Post on 30-Dec-2015
Predictors of Virologic Failure and HIV Drug Resistance Among Patients Receiving Fixed Dose Combination Stavudine/Lamivudine/Nevirapine in
Northern Tanzania
Duke University-KCMC Collaboration
Kilimanjaro Christian Medical Centre
Moshi
TANZANIA
Habib O. Ramadhani,* Nathan M. Thielman, Feng Gao, Jennifer Kirchherr, Rekha Shah, Keren Z. Landman, Evelyn M. Ndosi,
Humphrey J. Shao, Susan C. Morpeth, Jonathan McNeill, Venance P. Maro, John F. Shao, John A. Bartlett,
John A. Crump
Background
• ART access expanding rapidly in Africa– Free ART in Tanzania from September 2004– Before and during transition some patients paid– Focus on numbers of persons on therapy
• Few data are available on prevalence and risk factors for virologic failure and resistance
• Needed to optimize ART programs
Aims
1. Determine extent and risk factors for virologic failure
2. Describe HIV genotypic resistance mutations
Methods
• Retrospective cohort study– 150 HIV-infected adult patients, June-August 2005– FDC D4T/3TC/NVP ≥ 6 months– Consecutive patients presenting for follow up
• Standardized questionnaire– Sociodemographics– Economic conditions– HIV and ART knowledge, beliefs, disclosure– Adherence– Access to care
• Plasma– HIV RNA quantitation– HIV genotypic resistance testing
Methods
• Virologic failure– HIV RNA ≥400 copies/mL
• Drug resistance– ≥1 major NRTI or NNRTI mutation– International AIDS Society (USA) November 2005
Revision
Results• 94 (63%) female
• Median age 41 years (range 19-69)
• Median CD4 ART initiation 113 cells/mm3 (range 1-628)
• Median duration ART 12 months (range 6-27)
• 23 (16%) adherence less than 100%
Results
All subjects 150 (100%)
Virologic failure ≥ 400 copies/mL 48 (32%)
Not virologic failure <400 copies/mL 102 (68%)
Risk Factors for Virologic FailureBivariable Analysis
OR 95% CI p-value
Proportion on months on ART self-funded > median 2.7 1.3 5.6 0.006
Primary or no education 1.8 0.9 3.8 0.092
Male gender 1.3 0.7 2.6 0.452
Minutes walking to clinic 1.0 1.0 1.0 0.084
Age 1.0 1.0 1.0 0.537
Number of months on SVD/LMV/NVP 1.0 1.0 1.0 0.488
Rufiji Asset Score 1.0 1.0 1.1 0.469
Disclosure of HIV serostatus to persons other than clinic staff
0.17 0.3 0.9 0.040
Risk Factors for Virologic FailureMultivariable Analysis*
OR 95% CI p-value
Proportion on months on ART self-funded > median 4.2 1.7 10.5 0.002
Anyone beside clinic staff know HIV serostatus 0.11 0.2 0.7 0.023
*Model controlled for age and gender and included variables with p<0.1 from biavriable analysis
Self-Funded ART and Virologic Failure
• Persons paying for ART were more likely to be maladherent
r=0.54, p<0.001
Results
Genotyping ≥1,000 copies/mL 35 (73%)
No genotyping <1,000 copies/mL 13 (27%)
Sequenced 27 (77%)
Not sequenced 8 (23%)
≥1 resistance mutation 15 (56%)
No resistance mutation 12 (44%)
All subjects 150 (100%)
Virologic failure ≥ 400 copies/mL 48 (32%)
Not virologic failure <400 copies/mL 102 (68%)
Genotypic Resistance
No. mutations n (%) Type Mutation (n)
1 2 (13) NRTI na
NNRTI K103N (1), Y181C (1)
2 7 (47) NRTI M184V (7)
NNRTI K103N (3), Y181C (1), G190A (3)
≥3 6 (40) NRTI Q151M (1), M184V (4), M184I (1) TAMs: M41L (1), K65R (1), L210W (1), T215Y (1)
NNRTI K103N (3), V108I (1), Y181C (4), G190A (2)
Risk Factors for Resistance MutationsBivariable Analysis
OR 95% CI p-value
CD4 count <median at treatment initiation 4.8 1.5, 21.9 0.009
Conclusions
• One third of adult patients taking ART for ≥6 months are experiencing virologic failure
• Patients who paid for ART are at risk for virologic failure mediated by maladherence
• Disclosure of HIV status is protective against virologic failure
• Presence of resistance mutations is associated with low CD4 count at initiation
Recommendations
