)

34 Effect of V axillare-Loaded Serum on the Expression ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA Figure 6 showedthat the model group and PMA group had upregulation ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA compared with thenormal group (119875 lt 001) Moreover the upregulation ofNF-120581B in the PMA group was significantly higher than thatof the model group (119875 lt 001 Figure 6(a)) indicating theactivation of NF-120581B by PMAThe expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA were significantly downregulatedby highmediumlow dose of V axillare and Ranitidine (119875 lt005 119875 lt 001 Figures 6(a) and 6(c)) Compared with thePMA group the expression of NF-120581B TNF-120572 I120581B120572 andIKK120573mRNA was significantly reduced in V axillare groupsV axillare + PMA groups and Ranitidine group (119875 lt 001Figures 6(a)ndash6(c)) Compared with the V axillare high-dose+ PMA group V axillare high-dose group further reducedthe expression of TNF-120572 I120581B120572 and IKK120573mRNA (119875 lt 005119875 lt 001 Figures 6(b)ndash6(d)) and the downregulation of NF-120581B and IKK120573 was more than that of the V axillare low-dosegroup (119875 lt 005 Figures 6(a) and 6(d))

4 Discussion

Alcoholic gastric epithelial injury refers to conditions causedby excessive alcohol consumption that induced damage to

Gastroenterology Research and Practice 5

lowastlowastlowast

0

200

400

600

800

1000

NF-

B co

nten

t (pg

mL)

2 3 4 5 6 7 8 9 101

Groups

(a)

lowastlowast lowastlowastlowastlowastlowast

0

10

20

30

40

50

60

70

TNF-

cont

ent (

pgm

L)

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowast lowastlowast lowastlowast

0

2

4

6

8

10

12

14

IB

cont

ent (

ngm

L)

2 3 4 5 6 7 8 9 101

Groups

(c)

lowast lowastlowastlowast

0

100

200

300

400

500

600

700

IKK

cont

ent (

UL

)

2 3 4 5 6 7 8 9 101

Groups

(d)

Figure 3 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 content in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare + PMA7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normal lowast119875 lt 005lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810119875 lt 005 998810998810119875 lt 001 compared with low dosage of V

axillare + PMA I119875 lt 005 II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001

28S18S

5S

Figure 4 RNA integrity check nondenaturing agarose gel elec-trophoresis

the gastric epithelial tissues (such as gastric ulcer and gas-trorrhagia) The clinical symptoms include abdominal painfullness vomiting and heartburn [3] The injury caused byalcohol is typically exerted by inducing epithelial cell damageand apoptosis Our preliminary in vivo results showed thatthe water extract ofV axillare significantly inhibited ethanol-induced gastric epithelial cell damage [14 15 19] The ulcer

10987654321 181715 1614131211

Figure 5 Agarose gel electrophoresis of qRT-PCR products NoteLanes 5 and 12 DL500 DNA Ladder Marker (500 400 300 200150 100 and 50 bp in turn from the top down) Lanes 1ndash4 120573-actin(144 bp) Lanes 6ndash8 NF-120581B (127 bp) Lanes 9ndash11 TNF-120572 (119 bp)Lanes 13ndash15 I120581B120572 (116 bp) Lanes 16ndash18 IKK120573 (118 bp)

inhibition rates of low middle and high dosage (07 gkg14 gkg and 28 gkg) group were 479 714 and 894respectively [15] The current study used MTT assay toexamine the effect on cell viability under ethanol assault bypretreatment of GES-1 with V axillare-loaded serum Theresults showed that V axillare-loaded serum had protectiveeffects and reduced the damage caused by ethanolThis is thefirst evidence at the cellular level thatV axillare-loaded serum

6 Gastroenterology Research and Practice

lowastlowastΔΔlowastlowastΔΔ

lowastlowastnablanabla

ΔΔnablanabla ΔΔnablanablaΔΔnablanabla

ΔΔnablanabla

00

05

10

15

20

25

30

35

40N

F-

B m

RNA

expr

essio

n

2 3 4 5 6 7 8 9 101

Groups

lowastlowastΔΔnablanabla

lowastlowast

(a)

lowastlowastΔΔ

lowastlowast

lowastlowastΔΔnablanablalowastlowastΔΔnablanablalowastlowastnablanabla

nablanablanablanabla

nablanablaΔnablanablaΔΔ

0005101520253035404550

TNF-

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowastΔΔ

lowastlowast

lowastlowast

nablanablaΔΔ

lowastlowastnablanabla

lowastlowastnablanabla

ΔnablanablanablanablaΔnablanabla

0005101520253035404550

IB

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(c)

lowastlowast

lowastlowastΔΔ

lowastlowastnablanablalowastlowastnablanabla lowastlowastnablanabla lowastlowastnablanabla

nablanablanablanablaΔΔnablanabla

2 3 4 5 6 7 8 9 101

Groups

00

05

10

15

20

25

30

35

40

IKK

mRN

A ex

pres

sion

(d)

Figure 6 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normallowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810998810119875 lt 001 compared with low dosage of V axillare +

PMA II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with high dosage of V axillare +PMA ◼119875 lt 005 ◼◼119875 lt 001 compared with Ranitidine 998771998771119875 lt 001 compared with low dosage of V axillare e119875 lt 005

is effective against damage induced by ethanol as a model ofalcoholic gastric ulcer [14ndash19]

