PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays

in Drosophila

Part I: Gamma rays

Nanette Brand1

Nonhlanhla Ngwenya2

1Stellenbosch University, 2University of Pretoria, South Africa

Dr Igor Donatovich AlexandrovGenetic GroupLaboratory of Nuclear Problems

Goal To detect the quality and frequency of neutron-induced

mutational lesions in comparison to gamma ray-induced ones for different genes of Drosophila using PCR assay

Our aim: To study the molecular genetic action of gamma rays (60Co) on the black mutant of Drosophila

Polymerase Chain Reaction The polymerase chain reaction (PCR) is a technique for the

in vitro amplification of specific sequences of DNA

PCR allows the detection of different kinds of mutational changes within fragments, deletions locations

PCR result can be positive or negative

Model of study

Drosophila melanogaster (A) Wild type, (B) Black mutant

A B

Well studied example, gene structure known

Has common principal DNA structure with humans

Short life cycle (~15 days)

Permits the study of heritable gene mutation

Black gene structure

DNA Ex1 Ex2 Ex3 DNA

’ F1 R1 F3 R3 Fragment 1 Fragment 3 F2 R2

Fragment 2

In 1 In 2

A

B

5’ 3’

A. Physical map of black gene showing introns (In 1-2) and exons (Ex 1-3). B. Sizes and location of the black gene fragments studied with forward (F) and reverse (R) primers

Primer sequence for PCR

Fragment Primer Primer sequenceAnnealing

temperature (○С)

Size of the PCR

product (bp)

Size of the overlap

fragment (bp)

1F1 aggtgagatcggcacctg

64 1068R1 ttggctgcaatggggcactcac

45

2F2 acaacactcgcccgagtcca

64 1043R2 acactgttgcaggcagc

99

3F3 tggttgctcatttcgaggggt

64 859R3 tcccagttcccaaggcaaggac

Methods

DNA isolation

PCR assay

Gel electrophoresis (DNA analysis)

Results 22 black mutants studied 66 PCR assays performed Deletion of 2 fragments for 1 black mutant

was detected 21 black mutants have a small DNA

alterations not detected by PCR

Electrophoresis

1 2 3 54 76 8 9 10

Conclusion Gamma rays induce mostly small DNA

alterations which cannot be detected by PCR

This study serves as a basis for a study of the molecular genetic action of neutrons

Acknowledgements Dr I. Alexandrov, Dr M. Alexandrova and

Liliana Namolovan Co-presenter

Thank You for Your attention

Protocol for DNA Isolation

Homogenization of tissue

Binding of DNA with sorbent

Purification step

Purified DNA

1 2 3 54 76 8 9 10

Lane 1-3 = 1st fragment, Lane 4, 5 & 7 = 2nd fragment, Lane 8-10 = 3rd fragment and Lane 6 = DNA marker