• Provide free ART and promote social coping to enhance adherence and to limit virologic failure
• Encourage earlier detection of persons with HIV infection
• Sentinel site HIV RNA quantitation useful to– Evaluate ART program – Understand how to optimize ART– Identify treatment failure early
Acknowledgements
• Kilimanjaro Christian Medical Centre– Mark E. Swai, MD
– Sr Gertrude I. Kessy
– Sr Janet U. Kimaro
– Sr Bona K. Shirima
– Francis P. Karia, MBA
– Ahazi T. Kulanga, MBA
• KIWAKKUKI– Dafrosa K. Itemba
– Anna Mgonja
– Rehema A. Kiwera
• Division of Infectious Diseases and International Health, Duke University – John D. Hamilton, MD– Christopher W. Woods, MD, MPH– L. Barth Reller, MD– Anne B. Morrissey
• University of California at San Francisco– David R. Bangsberg, MD, MPH
• US National Institutes of Health– Duke Center for AIDS Research– AITRP– K24– ACTU
Kilimanjaro Christian Medical Centre, Moshi, TANZANIA
Kilimanjaro Christian Medical College, Tumaini University, Moshi, TANZANIA
Amplification of Partial pol Gene
• RNA purified from plasma samples using the Qiagen EZ1 Virus Mini Kit (QIAGEN) and subjected to cDNA synthesis using SuperScript III (Invitrogen)
• Viral cDNA samples were subjected to nested PCR amplification using the following primers with the QIA quick Gel Extraction kit (QIAGEN)
– gagout (5'- TAGAAGAAATGATGACAGCATGTCAGGGAGT -3')– polout (5'- CTAACTTCTGTATATCATTGACAGTCCA -3')– gagin (5'- CTGAGAGACAGGCTAATTTTTTAGGGA -3')– polin (5'- CATCCAAAGGAATGGAGGTTCTTTCTGATG -3')
• PCR cycling conditions included– 1 cycle at 94C for 2 min– 30 cycles of a denaturing step at 94C for 20s– An annealing step at 50C for 15s– An extension step at 68C for 2 min– 1 cycle of an additional extension at 68C for 10min– PCR products were visualized on 0.7% agarose gels and purified
Sequence Analysis
• Performed on purified PCR products by cycle-sequencing and dye terminator methods with an ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems) as recommended by the manufacturer
• Sequences were determined for both strands of DNA– Individual sequence fragments of pol gene amplicon from
each virus were assembled and edited using the Sequencher program 4.2 (Gene Codes).
Phylogenetic Analysis
• Phylogenetic relationships of new viral sequences determined by comparing partial pol nucleotide sequences to group M subtype references– Nucleotide sequences aligned using CLUSTAL– Pairwise evolutionary distances were estimated by using
the Kimura’s two-parameter method to correct for superimposed substitutions
– Sites where there was a gap in any sequence and ambiguous areas within the alignment were excluded from all comparisons
– Phylogenetic trees were constructed by the neighbor-joining method
– Reliability of branching orders was assessed by bootstrap analysis using 1,000 replicates
NRTI Mutations of Patients with Virologic Failure, KCMC, 2005
Patient M-41 A-62 K-65 D-67 K-70 V-75 F-77 F-116 F-151 M-184 L-210 T-215 K-219
19 L I W
22 V
24
31 V Y
32 V
45 V
61 V
75 V
85 V
88 R
95 V
108
129 V
130 V
138 V
International AIDS Society (USA) November 2005 Revision: Major Mutations
NNRTI Mutations of Patients with Virologic Failure, KCMC, 2005
Patient L-100 K-103 V-106 V-108 Y-181 Y-188 G-190 M-230
19 N C
22 A
24 N
31 A
32 N
45 N
61 N
75 I C
85 A
88 C A
95 A
108 C
129 C
130 N C
138 N
International AIDS Society (USA) November 2005 Revision: Major Mutations
H.VI997
H.90CF056J.SE9173
J.SE9280K.EQTB11C
K.MP535B.MNCGB.WEAU160
D.NDKD.94UG1141
TZ19TZ95
TZ24TZ38
TZ103TZ36
TZ88TZ85TZ75
TZ138F1.93BR020.1
F1.FIN9363G.HH8793
G.92NG083C.92BR025
TZ54TZ61
C.ETH2220TZ118
TZ26TZ130
TZ32TZ129
TZ39TZ31
A.KE.Q23-CXC-CGTZ45
TZ108TZ92
TZ27TZ22A.UG.92UG037
TZ20TZ68
TZ43
0.02
Subtype C
Subtype D
Subtype A
HIV-1 Subtypes of Patients with Virologic Failure, KCMC, 2005