Alcohol can cause gastric epithelial injury by inducingapoptosis through the TNF-120572 pathway and through the for-mation of ROS which causes cellular damage through oxida-tive stress [3] At the same time the expression of TNF-120572 isunder the control of NF-120581B signal pathway NF-120581B signalingpathway is involved in controlling the gene expression ofmultiple factors and plays an important role in immuneresponse inflammation stress response cell apoptosis can-cer and ontogenetic development [22ndash24] Excessive acti-vation of the NF-120581B pathway will trigger bodyrsquos specificand nonspecific immune response and cause tissue damageand organ dysfunction The three key factors in the NF-120581Bpathway are I120581B120572 IKK120573 and NF-120581B [25] When IKK120573 isactivated by inter- or intracellular stimulations it causes I120581B120572phosphorylation and ubiquitination Ubiquitinated I120581B120572 canbe degraded by a 28S small proteasome which causes thenucleic acid binding domain in NF-120581B to be exposed andthe translocation of NF-120581B into the nucleus This in turnwill change the chemical structure of I120581B causing a seriesof biological responses thus controlling the gene expressionof TNF-120572 [17 26] Studies have shown that Tong Xin LuoCapsule can protect the retina in a mouse diabetic modelby downregulating I120581B120572 IKK120573 and NF-120581B expressions[27] Severe liver damage was observed in IKK120573-knockoutmice and IL-1120573 and TNF-120572 induced NF-120581B activity was

significantly reduced [28] An earlier in vivo study hasshown that the protective effect of V axillare on ethanol-induced gastric ulcer of SD rats is intimately linked to TNF-120572mediated NF-120581B signaling pathway [15 17] Compared withthe ethanol injury model group the expressions of TNF-120572 NF-120581B TNFR-1 RIP1 I120581B120572 and IL-1120573 in rats gastrictissue are downregulated by V axillare The current studyhas shown that in the model group the mRNA expressionof NF-120581B TNF-120572 I120581B120572 and IKK120573 of GES-1 cell linesincreased significantly and the protein concentrations ofthem in GES-1 supernatant also increased remarkably whiledifferent doses of V axillare downregulated these factors inGES-1 and supernatant to various degrees Those indicatedthat V axillare likely exerted the protective effect on GES-1 against ethanol damage through the NF-120581B pathway bydownregulating the expressions of NF-120581B TNF-120572 I120581B120572and IKK120573 The concentrations of NF-120581B I120581B120572 and IKK120573in supernatant increased after the GES-1 were damaged by5 ethanol This increase was likely due to increased cellmembrane permeability from the swelling and cell damagealthough there is possibility that these factors are activelysecreted Further studies will be needed to discern the exactmechanism

PMA can activate protein kinase C (PKC) thus activatingNF-120581B [29] Under resting conditions NF-120581B and I120581B existas an inactive complex in the cytoplasm When cells arestimulated by a PKC agonist PKC is activated with the

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 Gastroenterology Research and PracticeO

D (4

90nm

)

lowastlowast

lowastlowast

lowastlowast

lowastlowast

lowastlowastΔnablanablalowastlowastΔnablanabla lowastlowastΔnablanabla

ΔΔnablanabla

ΔΔnablanabla

000005010015020025030035040045

2 3 4 5 6 7 8 9 101Groups

Figure 2 Effect of Veronicastrum axillare-loaded serum on cellviability in GES-1 injured by ethanol test by MTT method Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosageof V axillare 10 high dosage of V axillare Compared with normallowast119875 lt 005 lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt001 compared with PMA 998810998810119875 lt 001 compared with low dosageof V axillare + PMA II

119875 lt 001 compared with medium dosageof V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with highdosage ofV axillare + PMA ◼◼119875 lt 001 compared with Ranitidine998771119875 lt 005 compared with low dosage of V axillare e119875 lt 005

from each other In the PMA group cells formed globularaggregates and almost completely floated to the surface Cellmorphology was even worse than the ethanol model groupsuggesting PMA could further stimulate dissociation of cellsfrom each other InV axillare groups as the dosing increasedcell morphology improved and eventually got close to normalcells In low-dose V axillare group although cells werestill swollen the severity was reduced and they remainedadhered to the culturing dish In the medium-dose groupcell swelling was greatly reduced and half of the view fieldshowed normal cell morphology In the high-dose groupalmost no cell swelling was observed The high-dose groupappeared better than the Ranitidine group (positive control)In V axillare + PMA groups there were also improvementsto cell morphology and cell adhesion as the dose increasedbut overall cells appeared weaker than the V axillare groupswithout PMA Compared with the normal group cell in themodel group PMA group and V axillare + PMA groupsall showed significant lower viability (Figure 2 119875 lt 005119875 lt 001) Cell viabilities for V axillare high- and medium-dose groups Ranitidine group and V axillare high-dose+ PMA group were significantly higher than those for thePMA group V axillare low-dose + PMA group and Vaxillare medium-dose + PMA group (119875 lt 005 119875 lt001) Cell viability enhancement in the V axillare high-dosegroup was much better than those in the V axillare + PMAgroups Ranitidine group and V axillare low-dose groupThis indicated V axillare-loaded serum reduced GES-1 celldamage from PMA treatment

32 Effect of V axillare-Loaded Serum on NF-120581B TNF-120572I120581B120572 and IKK120573Level As shown in Figure 3 when comparedwith the normal group the NF-120581B TNF-120572 I120581B120572 and IKK120573levels in the model group and the PMA group all increased

(119875 lt 005 119875 lt 001) Compared with the model groupV axillare groups and Ranitidine group had significantdownregulation of NF-120581B TNF-120572 I120581B120572 and IKK120573 (119875 lt005 119875 lt 001) the effects in the V axillare groups tend tobe dose-dependent with the high-dose group being the mostsignificant V axillare high-dose + PMA group V axillaregroups and Ranitidine group all had significant inhibitionon the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 whencompared with the PMA group (119875 lt 005 119875 lt 001)The inhibition of TNF-120572 was stronger in the V axillarehigh- and medium-dose groups compared with that of Vaxillare low-dose + PMA group (119875 lt 005 Figure 3(b)) Thedownregulation of IkB120572 in theV axillare high- andmedium-dose groups andV axillare high-dose +PMAgroupwasmoresignificant than that ofV axillaremedium-dose+PMAgroup(119875 lt 005 119875 lt 001 Figure 3(c)) The downregulation ofIKK120573 in the V axillare high- and medium-dose groups Vaxillare medium-dose + PMA group and Ranitidine groupwas stronger than that of the V axillare low-dose + PMAgroup (119875 lt 001 119875 lt 005 Figure 3(d))

