Post on 10-Jul-2015
description
Mutagens and their actionsMutagens and their actions
Chan Ho Yin, Aurora (02690763)Chen Yiwei, Echo (01790443)Co Ngai Na, Chloe (02715283)Lam Kit Ming, Germaine (02770293)
MutationSpontaneous Mutation & Induced Mutation
MutagenChemical MutagensRadiationBiological Mutagens
Conclusion
Introduction Introduction
The process that produces an inheritable alteration in
DNA StructureChromosome Structure
There are two types of mutationsSpontaneous MutationInduced Mutation
MutationMutation
Spontaneous MutationSpontaneous MutationNatural error during DNA replication or recombinationCaused by background radiationArise randomly as a result in cellsNO ARTIFICIAL TREATMENT
Spontaneous Mutation vs. Induced MutationSpontaneous Mutation vs. Induced Mutation
Spontaneous Mutation vs. Induced MutationSpontaneous Mutation vs. Induced Mutation
Induced MutationInduced MutationCaused by exposure to known mutagenic agents
-- Mutagens
MutagenMutagen
A natural or human-made agent which can alter the structure or sequence of genetic material and induce
Mutation
There are three main types ofmutagens classifying by their sources
Chemical MutagensRadiationBiological Mutagens
• Transposable element
• Ionizing Radiation
• UV Radiation
• Base analogs• Chemical
modification agents
• Intercalating agents
BiologicalMutagensRadiationChemical
Mutagens
Chemicals structurally resemble normal bases, purines and pyrimidinesIncorporate into DNA during replicationLead to incorrect insertion of nucleotides opposite them in replication
Chemical Mutagens -Base analogs
5-Bromouracil (5-BU)
2-Aminopurine (2-AP)
For Example
resembles Thymine (T) has Br atom at C-5 instead of methyl group as in T can incorporate into DNA and pair with either A or G due to tautomerization
5-Bromouracilanalog of a pyrimidine
* TAUTOMERIZATION – spontaneous structural alternations between 2 forms, keto form and enol form
5-Bromouracilanalog of a pyrimidine
Mechanism of 5-Bromouracil
Mechanism of 5-Bromouracil
Mechanism of 5-Bromouracil
Mechanism of 5-Bromouracil
Chemicals which alter structure and pairing properties of normal basesActive on both replicating and non-replicating DNAResult in mutation upon DNA replication by forming baseless sites or mispairTwo common chemical modification agents
Alkylating agentsDeaminating agents
Chemical Mutagens-Chemical Mutagens-Chemical modification agentsChemical modification agents
Modify the normal bases by adding alkyl groupsCommon alkylating agents
Ethylmethane sulfonate (EMS) Nitrosoguanidine (NG)Di-(2-chloroethyl) sulfide (Sulfur mustard)Di-(2-chloroethyl) methylamine (Nitrogen mustard)
Alkylating agentsAlkylating agents
Ethylmethane sulfonate (EMS)
Alkylating agentsAlkylating agents
Ethylate base’s 7-N & 6-O positions
Mechanism ofMechanism ofEthylmethane sulfonate (EMS)Ethylmethane sulfonate (EMS)
Ethylate base’s 7-N & 6-O positions
Mechanism ofMechanism ofEthylmethane sulfonate (EMS)Ethylmethane sulfonate (EMS)
Oxidative deamination of amino group in Adenine (A), Guanine (G) and Cytosine (C)
Deaminating agentsDeaminating agents
Nitrous acid (HNO2) is one of common deaminating agents
Convert the amino group (-NH2) into ketogroup (=O)Change H-bonding potential of the modified bases
Deaminating agentsDeaminating agents
Adenine (A) → Hydroxanthine
Mechanism of Nitrous acidMechanism of Nitrous acid
Cytosine (C) → Urail
Mechanism of Nitrous acidMechanism of Nitrous acid
Guanine (G) → Xanthine
Mechanism of Nitrous acidMechanism of Nitrous acid
A group of aromatic organic moleculesRoughly the same dimensions as a nitrogenous base pairIntercalate or wedge between the base pair
Chemical Mutagens-Intercalating agentsChemical Mutagens-Intercalating agents
Cause addition or deletion of base pairs of intact DNAAlter reading frame of gene Result in non-functional gene product
Chemical Mutagens-Intercalating agentsChemical Mutagens-Intercalating agents
Mechanism of Intercalating agents
Mechanism of Intercalating agents
Mechanism of Intercalating agents
Mechanism of Intercalating agentsCommon intercalating agents
2,8-Diamino acridine (proflavin)Acridine orange
Ionising radiatione.g. x rays, γrays,
cosmic rays
Non-ionising radiatione.g. UV radiation
Physical MutagensPhysical Mutagens
Natural Sources:Sunlight, outer space
Artificial Sources:Medical diagnostic, powerplant
Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)
MechanismProduction of highly reactive free radicals (OH• radicals)Interaction between the radicals and DNA, proteins, lipids in cell membrane etc.
Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)
EffectsOrganelle failureCell division blockageCell death
Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)
Breaks in one or both strands(can lead to rearrangements, deletions, chromosome loss death if unrepaired)
Damage to/loss of bases (mutation)
Crosslinking of DNA to itself or proteins
Interaction with DNAInteraction with DNA
Interaction with DNAInteraction with DNA
CATCACCTGTACCAGTAGTGGACATGGT
deletion
CATTCACCTGTACCAGTAAGTGGACATGGT
normal sequence
Base pair mutation
Take UV radiation as an exampleIts wavelengths are preferentially absorbed by bases of DNA and by aromatic amino acids of proteins
Normally classified in terms of its wavelengths:UV-A, UV-B, UV-C (in decreasing order of wavelengths)
Non-Ionizing RadiationNon-Ionizing Radiation(Less energy, Non-penetrating)(Less energy, Non-penetrating)
Non-Ionizing RadiationNon-Ionizing Radiation(Less energy, Non-penetrating)(Less energy, Non-penetrating)
MechanismFormation of Thymine dimers
These dimers cause the strand to buckle, disrupting normal base pairing
Prevent normal replication and transcription
Formation of Thymine-thymine dimer
Transposable element
Insertions result in dysfunction of genes
Common biological mutagensRubella virusCytomegalovirusHepatitis B virus
Biological MutagensBiological Mutagens
Biological agents
Biological MutagensBiological Mutagens
Conclusion Conclusion
MutationSpontaneous Mutation & Induced Mutation
MutagenChemical MutagensRadiationBiological Mutagens
Exposure to mutagen may induce mutation!
References References
Principles of GeneticsAn Introduction of Genetic AnalysisDNA replicationhttp://pharmacology.unmc.edu/cancer/antibio.htm
Thank YouThank You
Chan Ho Yin, Aurora (02690763)Chen Yiwei, Echo (01790443)Co Ngai Na, Chloe (02715283)Lam Kit Ming, Germaine (02770293)