33 Extraction of Total RNA and Analysis of the DNAAmplification Product The extracted RNA was subjected tonondenaturing agarose gel electrophoresis (2) and the 5S18S and 28S RNA bands were well defined proving theintegrity of the extracted RNA (Figure 4) Electrophoresis ofthe PCR products and subsequent fluorescent quantificationshowed the PCR products were uniform and in agreementwith the expected product size indicating NF-120581B TNF-120572IkB120572 and IKK120573 gene and 120573-actin primers participated inthe reactions and the PCR amplifications were successful(Figure 5)

34 Effect of V axillare-Loaded Serum on the Expression ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA Figure 6 showedthat the model group and PMA group had upregulation ofNF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA compared with thenormal group (119875 lt 001) Moreover the upregulation ofNF-120581B in the PMA group was significantly higher than thatof the model group (119875 lt 001 Figure 6(a)) indicating theactivation of NF-120581B by PMAThe expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA were significantly downregulatedby highmediumlow dose of V axillare and Ranitidine (119875 lt005 119875 lt 001 Figures 6(a) and 6(c)) Compared with thePMA group the expression of NF-120581B TNF-120572 I120581B120572 andIKK120573mRNA was significantly reduced in V axillare groupsV axillare + PMA groups and Ranitidine group (119875 lt 001Figures 6(a)ndash6(c)) Compared with the V axillare high-dose+ PMA group V axillare high-dose group further reducedthe expression of TNF-120572 I120581B120572 and IKK120573mRNA (119875 lt 005119875 lt 001 Figures 6(b)ndash6(d)) and the downregulation of NF-120581B and IKK120573 was more than that of the V axillare low-dosegroup (119875 lt 005 Figures 6(a) and 6(d))

4 Discussion

Alcoholic gastric epithelial injury refers to conditions causedby excessive alcohol consumption that induced damage to

Gastroenterology Research and Practice 5

lowastlowastlowast

0

200

400

600

800

1000

NF-

B co

nten

t (pg

mL)

2 3 4 5 6 7 8 9 101

Groups

(a)

lowastlowast lowastlowastlowastlowastlowast

0

10

20

30

40

50

60

70

TNF-

cont

ent (

pgm

L)

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowast lowastlowast lowastlowast

0

2

4

6

8

10

12

14

IB

cont

ent (

ngm

L)

2 3 4 5 6 7 8 9 101

Groups

(c)

lowast lowastlowastlowast

0

100

200

300

400

500

600

700

IKK

cont

ent (

UL

)

2 3 4 5 6 7 8 9 101

Groups

(d)

Figure 3 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 content in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare + PMA7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normal lowast119875 lt 005lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810119875 lt 005 998810998810119875 lt 001 compared with low dosage of V

axillare + PMA I119875 lt 005 II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001

28S18S

5S

Figure 4 RNA integrity check nondenaturing agarose gel elec-trophoresis

the gastric epithelial tissues (such as gastric ulcer and gas-trorrhagia) The clinical symptoms include abdominal painfullness vomiting and heartburn [3] The injury caused byalcohol is typically exerted by inducing epithelial cell damageand apoptosis Our preliminary in vivo results showed thatthe water extract ofV axillare significantly inhibited ethanol-induced gastric epithelial cell damage [14 15 19] The ulcer

10987654321 181715 1614131211

Figure 5 Agarose gel electrophoresis of qRT-PCR products NoteLanes 5 and 12 DL500 DNA Ladder Marker (500 400 300 200150 100 and 50 bp in turn from the top down) Lanes 1ndash4 120573-actin(144 bp) Lanes 6ndash8 NF-120581B (127 bp) Lanes 9ndash11 TNF-120572 (119 bp)Lanes 13ndash15 I120581B120572 (116 bp) Lanes 16ndash18 IKK120573 (118 bp)

inhibition rates of low middle and high dosage (07 gkg14 gkg and 28 gkg) group were 479 714 and 894respectively [15] The current study used MTT assay toexamine the effect on cell viability under ethanol assault bypretreatment of GES-1 with V axillare-loaded serum Theresults showed that V axillare-loaded serum had protectiveeffects and reduced the damage caused by ethanolThis is thefirst evidence at the cellular level thatV axillare-loaded serum

6 Gastroenterology Research and Practice

lowastlowastΔΔlowastlowastΔΔ

lowastlowastnablanabla

ΔΔnablanabla ΔΔnablanablaΔΔnablanabla

ΔΔnablanabla

00

05

10

15

20

25

30

35

40N

F-

B m

RNA

expr

essio

n

2 3 4 5 6 7 8 9 101

Groups

lowastlowastΔΔnablanabla

lowastlowast

(a)

lowastlowastΔΔ

lowastlowast

lowastlowastΔΔnablanablalowastlowastΔΔnablanablalowastlowastnablanabla

nablanablanablanabla

nablanablaΔnablanablaΔΔ

0005101520253035404550

TNF-

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowastΔΔ

lowastlowast

lowastlowast

nablanablaΔΔ

lowastlowastnablanabla

lowastlowastnablanabla

ΔnablanablanablanablaΔnablanabla

0005101520253035404550

IB

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(c)

lowastlowast

lowastlowastΔΔ

lowastlowastnablanablalowastlowastnablanabla lowastlowastnablanabla lowastlowastnablanabla

nablanablanablanablaΔΔnablanabla

2 3 4 5 6 7 8 9 101

Groups

00

05

10

15

20

25

30

35

40

IKK

mRN

A ex

pres

sion

(d)

Figure 6 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normallowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810998810119875 lt 001 compared with low dosage of V axillare +

PMA II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with high dosage of V axillare +PMA ◼119875 lt 005 ◼◼119875 lt 001 compared with Ranitidine 998771998771119875 lt 001 compared with low dosage of V axillare e119875 lt 005

is effective against damage induced by ethanol as a model ofalcoholic gastric ulcer [14ndash19]

Alcohol can cause gastric epithelial injury by inducingapoptosis through the TNF-120572 pathway and through the for-mation of ROS which causes cellular damage through oxida-tive stress [3] At the same time the expression of TNF-120572 isunder the control of NF-120581B signal pathway NF-120581B signalingpathway is involved in controlling the gene expression ofmultiple factors and plays an important role in immuneresponse inflammation stress response cell apoptosis can-cer and ontogenetic development [22ndash24] Excessive acti-vation of the NF-120581B pathway will trigger bodyrsquos specificand nonspecific immune response and cause tissue damageand organ dysfunction The three key factors in the NF-120581Bpathway are I120581B120572 IKK120573 and NF-120581B [25] When IKK120573 isactivated by inter- or intracellular stimulations it causes I120581B120572phosphorylation and ubiquitination Ubiquitinated I120581B120572 canbe degraded by a 28S small proteasome which causes thenucleic acid binding domain in NF-120581B to be exposed andthe translocation of NF-120581B into the nucleus This in turnwill change the chemical structure of I120581B causing a seriesof biological responses thus controlling the gene expressionof TNF-120572 [17 26] Studies have shown that Tong Xin LuoCapsule can protect the retina in a mouse diabetic modelby downregulating I120581B120572 IKK120573 and NF-120581B expressions[27] Severe liver damage was observed in IKK120573-knockoutmice and IL-1120573 and TNF-120572 induced NF-120581B activity was

significantly reduced [28] An earlier in vivo study hasshown that the protective effect of V axillare on ethanol-induced gastric ulcer of SD rats is intimately linked to TNF-120572mediated NF-120581B signaling pathway [15 17] Compared withthe ethanol injury model group the expressions of TNF-120572 NF-120581B TNFR-1 RIP1 I120581B120572 and IL-1120573 in rats gastrictissue are downregulated by V axillare The current studyhas shown that in the model group the mRNA expressionof NF-120581B TNF-120572 I120581B120572 and IKK120573 of GES-1 cell linesincreased significantly and the protein concentrations ofthem in GES-1 supernatant also increased remarkably whiledifferent doses of V axillare downregulated these factors inGES-1 and supernatant to various degrees Those indicatedthat V axillare likely exerted the protective effect on GES-1 against ethanol damage through the NF-120581B pathway bydownregulating the expressions of NF-120581B TNF-120572 I120581B120572and IKK120573 The concentrations of NF-120581B I120581B120572 and IKK120573in supernatant increased after the GES-1 were damaged by5 ethanol This increase was likely due to increased cellmembrane permeability from the swelling and cell damagealthough there is possibility that these factors are activelysecreted Further studies will be needed to discern the exactmechanism

PMA can activate protein kinase C (PKC) thus activatingNF-120581B [29] Under resting conditions NF-120581B and I120581B existas an inactive complex in the cytoplasm When cells arestimulated by a PKC agonist PKC is activated with the

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Gastroenterology Research and Practice 5

lowastlowastlowast

0

200

400

600

800

1000

NF-

B co

nten

t (pg

mL)

2 3 4 5 6 7 8 9 101

Groups

(a)

lowastlowast lowastlowastlowastlowastlowast

0

10

20

30

40

50

60

70

TNF-

cont

ent (

pgm

L)

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowast lowastlowast lowastlowast

0

2

4

6

8

10

12

14

IB

cont

ent (

ngm

L)

2 3 4 5 6 7 8 9 101

Groups

(c)

lowast lowastlowastlowast

0

100

200

300

400

500

600

700

IKK

cont

ent (

UL

)

2 3 4 5 6 7 8 9 101

Groups

(d)

Figure 3 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 content in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare + PMA7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normal lowast119875 lt 005lowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810119875 lt 005 998810998810119875 lt 001 compared with low dosage of V

axillare + PMA I119875 lt 005 II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001

28S18S

5S

Figure 4 RNA integrity check nondenaturing agarose gel elec-trophoresis

the gastric epithelial tissues (such as gastric ulcer and gas-trorrhagia) The clinical symptoms include abdominal painfullness vomiting and heartburn [3] The injury caused byalcohol is typically exerted by inducing epithelial cell damageand apoptosis Our preliminary in vivo results showed thatthe water extract ofV axillare significantly inhibited ethanol-induced gastric epithelial cell damage [14 15 19] The ulcer

10987654321 181715 1614131211

Figure 5 Agarose gel electrophoresis of qRT-PCR products NoteLanes 5 and 12 DL500 DNA Ladder Marker (500 400 300 200150 100 and 50 bp in turn from the top down) Lanes 1ndash4 120573-actin(144 bp) Lanes 6ndash8 NF-120581B (127 bp) Lanes 9ndash11 TNF-120572 (119 bp)Lanes 13ndash15 I120581B120572 (116 bp) Lanes 16ndash18 IKK120573 (118 bp)

inhibition rates of low middle and high dosage (07 gkg14 gkg and 28 gkg) group were 479 714 and 894respectively [15] The current study used MTT assay toexamine the effect on cell viability under ethanol assault bypretreatment of GES-1 with V axillare-loaded serum Theresults showed that V axillare-loaded serum had protectiveeffects and reduced the damage caused by ethanolThis is thefirst evidence at the cellular level thatV axillare-loaded serum

6 Gastroenterology Research and Practice

lowastlowastΔΔlowastlowastΔΔ

lowastlowastnablanabla

ΔΔnablanabla ΔΔnablanablaΔΔnablanabla

ΔΔnablanabla

00

05

10

15

20

25

30

35

40N

F-

B m

RNA

expr

essio

n

2 3 4 5 6 7 8 9 101

Groups

lowastlowastΔΔnablanabla

lowastlowast

(a)

lowastlowastΔΔ

lowastlowast

lowastlowastΔΔnablanablalowastlowastΔΔnablanablalowastlowastnablanabla

nablanablanablanabla

nablanablaΔnablanablaΔΔ

0005101520253035404550

TNF-

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowastΔΔ

lowastlowast

lowastlowast

nablanablaΔΔ

lowastlowastnablanabla

lowastlowastnablanabla

ΔnablanablanablanablaΔnablanabla

0005101520253035404550

IB

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(c)

lowastlowast

lowastlowastΔΔ

lowastlowastnablanablalowastlowastnablanabla lowastlowastnablanabla lowastlowastnablanabla

nablanablanablanablaΔΔnablanabla

2 3 4 5 6 7 8 9 101

Groups

00

05

10

15

20

25

30

35

40

IKK

mRN

A ex

pres

sion

(d)

Figure 6 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normallowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810998810119875 lt 001 compared with low dosage of V axillare +

PMA II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with high dosage of V axillare +PMA ◼119875 lt 005 ◼◼119875 lt 001 compared with Ranitidine 998771998771119875 lt 001 compared with low dosage of V axillare e119875 lt 005

is effective against damage induced by ethanol as a model ofalcoholic gastric ulcer [14ndash19]

Alcohol can cause gastric epithelial injury by inducingapoptosis through the TNF-120572 pathway and through the for-mation of ROS which causes cellular damage through oxida-tive stress [3] At the same time the expression of TNF-120572 isunder the control of NF-120581B signal pathway NF-120581B signalingpathway is involved in controlling the gene expression ofmultiple factors and plays an important role in immuneresponse inflammation stress response cell apoptosis can-cer and ontogenetic development [22ndash24] Excessive acti-vation of the NF-120581B pathway will trigger bodyrsquos specificand nonspecific immune response and cause tissue damageand organ dysfunction The three key factors in the NF-120581Bpathway are I120581B120572 IKK120573 and NF-120581B [25] When IKK120573 isactivated by inter- or intracellular stimulations it causes I120581B120572phosphorylation and ubiquitination Ubiquitinated I120581B120572 canbe degraded by a 28S small proteasome which causes thenucleic acid binding domain in NF-120581B to be exposed andthe translocation of NF-120581B into the nucleus This in turnwill change the chemical structure of I120581B causing a seriesof biological responses thus controlling the gene expressionof TNF-120572 [17 26] Studies have shown that Tong Xin LuoCapsule can protect the retina in a mouse diabetic modelby downregulating I120581B120572 IKK120573 and NF-120581B expressions[27] Severe liver damage was observed in IKK120573-knockoutmice and IL-1120573 and TNF-120572 induced NF-120581B activity was

significantly reduced [28] An earlier in vivo study hasshown that the protective effect of V axillare on ethanol-induced gastric ulcer of SD rats is intimately linked to TNF-120572mediated NF-120581B signaling pathway [15 17] Compared withthe ethanol injury model group the expressions of TNF-120572 NF-120581B TNFR-1 RIP1 I120581B120572 and IL-1120573 in rats gastrictissue are downregulated by V axillare The current studyhas shown that in the model group the mRNA expressionof NF-120581B TNF-120572 I120581B120572 and IKK120573 of GES-1 cell linesincreased significantly and the protein concentrations ofthem in GES-1 supernatant also increased remarkably whiledifferent doses of V axillare downregulated these factors inGES-1 and supernatant to various degrees Those indicatedthat V axillare likely exerted the protective effect on GES-1 against ethanol damage through the NF-120581B pathway bydownregulating the expressions of NF-120581B TNF-120572 I120581B120572and IKK120573 The concentrations of NF-120581B I120581B120572 and IKK120573in supernatant increased after the GES-1 were damaged by5 ethanol This increase was likely due to increased cellmembrane permeability from the swelling and cell damagealthough there is possibility that these factors are activelysecreted Further studies will be needed to discern the exactmechanism

PMA can activate protein kinase C (PKC) thus activatingNF-120581B [29] Under resting conditions NF-120581B and I120581B existas an inactive complex in the cytoplasm When cells arestimulated by a PKC agonist PKC is activated with the

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 Gastroenterology Research and Practice

lowastlowastΔΔlowastlowastΔΔ

lowastlowastnablanabla

ΔΔnablanabla ΔΔnablanablaΔΔnablanabla

ΔΔnablanabla

00

05

10

15

20

25

30

35

40N

F-

B m

RNA

expr

essio

n

2 3 4 5 6 7 8 9 101

Groups

lowastlowastΔΔnablanabla

lowastlowast

(a)

lowastlowastΔΔ

lowastlowast

lowastlowastΔΔnablanablalowastlowastΔΔnablanablalowastlowastnablanabla

nablanablanablanabla

nablanablaΔnablanablaΔΔ

0005101520253035404550

TNF-

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(b)

lowastlowastΔΔ

lowastlowast

lowastlowast

nablanablaΔΔ

lowastlowastnablanabla

lowastlowastnablanabla

ΔnablanablanablanablaΔnablanabla

0005101520253035404550

IB

mRN

A ex

pres

sion

2 3 4 5 6 7 8 9 101

Groups

(c)

lowastlowast

lowastlowastΔΔ

lowastlowastnablanablalowastlowastnablanabla lowastlowastnablanabla lowastlowastnablanabla

nablanablanablanablaΔΔnablanabla

2 3 4 5 6 7 8 9 101

Groups

00

05

10

15

20

25

30

35

40

IKK

mRN

A ex

pres

sion

(d)

Figure 6 Effect of Veronicastrum axillare-loaded serum on NF-120581B TNF-120572 I120581B120572 and IKK120573 mRNA in GES-1 injured by ethanol Note 1normal 2 model 3 PMA 4 low dosage of V axillare + PMA 5 medium dosage of V axillare + PMA 6 high dosage of V axillare +PMA 7 Ranitidine 8 low dosage of V axillare 9 medium dosage of V axillare 10 high dosage of V axillare Compared with normallowastlowast119875 lt 001 compared with model 119875 lt 005 119875 lt 001 compared with PMA 998810998810119875 lt 001 compared with low dosage of V axillare +

PMA II119875 lt 001 compared with medium dosage of V axillare + PMA X119875 lt 005 XX

119875 lt 001 compared with high dosage of V axillare +PMA ◼119875 lt 005 ◼◼119875 lt 001 compared with Ranitidine 998771998771119875 lt 001 compared with low dosage of V axillare e119875 lt 005

is effective against damage induced by ethanol as a model ofalcoholic gastric ulcer [14ndash19]

Alcohol can cause gastric epithelial injury by inducingapoptosis through the TNF-120572 pathway and through the for-mation of ROS which causes cellular damage through oxida-tive stress [3] At the same time the expression of TNF-120572 isunder the control of NF-120581B signal pathway NF-120581B signalingpathway is involved in controlling the gene expression ofmultiple factors and plays an important role in immuneresponse inflammation stress response cell apoptosis can-cer and ontogenetic development [22ndash24] Excessive acti-vation of the NF-120581B pathway will trigger bodyrsquos specificand nonspecific immune response and cause tissue damageand organ dysfunction The three key factors in the NF-120581Bpathway are I120581B120572 IKK120573 and NF-120581B [25] When IKK120573 isactivated by inter- or intracellular stimulations it causes I120581B120572phosphorylation and ubiquitination Ubiquitinated I120581B120572 canbe degraded by a 28S small proteasome which causes thenucleic acid binding domain in NF-120581B to be exposed andthe translocation of NF-120581B into the nucleus This in turnwill change the chemical structure of I120581B causing a seriesof biological responses thus controlling the gene expressionof TNF-120572 [17 26] Studies have shown that Tong Xin LuoCapsule can protect the retina in a mouse diabetic modelby downregulating I120581B120572 IKK120573 and NF-120581B expressions[27] Severe liver damage was observed in IKK120573-knockoutmice and IL-1120573 and TNF-120572 induced NF-120581B activity was

significantly reduced [28] An earlier in vivo study hasshown that the protective effect of V axillare on ethanol-induced gastric ulcer of SD rats is intimately linked to TNF-120572mediated NF-120581B signaling pathway [15 17] Compared withthe ethanol injury model group the expressions of TNF-120572 NF-120581B TNFR-1 RIP1 I120581B120572 and IL-1120573 in rats gastrictissue are downregulated by V axillare The current studyhas shown that in the model group the mRNA expressionof NF-120581B TNF-120572 I120581B120572 and IKK120573 of GES-1 cell linesincreased significantly and the protein concentrations ofthem in GES-1 supernatant also increased remarkably whiledifferent doses of V axillare downregulated these factors inGES-1 and supernatant to various degrees Those indicatedthat V axillare likely exerted the protective effect on GES-1 against ethanol damage through the NF-120581B pathway bydownregulating the expressions of NF-120581B TNF-120572 I120581B120572and IKK120573 The concentrations of NF-120581B I120581B120572 and IKK120573in supernatant increased after the GES-1 were damaged by5 ethanol This increase was likely due to increased cellmembrane permeability from the swelling and cell damagealthough there is possibility that these factors are activelysecreted Further studies will be needed to discern the exactmechanism

PMA can activate protein kinase C (PKC) thus activatingNF-120581B [29] Under resting conditions NF-120581B and I120581B existas an inactive complex in the cytoplasm When cells arestimulated by a PKC agonist PKC is activated with the

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Gastroenterology Research and Practice 7

concomitant activation of IKK120573 IKK120573 can act as the kinaseof I120581B to cause its phosphorylation and dissociation fromNF-120581B I120581B120572 contains a gene promoter domain that bindsNF-120581B the binding of which causes I120581B120572 gene expressionto increase rapidly At the same time the dissociated NF-120581Bis activated to display the transcription modulating activity[30ndash34] The gene of the proinflammatory cellular factorTNF-120572 has a 120581B-binding domainWhenNF-120581B is activated itwill bind to the120581Bdomain andpromote its transcription thusaggravating the inflammation [35 36] Study has shown thatwith increasing concentration of PMA the concentration ofNF-120581B protein in astrocytes also increased [37] In anotherstudy the damage to myocytes from Doxorubicin was linkedto the overactivation of NF-120581B and TNF-120572 [38] This studyshowed that the expressions of NF-120581B TNF-120572 I120581B120572 andIKK120573 in the PMA group were significantly higher than thoseof the normal group and the model group This may indicatethat when PMA activated PKC it also activated IKK120573 Thiswould cause the phosphorylation of I120581B120572 and its dissociationfrom NF-120581B The dissociated NF-120581B displayed TNF-120572 mod-ulating activity which affected the NF-120581B signaling pathwayCompared with the PMA groupV axillare high-dose + PMAgrouphad significantly lowerNF-120581BTNF-120572 I120581B120572 and IKK120573levels which indicated V axillare inhibited the activationof NF-120581B pathway by PMA and in turn supported that Vaxillare protectedGES-1 fromalcohol damage by blocking theNF-120581B pathway

Chinese herbal medicines and their active compoundshave become an active research field because of their advan-tages of multitarget multichannel activities and less recur-rence and play an irreplaceable role in the treatment of gastriculcer Our preliminary studies showed that the decoction ofV axillare can significantly reduce the acute gastric mucosalinjury in SD rats induced by ethanol improving the patholog-ical state of the gastric mucosa and regulating the secretionof gastric juice and gastric acid [14] Compared with theethanol injury model group the concentrations or activitiesof multiple protective factors such as NO [12] iNOS [12]superoxide dismutase (SOD) [10] cyclooxygenase 2 (COX2)(unpublished data) prostaglandin E2 (PGE2) (unpublisheddata) and aquaporins (AQP1) [14] in rat gastric epithelialtissues are upregulated by pretreatment of V axillare whilethe activities of pepsin [14] and the expression of endothelin1 (ET-1) [11] AQP3 [14] and AQP4 [14] are downregulatedThe concentrations of EGF [10] and VEGF [12] between theethanol-injured model group and V axillare group are notsignificantly different In this experiment Ranitidine wasused as the positive control This is because Ranitidine isa commonly used drug in the treatment of gastric ulcerRanitidine is a histamine H2 receptor antagonist (H2RA) Itcan effectively inhibit the secretion of gastric acid caused byhistamine pentapeptide gastrin and the stimulation of foodand reduce the activity of pepsin Our prior results showedthat Ranitidine can significantly reduce ethanol-inducedgastric ulcer increase the level of PGE2 and upregulate theexpression of COX-2 protein and mRNA But the antiulcereffect of Ranitidine was weaker than V axillare This maybe related to their different antiulcer mechanisms As theantiulcer mechanism ofV axillare is not clear other antiulcer

drugs such as Omeprazole (a proton pump inhibitors PPIs)Colloidal Bismuth Subcitrate (gastric mucosal protectiveagent) Dexamethasone (anti-inflammatory drugs) Weikan-gling Capsule (Chinese medicine) could be included aspositive controls in further studies

In summary V axillare-loaded serum significantly pro-tected GES-1 against ethanol-induced damage This effect islikely linked to the downregulation of the expression of NF-120581B TNF-120572 I120581B120572 and IKK120573 The exact mechanism remainsto be elucidated

Competing Interests

The authors declare that they have no conflict of interests

Acknowledgments

This study was undertaken with support from ldquoNatural Sci-ence Foundation of Zhejiang Province (no LY14H280006)rdquoand ldquoFounds of Zhejiang Provincial Educational Department(no Y201121241)rdquo The authors wish to express their specialthanks to Professor Robert N Young Kun-yan Zhu Qin YuandMin-li Chen for their helpful comments on experimentaldesigns and an earlier draft of the manuscript They alsothank Yue-qin Cai for providing technical assistance

References

[1] B M Srikanta M N Siddaraju and S M Dharmesh ldquoA novelphenol-bound pectic polysaccharide fromDecalepis hamiltoniiwith multi-step ulcer preventive activityrdquo World Journal ofGastroenterology vol 13 no 39 pp 5196ndash5207 2007

[2] I Sobhani A Bado C Vissuzaine et al ldquoLeptin secretion andleptin receptor in the human stomachrdquo Gut vol 47 no 2 pp178ndash183 2000

[3] C L LiuTheMechanismResearch of Astragalus Glysosidesrsquos Pro-tecting Effect on Ethanol-induced GES-1 Cells Injury GuangzhouUniversity of Chinese Medicine GuangDong China 2014

[4] S Y She D Y Liu M Chen et al ldquoEffect of fungus infection ongastric epitheial cell apoptosis and proliferation in gastric ulcerpatientsrdquoGuangxiMedical Journal vol 24 no 10 pp 1525ndash15262002

[5] Y X Lou and Y Peng ldquoProgress of mechanism researching ofgastric mucosardquo Journal ofMilitary Surgeon in Southwest Chinavol 13 no 1 pp 122ndash123 2011

[6] M Li ldquoDiagnosis and treatment of 76 cases of acute gastricmucosal lesion caused by acute alcoholismrdquo ContemporaryMedicine vol 18 no 33 pp 52ndash53 2012

[7] Y B Zhang Y S Ruan X H Zhao et al ldquoAlcoholmdashinducedgastric mucosal injury and its protective effectrdquo Journal of FoodSafety and Food Quality vol 4 no 4 pp 1239ndash1244 2013

[8] X Dang B Zhao A Gao et al ldquoPharmaceutical research ofVeronicastrumrdquo Journal of Anhui Agricultural Sciences vol 32pp 19801ndash19802 2011

[9] X Q Zeng ldquoFolk remedies for treatment of acute and chronicnephritisrdquo New Rural Technology vol 21 article 44 2010

[10] JHWu ldquoVeronicastrumaxillare treatment of acute and chronicnephritisrdquo Zhejiang Journal of Traditional Chinese Medicine no11 p 516 1997

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

8 Gastroenterology Research and Practice

[11] J HWu ldquoVeronicastrum axillare treatment of pleural effusionrdquoZhejiang Journal of Traditional Chinese Medicine vol 1 article33 2003

[12] J Shu ldquoTreatment of 110 cases of liver cirrhosis with Lysimachiachristinae Hance and Veronicastrum axillare (Siebet Zucc)Yamazakirdquo Journal of Practical Traditional Chinese InternalMedicine vol 19 no 2 p 148 2005

[13] C J Zheng X H Deng Y Wu et al ldquoAntiinflammatory effectsand chemical constituents ofVeronicastrumaxillarerdquoPhytother-apy Research vol 28 no 10 pp 1561ndash1566 2014

[14] G F Shen W Guo W C Zhao et al ldquoAntiulcer effects andaction pathways ofVeronicastrum axillare on gastric ulcer in ratinduced by ethanolrdquo Chinese Journal of Integrated Traditionaland Western Medicine vol 32 no 10 pp 1370ndash1373 2012

[15] Y Du W C Zhao L L Lu et al ldquoStudy on the antiul-cer effects of Veronicastrum axillare on gastric ulcer in ratsinduced by ethanol based on tumor necrosis factor-120572 (TNF-120572) and endothelin-1 (ET-1)rdquo Asian Pacific Journal of TropicalBiomedicine vol 3 no 12 pp 925ndash930 2013

[16] Y Du W C Zhao W W Shen et al ldquoAntiulcer effects ofVeronicastrum axillare on gastric ulcer in rats induced byethanol and the effect on the expression of NO iNOS andVEGFrdquo Journal of Chinese Medical University vol 37 no 10 pp1151ndash1155 2013

[17] Y Du Study on Molecular Mechanism of Veronicastrum axillare(Siebet Zucc) Yamazaki against Gastric Ulcer by InterveningInflammatory Response Zhejiang Chinese Medical UniversityZhejiang China 2014

[18] Q J Lou Y S Xu W C Zhao et al ldquoStudy on the regulationroles of water metabolism in gastric mucosa injury inducedby ethanol and the effect of Veronicastrum axillarerdquo Journal ofZheijang Chinese Medical University vol 40 no 1 pp 13ndash182016

[19] Y S Xu W C Zhao D Y Wang et al ldquoProtective effect ofVeronicastrum axillare on human gastric epithelial cells (GES-1) and its modulation on the PKA CREB and AQP1rdquo Journal ofZhejiang Chinese Medical University vol 40 no 3 pp 173ndash1782016

[20] A B Hummon S R Lim M J Difilippantonio and T RiedldquoIsolation and solubilization of proteins after TRIzol extrac-tion of RNA and DNA from patient material following pro-longed storagerdquo BioTechniques vol 42 no 4 pp 467ndash472 2007

[21] P Chomczynski ldquoA reagent for the single-step simultaneous iso-lation of RNA DNA and proteins from cell and tissue samplesrdquoBioTechniques vol 15 no 3 pp 532ndash536 1993

[22] F Chen V Castranova and X Shi ldquoNew insights into the roleof nuclear factor-120581B in cell growth regulationrdquo The AmericanJournal of Pathology vol 159 no 2 pp 387ndash397 2001

[23] S Ghosh M J May and E B Kopp ldquoNF-120581B and rel proteinsevolutionarily conserved mediators of immune responsesrdquoAnnual Review of Immunology vol 16 pp 225ndash260 1998

[24] A S Baldwin Jr ldquoTheNF-120581B and I120581B proteins new discoveriesand insightsrdquo Annual Review of Immunology vol 14 pp 649ndash681 1996

[25] C Chen RMoreno B Samikannu et al ldquoImproved intraportalislet transplantation outcome by systemic IKK-beta inhibitionNF-120581B activity in pancreatic islets depends on oxygen availabil-ityrdquo American Journal of Transplantation vol 11 no 2 pp 215ndash224 2011

[26] T Zhao Expression and Significance of IKK I120581B and NF-120581B inNSCLC Qingdao University Shandong China 2012

[27] X Wang C Wang H Y Xing et al ldquoEffects of Tongxinluocapsule on retina through IKK120573 I120581B120572 NF-120581B pathway indiabetic mouserdquo Recent Advances in Ophthalmology vol 34 no11 pp 1005ndash1008 2014

[28] M Tanaka M E Fuentes K Yamaguchi et al ldquoEmbryoniclethality liver degeneration and impaired NF-kappaB activa-tion in IKK-beta-deficient micerdquo Immunity vol 10 no 4 pp421ndash429 1999

[29] X Y Yang The Effect of Triptolide on the COX-2 Expressionin A431 Cell Line and PMA-Treated HaCaT Cell Line CentralSouth University Hunan China 2007

[30] M A Huber A Denk R U Peter et al ldquoThe IKK-2IkappaBalphaNF-kappa B pathway plays a key role in the regulationofCCR3 and eotaxin-1 in fibroblasts A critical link to dermatitisin I120581B120572-deficientmicerdquoThe Journal of Biological Chemistry vol277 no 2 pp 1268ndash1275 2002

[31] J S Zhang X Y Wang Y A Shan et al ldquoResearch progress oftranscription factorNF-120581BrdquoChinese Science Bulletin vol 47 no5 pp 323ndash329 2002

[32] N Sizemore N Lerner N Dombrowski et al ldquoDistinct rolesof the IkappaB kinase alpha and beta subunits in liberatingnuclear factor kappaB (NF-kappaB) from IkappaB and inphosphorylating the p65 subunit of NF-kappaBrdquo Journal ofBiological Chemistry vol 277 no 6 pp 3863ndash3869 2002

[33] B H B Kwok B Koh M I Ndubuisi et al ldquoThe anti-inflam-matory natural product parthenolide from the medicinal herbFeverfew directly binds to and inhibits I120581B kinaserdquo Chemistryand Biology vol 8 no 8 pp 759ndash766 2001

[34] P J Chiao S Miyamoto and I M Verma ldquoAutoregulation of Ikappa B alpha activityrdquo Proceedings of the National Academy ofSciences vol 91 no 1 pp 28ndash32 1994

[35] W G van Eyndhoven C J Gamper E Cho et al ldquoTRAF-3 mRNA splice-deletion variants encode isoforms that induceNF-kappaB activationrdquo Molecular Immunology vol 36 no 10pp 647ndash658 1999

[36] J S Kim and C Jobin ldquoRole of NF-kappaB in inflammatorydisorders just when you thought you knew everythingrdquo Journalof Pediatric Gastroenterology and Nutrition vol 38 no 1 pp109ndash110 2004

[37] W Mo B Chen X H Zhou et al ldquoEffect of different con-centration of PMA and PDTC on the expression of NF-120581B inastrocytesrdquo Hainan Medical Journal vol 23 no 7 pp 15ndash172012

[38] J Shu W H Yan H B Wang et al ldquoResearch on TLR4NF-120581B expression of cardiac cells and signal-transduction pathwayof DOX in newborn rats the intervention of dexam ethasonerdquoJournal of Jiangsu University (Medicine Edition) vol 19 no 6pp 480ndash484 2009

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom