Post on 03-Oct-2020
J Cell Physiol. 2020;1–11. wileyonlinelibrary.com/journal/jcp © 2020 Wiley Periodicals, Inc. | 1
Received: 17 July 2019 | Accepted: 9 January 2020
DOI: 10.1002/jcp.29506
OR I G I NA L R E S EA RCH AR T I C L E
miR‐4510 acts as a tumor suppressor in gastrointestinalstromal tumor by targeting APOC2
Yuan Chen1 | Chengkun Qin2 | Xianping Cui2 | Wenmao Geng2 | Guozhe Xian2 |Zhiyi Wang2
1Department of Pediatrics, Shandong
Provincial Hospital Affiliated to Shandong
University, Jinan, China
2Department of Hepatobiliary Surgery,
Shandong Provincial Hospital Affiliated to
Shandong University, Jinan, China
Correspondence
Zhiyi Wang, Department of Hepatobiliary
Surgery, Shandong provincial Hospital
Affiliated to Shandong University, 324 Jingwu
Road, Jinan, 250021 Shandong, P.R. China.
Email: wzy665@163.com
Funding information
Natural Science Foundation of Shandong
Province, Grant/Award Number:
ZR2013HQ026; Key Research and
Development Plan of Shandong Province,
Grant/Award Numbers: 2013G0021810,
2017GSF218035
Abstract
Dysregulation of microRNAs (miRNAs) expression has been demonstrated in
gastrointestinal stromal tumor (GIST). In this study, we aimed to determine the
differential miRNAs expression in GISTs and explore the functional mechanism of
differential miRNAs in GIST cells. We measured differential miRNAs in six pairs of
GIST tissues and matched adjacent tissues through a high‐throughput sequencing,which was confirmed in 64 pairs of GIST tissues and adjacent tissues by real‐time
polymerase chain reaction. We found that miR‐4510 expression was significantly
downregulated in GIST tissues compared to matched control tissues. Luciferase
reporter assay identified apolipoprotein C‐II (APOC2) as a direct target of
miR‐4510. Overexpression of miR‐4510 inhibited the mRNA and protein expression
of APOC2. In addition, overexpression of miR‐4510 suppressed GIST cell
proliferation, migration, and invasion. Overexpression of miR‐4510 also inhibited
the phosphorylation of AKT and ERK1/2, reduced the expression of matrix
metallopeptidase 2 (MMP2) and MMP9. APOC2 knockdown mimicked the effect
of miR‐4510 overexpression. Further investigation confirmed that APOC2 was
notably upregulated in GIST tissues compared to adjacent control tissues. These
results suggested that miR‐4510 downregulation could promote GIST progression,
including growth, invasion, and metastasis, through increasing APOC2 expression.
K E YWORD S
APOC2, gastrointestinal stromal tumor, microRNA, miR‐4510, proliferation
1 | INTRODUCTION
Gastrointestinal stromal tumor (GIST) is commonly characterized
as mesenchymal tumors of gastrointestinal tract (Nannini et al.,
2015). The activating mutations in c‐KIT and platelet‐derivedgrowth factor receptor‐α (PDGFRA) are found in over 80% of
GISTs, which triggers GIST growth (Barnett, Corless, & Heinrich,
2013). Approximately 10% of GISTs without mutations in c‐KITand PDGFRA are called “wild type (wt)” GISTs (Barnett et al.,
2013). Pediatric GISTs and 10–15% of adult GISTs present as wt
GISTs (Weldon et al., 2017). So far, surgical resection is the main
treatment for patients with GIST. However, more than 50%
patients subsequently develop local recurrence and distant
metastasis, leading to fatal prognosis (Joensuu, Hohenberger, &
Corless, 2013). The adjuvant imatinib that targets the tyrosine
kinase c‐KIT has improved the prognosis of GIST patients
with mutations in c‐KIT and PDGFRA after surgery, but
is powerless for wt GISTs (Chen et al., 2017). Therefore, it is
necessary to explore the novel molecular mechanism of GIST
progression.
MicroRNAs (miRNAs) are small noncoding RNAs that
contain 18–25 nucleotides, and regulate gene expression by
binding to the 3′‐untranslated region (3′‐UTR) of targeted
messenger RNAs (mRNAs; Akcakaya et al., 2014). miRNAs have
been widely implicated in tumor progression, including prolifera-
tion, invasion, and metastasis. Recently, miRNAs have been
demonstrated to be critical for the development and progression
of GIST (Akcakaya et al., 2014; Long, Wu, Cai, Wang, & Zhou,
2018; Yun et al., 2018). For example, miR‐221 and miR‐222 are
significantly downregulated in KIT‐positive GIST, and overexpres-
sion of these two miRNAs inhibits proliferation of GIST‐T1 cells by
targeting KIT (Ihle et al., 2015). miR‐374b promotes GIST cell
proliferation by inhibiting phosphatase and tensin homolog (Long
et al., 2018). miR‐182 expression is remarkably elevated in GISTs
compared with adjacent normal tissues, and overexpression of
miR‐182 increased GIST‐T1 cell proliferation and migration by
inhibiting the expression of cylindromatosis (Ling, Yu, & Cao,
2018). These results indicate that dysregulation of microRNAs in
GISTs plays a key role in GIST cells growth, migration, and
invasion.
In this study, we evidenced that miR‐4510 expression was
reduced in GISTs compared with adjacent normal tissues. Over-
expression of miR‐4510 inhibited GIST‐882 cell proliferation,
migration, and invasion by targeting apolipoprotein C‐II (APOC2).
Further investigation showed that APOC2 expression was higher in
GISTs than that in adjacent normal tissues. These results suggested
that downregulation of miR‐4510 might promote the progression of
GISTs by increasing APOC2 expression.
2 | MATERIALS AND METHODS
2.1 | Antibodies and reagents
Anti‐Akt was purchased from Anbo Biotechnology Company
(San Francisco, CA); Anti‐phospho‐Akt (Ser473), anti‐phospho‐ERK1/2, anti‐ERK1/2, anti‐APOC2, anti‐matrix metallopeptidase 2
(MMP2), anti‐MMP9, and anti‐β‐actin were purchased from
Abcam (Cambridge, MA); Cell Counting Kit‐8 was purchased from
Dojindo Laboratories (Tokyo, Japan). miR‐4510 and miR‐4510inhibitor were synthesized by Biosune Biotechnology (Shanghai,
China).
2.2 | Study population
Patients with GIST were recruited from Shandong Provincial Hospital
Affiliated to Shandong University. Sixty four patients received
surgery, of which none received receptor tyrosine kinase inhibitor
therapy before the surgery. All procedures performed in studies
involving human participants were in accordance with the ethical
standards of the Ethics Committee of Shandong provincial Hospital
affiliated to Shandong University and with the 1964 Helsinki
declaration and its later amendments or comparable ethical
standards. Informed consent was obtained from all individual
participants included in the study.
2.3 | Small RNA preparation and analysis
Total RNAs were extracted using TRIzol reagent (Invitrogen), and were
sequentially ligated with RNA 5′ and 3′ adapters. The complementary
DNA (cDNA) constructs were created by reverse transcription followed
by polymerase chain reaction (PCR) amplification. Gel purification was
performed to obtain the amplified cDNA constructs. The small RNA
library was prepared using TruSeq Small RNA Sample Prep Kits
(Illumina, San Diego). The purified cDNA library was prepared for
cluster generation on Illumina's Cluster Station.
Raw reads were subjected to an in‐house program, ACGT101‐miR
(LC Sciences, Houston, TX), to remove adapter dimers, low quality
reads, common RNA families (rRNA, tRNA, snRNA, snoRNA), and
repeats. Subsequently, unique sequences containing 18–26 bases were
mapped to specific species precursors in miRBase 22.0 using a BLAST
search to identify known miRNAs and novel 3p‐ and 5p‐derivedmiRNAs. The mapped sequences were identified as known miRNAs. The
remaining sequences were mapped to other selected species precursors
in miRBase 22.0 by BLAST search. The unmapped sequences were
analyzed by a BLAST search against the specific genomes, and the
sequences containing hairpin RNA structures were predicated from the
flank 80‐nt sequences using RNAfold software (http://rna.tbi.univie.ac.
at/cgi‐bin/RNAfold.cgi).
2.4 | Cell culture
The human GIST‐882 and GIST‐T1 cells were purchased from American
Type Culture Collection (Manassas, VA). Cells were cultured in Roswell
Park Memorial Institute‐1640 medium (HyClone) containing 10% fetal
bovine serum (HyClone) at 37°C in 5% CO2.
2.5 | Gene transfection
GIST‐882 and GIST‐T1 cells were grown in a 96‐well plate at a density of
5.0 × 103 cells/well. After growing overnight, the cells were transfected
with lentivirus carrying short hairpin RNAs (shRNAs) against APOC2
(GeneChem, Shanghai, China). For determining the effect of miR‐4510,GIST‐882 cells were transfected with negative control (NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐4510 mimics (5′‐UGAGGGAGUAGGAUGUAUGGUU‐3′), or anti‐miR‐4510 (5′‐AACCAUACAUCCUACUCCCUCA‐3′) using Lipofectamine 3000 (Invitrogen).
2.6 | Cell viability assay
GIST‐882 and GIST‐T1 cells were grown in 96‐well plates at a
density of 5.0 × 103 cells/well. After gene transfection, the cells
were incubated for indicated time. Sequentially, the cells were
incubated with 10 μl WST‐8 dye for 2 hr at 37°C. The absorbance
was measured at 450 nm using SpectraMax M2.
2 | CHEN ET AL.
2.7 | Flow cytometric analysis
GIST‐882 and GIST‐T1 cells were transfected with NC, miR‐4510,or anti‐miR‐4510 for indicated time. The cells were harvested
using trypsin without ethylenediaminetetraacetic acid and phenol
red, followed by incubation in binding buffer containing Annexin‐V‐fluorescein isothiocyanate (2.5 mg/ml) and propidium iodide
(5mg/ml) for 10min in the dark at room temperature. Sequentially,
cell apoptosis was determined by flow cytometric analysis
(Beckman Coulter, Chicago).
F IGURE 1 Differential microRNA (miRNA) expression in gastrointestinal stromal tumor (GIST) tissues. (a) miRNA expression heatmap of
GIST tissues and matched control tissues. (b) Volcano plot of differentially expressed miRNAs in GIST tissues compared to matched controltissues. (c) Gene Ontology enrichment analyses of the differential miRNAs. (d) The Kyoto Encyclopedia of Genes and Genomes pathwayanalyses of the differential miRNAs
CHEN ET AL. | 3
2.8 | Western blot analysis
Western blot analysis was performed as previously described
(Wang et al., 2017). Equal amounts of protein were subjected
to sodium dodecyl sulfate‐polyacrylamide gel electrophoresis
gels and were transferred onto polyvinylidene fluoride mem-
branes. The membranes were blocked with 5% nonfat milk, and
were then incubated with the indicated primary and secondary
antibodies. The protein signals were determined using the
enhanced chemiluminescence kit and quantified using Scion
Image.
2.9 | Luciferase reporter assay
The sequence between the position 80–270 of APOC2 3′‐UTRwere amplified using forward (5′‐GCATCCAGGACCCAGAAGTT‐3′) and reverse (5′‐AAAGCACAGATGGTTAGAGGGA‐3′) primers,
and was then digested and ligated to pMIR‐REPORT (Promega).
HEK293 cells were cotransfected with 300 ng reporter vector,
20 nM wide type miR‐4510 (miR‐4510 WT), or mutant
miR‐4510 (miR‐4510 MT) using Lipofectamine 3000 (Roche), and
5 ng pRL‐SV40 plasmid (Promega) as a normalizing control.
After 24 hr of incubation, luciferase activities were determined
using the Dual‐Luciferase Assay (Promega) according to the
manufacturer's instructions.
2.10 | Quantitative real‐time polymerase chainreaction
Total RNAs were extracted using TRIzol reagent (Invitrogen).
The expression of differential microRNAs was analyzed using
TaqMan miRNA assays (Applied Biosystems, CA) according to
the manufacturer's instructions. U6 snRNA was used as an
internal control. The mRNA expression of APOC2 was determined
using forward (5′‐TGTGGAGCGGAAGTGGGTC‐3′) and reverse
(5′‐CGGCAGAAAGAGGGTGAGA‐3′) primers.
2.11 | Wound‐healing assay
GIST‐882 and GIST‐T1 cells overexpressing miR‐4510 or anti‐miR‐4510 were seeded in six‐well plates at a density of 2 × 105 cells/well.
F IGURE 2 miR‐4510 was downregulated in GIST tissues. (a) A heatmap of eight differential miRNAs between GIST tissues andmatched control tissues. (b–i) Real‐time polymerase chain reaction (PCR) was performed to determine the expression of miR‐134‐5p,miR‐382‐5p, miR‐323b‐3p, miR‐409‐3p, miR‐1185‐1‐3p, miR‐4510, miR‐3187‐3p, and miR‐29b‐1‐5p in 64 pairs of GIST tissues. GIST,gastrointestinal stromal tumor; miRNA, microRNA
4 | CHEN ET AL.
After reaching approximately 90% confluence, a linear wound was
produced in cell monolayer by a sterile pipette tip. Images were
captured in three defined fields at 0 and 24 hr, respectively. The
closure area of wounds was determined using ImageJ (National
Institutes of Health, Bethesda, MD).
2.12 | Transwell assay
GIST‐882 and GIST‐T1 cells overexpressing miR‐4510 or anti‐miR‐4510 were seeded in upper chamber of 24‐well plates containing
serum‐free medium. The upper chambers were coated with Matrigel
Matrix (1× phosphate buffered saline dilution: 1:5; BD Biosciences).
After 48 hr of incubation, the cells invaded to the lower surface of
the membranes were fixed and strained using crystal violet.
2.13 | Statistical analysis
Statistical analysis was performed using GraphPad Prism 6.0. All data
are presented as the mean ± SD of at least three independent
experiments. Student's t test was used to assess the differences
between two groups. One‐way analysis of variance was used to
assess the differences among multiple groups. p < .05 was considered
to be statistically significant.
3 | RESULTS
3.1 | Differential miRNAs between gastrointestinalstromal tumor tissues and matched control tissues
We first analyzed miRNA expression in six pairs of human GIST tissues
(GIST tissue vs. matched control tissue from the same patients). After
excluding undetectable miRNAs in some tissues, we found 117
differential miRNAs in these six pairs of GIST tissues. Figure 1a shows
a heatmap that represented miRNA profiling. The detail data are shown
in Supporting information. Among these miRNAs, five miRNAs were
significantly upregulated (p < .05) and 15 miRNAs were significantly
downregulated (p < .05) (Figure 1b). Subsequently, Gene Ontology (GO)
enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG)
pathway analyses were performed to assess the functions of these
differential miRNAs. Figure 1c,d reveals the probable biological
functions of targeted genes of these differential miRNAs.
3.2 | miR‐4510 was downregulated in GIST tissues
Among these differential miRNAs, miR‐134‐5p, miR‐382‐5p,miR‐323b‐3p, miR‐409‐3p, miR‐1185‐1‐3p, miR‐4510, and
miR‐3187‐3p were significantly downregulated in each pair of GIST
tissues, whereas miR‐29b‐1‐5p was significantly upregulated
(Figure 2a). We next verified the expression of these eight miRNAs
in 64 pairs of GIST tissues by real‐time PCR. The results showed
that miR‐4510, miR‐323b‐3p, and miR‐409‐3p were significantly
downregulated, and miR‐29b‐1‐5p was significantly upregulated in
GIST tissues (GIST‐T) compared to matched control tissues (GIST‐N;
Figure 2b–e). However, no significant difference was observed
in the expression of miR‐134‐5p, miR‐382‐5p, miR‐1185‐1‐3p,and miR‐3187‐3p between GIST‐T and GIST‐N (Figure 2f–i). The
associations between miR‐4510 expression and the clinicopatholo-
gical parameters are shown in Table 1. There was no significant
association between miR‐4510 expression and age (p = .608),
gender (p = .8987), and mutation status (p = .2283). However,
miR‐4510 expression was significantly associated with tumor
location (p = .048), tumor size (p = .02), mitoses (p = 0.03338), and
risk classification (p < .0001).
3.3 | miR‐4510 overexpression inhibited GIST cellproliferation, migration, and invasion
To determine the function of miR‐4510 in GIST progression,
we tested the effect of miR‐4510 on GIST cell proliferation,
migration, and invasion. The results showed that miR‐4510
TABLE 1 The clinicopathological parameters and expression of
miR‐4510 in gastrointestinal stromal tumor samples
Characteristics Number (%)Median expressionof miR‐4510 p‐value
Age (years)
≤55 30 (46.9) 0.79518 ± 0.39196 .608
>55 34 (53.1) 0.74976 ± 0.51164
Gender
Famale 31 (48.4) 0.77092 ± 0.49808 .8987
Male 33 (46.9) 0.75599 ± 0.43544
Location
Stomach 41 (64.1) 0.75144 ± 0.46545 .048
Small intestine 17 (26.5) 0.92892 ± 0.45066
Other 6 (9.4) 0.45245 ± 0.18037
Tumor size (cm)
≤5 22 (34.4) 0.90936 ± 0.47665 .02
≤10 35 (54.7) 0.75251 ± 0.43877
>10 7 (10.9) 0.35745 ± 0.30834
Mitoses per 50 HPFs
≤5 37 0.84103 ± 0.46408 .03338
>5 27 0.62029 ± 0.45761
Mutation status
Wild type 13 (20.3) 0.70923 ± 0.35799 .2283
c‐kit andmutation
48 (75) 0.78101 ± 0.48134
PDGFRA
mutation
3 (4.7) 0.87436 ± 0.54934
Risk classification
Low 10 (15.6) 1.00728 ± 0.39005 <.0001
Intermediate 15 (23.4) 1.08887 ± 0.37747
High 39 (61) 0.57539 ± 0.41635
Abbreviations: HPF, high‐power field; miR‐4510, microRNA‐4510;PDGFRA, platelet‐derived growth factor receptor‐α
CHEN ET AL. | 5
overexpression suppressed GIST cell proliferation while anti‐miR‐4510 accelerated GIST cell growth compared to negative
control (NC) (Figure 3a). Flow cytometry analysis confirmed that
miR‐4510 overexpression increased GIST cell apoptosis while
anti‐miR‐4510 reduced GIST cell apoptosis compared to NC
group (Figure 3b). Further investigation revealed that miR‐4510overexpression inhibited GIST cell migration and invasion
(Figure 3c,d). These results suggested that downregulation of
miR‐4510 in GIST tissues might contribute to GIST cell
proliferation, migration, and invasion.
F IGURE 3 miR‐4510 inhibited GIST cell proliferation, migration, and invasion. (a) GIST‐882 and GIST‐T1 cells were transfected withnegative control (NC), miR‐4510, or anti‐miR‐4510 for indicated time. Cell Counting Kit‐8 (CCK8) assay was used to determine cell viability.
(b) After GIST‐882 and GIST‐T1 cells were transfected with negative control (NC), miR‐4510, or anti‐miR‐4510 for 72 hr, flow cytometricanalysis was performed to determine cell apoptosis. (c and d) After GIST‐882 and GIST‐T1 cells were transfected with negative control (NC),miR‐4510, or anti‐miR‐4510 for 72 hr, cell migration and invasion were determined by wound‐healing assay and transwell assay.GIST, gastrointestinal stromal tumor
6 | CHEN ET AL.
3.4 | APOC2 was a direct target of miR‐4510
We further identified the targeted genes of miR‐4510. The targeted
genes were predicted by Targetscan (http://www.targetscan.org/). As
shown in Figure 4a, at the position 80–270 of APOC2 3′‐UTR, therewere six binding sites of miR‐4510. The sequences containing these
sites were ligated to pMIR‐REPORT to construct pMIR‐APOC2‐Lucplasmid. HEK293 cells were cotransfected with pMIR‐APOC2‐lucand wild type miR‐4510 (miR‐4510 WT) or mutant type miR‐4510(miR‐4510 MT). The results showed that miR‐4510 WT remarkably
reduced luciferase activities while miR‐4510 MT had no effect
(Figure 4b). Overexpression of miR‐4510 not only suppressed mRNA
and protein expression of APOC2 (Figure 4c,d), but also reduced the
secretion of APOC2 to media (Figure 4e). These results indicated
that APOC2 was a direct target of miR‐4510.
3.5 | APOC2 knockdown inhibited GIST cellproliferation, migration, and invasion
APOC2 knockdown was performed to determine the role of APOC2
in GIST progression. Figure 5a showed that, after transfection with
lentivirus carrying shRNAs against APOC2, APOC2 expression was
significantly reduced in GIST cells. APOC2 knockdown inhibited
GIST cell proliferation (Figure 5b), and restrained GIST cell migration
and invasion (Figure 5c–e), which was similar to the effect of
miR‐4510 overexpression. These results suggested that miR‐4510
might control the proliferation, migration, and invasion of GIST cells
by inhibiting APOC2 expression.
3.6 | miR‐4510 overexpression inhibited thephosphorylation of ERK1/2 and AKT, the expressionof MMP2 and MMP9
To determine the functional mechanism of miR‐4510 and APOC2 in
GIST cells, we tested the effects of miR‐4501 overexpression and
APOC2 knockdown on the phosphorylation of ERK1/2 and AKT as
well as the expression of MMP2 and MMP9 in GIST cells. The results
showed that miR‐4510 overexpression notably reduced the phos-
phorylation of ERK1/2 and AKT, and inhibited the expression of
MMP2 and MMP9, which was consistent with the effect of APOC2
knockdown (Figure 6). These results suggested that miR‐4510 might
regulate the phosphorylation of ERK1/2 and AKT as well as the
expression of MMP2 and MMP9 by directly inhibiting APOC2
expression.
3.7 | APOC2 expression was elevated in GISTtissues
We finally assayed the expression of APOC2 in GIST tissues and the
adjacent normal tissues. The western blot analysis showed that
APOC2 expression was higher in GIST tissues than that in the
F IGURE 4 Apolipoprotein C‐II (APOC2) was a direct target of miR‐4510. (a) The putative binding sites of miR‐4510 in the 3′‐untranslatedregion region of APOC2. (b) HEK293 cells were transfected with wild type miR‐4510 (miR‐4510 WT) or mutant type miR‐4510 (miR‐4510 MT)and pMIR‐APOC2‐luc. The dual‐luciferase assay was used to determine the luciferase activities. (c) GIST‐882 cells were transfected with
miR‐4510 or anti‐miR‐4510 for 72 hr. Real‐time PCR was performed to determine the messenger RNA expression of APOC2. (d and e)Western blot analysis was performed to determine the protein expression of APOC2. PCR, polymerase chain reaction
CHEN ET AL. | 7
adjacent normal tissues (Figure 7a), which was confirmed by real‐time PCR (Figure 7b). The associations between APOC2 expression
and the clinicopathological parameters are shown in Table 2. Despite
no significant association between APOC2 expression and age
(p = .9006), gender (p = .2412), and tumor location (p = .5508), APOC2
expression was significantly associated with tumor size (p = .0066),
mitoses (p = .0031), mutation status (p = .0313), and risk classification
(p = .0481). These results suggested that APOC2 upregulation might
contribute to GIST progression.
4 | DISCUSSION
miRNAs are a class of noncoding RNAs that have been implicated in
multiple tumor processes by suppressing the expression of targeted
genes. Recently, several investigations have been performed to
explore miRNA profiling in GIST tissues. For example, downregula-
tion of miR‐221 and miR‐222 promoted KIT‐positive GIST progres-
sion by increasing KIT expression (Ihle et al., 2015), and miR‐494expression is negatively correlated to KIT expression in GIST (Kim
et al., 2011; Yun et al., 2018). Moreover, upregulation of miR‐196a in
GIST tissues is significantly associated with risk classification and
metastasis (Niinuma et al., 2012). In the present study, we evidenced
that miR‐4510 was downregulated in GIST tissues compared to
matched control tissues. To our knowledge, only one report about
miR‐4510 function has been found. This finding identifies miR‐4510as a suppressor in liver cancer by targeting glypican‐3 (Cartier et al.,
2017). Conformably, our results suggested that miR‐4510 served as a
suppressor in GIST cells. Overexpression of miR‐4510 significantly
inhibited GIST cell proliferation, migration, and invasion. Our results
indicated that miR‐4510 downregulation could propel GIST process.
Further investigation identified APOC2 as a direct target of
miR‐4510. APOC2 is a small protein that is synthesized by the liver
and intestine (Jong, Hofker, & Havekes, 1999). APOC2 acts as an
important component of low‐density lipoproteins, very low‐densitylipoproteins, and high‐density lipoproteins, where it assists to
hydrolyze triglycerides associated with lipoproteins by activating
lipoprotein lipase (LaRosa, Levy, Herbert, Lux, & Fredrickson, 1970).
APOC2 has been demonstrated to be closely associated with survival
of patients with pancreatic cancer (Xue et al., 2012). Elevated APOC2
promotes pancreatic cancer cell growth, migration, and invasion.
Although the role of APOC2 in GIST has never been reported,
considering that APOC2 was a direct target of miR‐4510, it was likely
that APOC2 upregulation accelerated GIST progression. As expected,
F IGURE 5 APOC2 knockdown suppressed GIST cell proliferation, migration, and invasion. (a) GIST‐882 and GIST‐T1 cells were transfectedwith lentivirus carrying short hairpin RNAs (shRNAs) against APOC2 (APOC2 shRNA). Western blot analysis was performed to determine
the protein expression of APOC2. (b) After GIST‐882 and GIST‐T1 cells were transfected with APOC2 shRNA, CCK8 assay was performedto determine the cell viability. (c and d) After GIST‐882 and GIST‐T1 cells were transfected with APOC2 shRNA for 72 hr, cells migrationand invasion were determined by wound‐healing assay and transwell assay. APOC2, apolipoprotein C‐II; CCK8, cell counting kit‐8;GIST, gastrointestinal stromal tumor
8 | CHEN ET AL.
our results showed that APOC2 knockdown inhibited GIST cell
proliferation, migration, and invasion. In addition, APOC2 expression
was significantly higher in GIST tissues than that in adjacent tissues.
These results suggested that elevated APOC2 could promote GIST
progression.
KIT signaling pathway has been demonstrated to be an
effective target of GIST (Ran et al., 2015). KIT can bind some
cytoplasmic proteins to form complex, and then phosphorylates
other proteins, which activates AKT and ERK pathway (Bauer,
Duensing, Demetri, & Fletcher, 2007). The phosphorylation
of AKT and ERK play key roles in GIST cell proliferation and
survival (Bauer et al., 2007; Ihle et al., 2015). Our results showed
that both miR‐4510 overexpression and APOC2 knockdown
inhibited the phosphorylation of AKT and ERK, which explained
the inhibitory effects of miR‐4510 overexpression and APOC2
knockdown on GIST cell proliferation. Moreover, miR‐4510
F IGURE 6 miR‐4510 overexpression
and APOC2 knockdown inhibited thephosphorylation of AKT and ERK1/2, theexpression of matrix metallopeptidase
2 (MMP2) and MMP9. GIST‐882 andGIST‐T1 cells were transfected with NC,miR‐4510, ctrl shRNA, or APOC2 shRNA
for 72 hr. Western blot analysis wasperformed to determine the proteinexpression of phosphorylated AKT,phosphorylated ERK1/2, MMP2, and
MMP9. APOC2, apolipoprotein C‐II;shRNA, short hairpin RNA
F IGURE 7 APOC2 expression waselevated in GIST tissues. The western blot
(a) and real‐time PCR (b) were used todetermine the expression of APOC2expression in GIST tissues and the adjacentnormal tissues. APOC2, apolipoprotein
C‐II; GIST, gastrointestinal stromaltumor; PCR, polymerase chain reaction
CHEN ET AL. | 9
overexpression and APOC2 knockdown also suppressed MMP2
and MMP9 expression. MMP2 and MMP9 have been involved in
metastasis of multiple malignancies (Gao et al., 2015; Lu et al.,
2015; Ma et al., 2016; Ye et al., 2017). Therefore, it was reasonable
that miR‐4510 overexpression and APOC2 knockdown reduced
the migratory and invasive capabilities of GIST cells.
5 | CONCLUSION
Taken together, we provided evidence that miR‐4510 expression
was significantly reduced while APOC2 expression was signifi-
cantly elevated in GIST tissues compared to adjacent control
tissues. Further investigation confirmed that APOC2 was a
direct target of miR‐4510. Overexpression of miR‐4510 inhibited
GIST cell proliferation, migration, and invasion, and blocked the
phosphorylation of AKT and ERK1/2 as well as the expression
of MMP2 and MMP9, which was similar to APOC2 knockdown.
These results suggested that miR‐4510 downregulation could
promote GIST progression, including growth, invasion, and
metastasis, through increasing APOC2 expression.
ACKNOWLEDGMENTS
This study was funded by Natural Science Foundation of Shandong
Province (grant no. ZR2013HQ026) and Key Research and Devel-
opment Plan of Shandong Province (grant nos. 2013G0021810;
2017GSF218035).
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
AUTHOR CONTRIBUTIONS
Y. C. and X. C. carried out the experiments. C. Q. and Z. W.
participated in the experiment design. W. G. and G. X. analyzed the
data and wrote the manuscript. All authors read and approved
the final manuscript.
DATA AVAILABILITY STATEMENT
All data used and/or analyzed during the current study are available
from the corresponding author on reasonable request.
ORCID
Zhiyi Wang http://orcid.org/0000-0002-3254-9132
REFERENCES
Akcakaya, P., Caramuta, S., Ahlen, J., Ghaderi, M., Berglund, E.,
Ostman, A., … Lui, W. O. (2014). microRNA expression signatures
of gastrointestinal stromal tumours: Associations with imatinib
resistance and patient outcome. British Journal of Cancer, 111(11),
2091–2102. https://doi.org/10.1038/bjc.2014.548
Barnett, C. M., Corless, C. L., & Heinrich, M. C. (2013). Gastrointestinal
stromal tumors: Molecular markers and genetic subtypes. Hematology/
Oncology Clinics of North America, 27(5), 871–888. https://doi.org/10.
1016/j.hoc.2013.07.003
Bauer, S., Duensing, A., Demetri, G. D., & Fletcher, J. A. (2007). KIT oncogenic
signaling mechanisms in imatinib‐resistant gastrointestinal stromal
tumor: PI3‐kinase/AKT is a crucial survival pathway. Oncogene, 26(54),
7560–7568. https://doi.org/10.1038/sj.onc.1210558
Cartier, F., Indersie, E., Lesjean, S., Charpentier, J., Hooks, K. B., Ghousein,
A., … Grosset, C. F. (2017). New tumor suppressor microRNAs target
glypican‐3 in human liver cancer. Oncotarget, 8(25), 41211–41226.
https://doi.org/10.18632/oncotarget.17162
Chen, W., Kuang, Y., Qiu, H. B., Cao, Z., Tu, Y., Sheng, Q., … Ou, W. B.
(2017). Dual targeting of insulin receptor and KIT in imatinib‐resistantgastrointestinal stromal tumors. Cancer Research, 77(18), 5107–5117.
https://doi.org/10.1158/0008‐5472.CAN‐17‐0917Gao, Y., Guan, Z., Chen, J., Xie, H., Yang, Z., Fan, J., … Li, L. (2015). CXCL5/
CXCR2 axis promotes bladder cancer cell migration and invasion
by activating PI3K/AKT‐induced upregulation of MMP2/MMP9.
International Journal of Oncology, 47(2), 690–700. https://doi.org/10.
3892/ijo.2015.3041
Ihle, M. A., Trautmann, M., Kuenstlinger, H., Huss, S., Heydt, C., Fassunke,
J., …Merkelbach‐Bruse, S. (2015). miRNA‐221 and miRNA‐222 induce
TABLE 2 The clinicopathological parameters and expression ofAPOC2 in GIST samples
Characteristics Number (%)
Median expression
of APOC2 p‐value
Age (years)
≤55 30 (46.9) 1.80286 ± 0.76471 .9006
>55 34 (53.1) 1.76616 ± 1.43092
Gender
Famale 31 (48.4) 1.9596 ± 1.35347 . 2412
Male 33 (46.9) 1.6178 ± 0.93081
Location
Stomach 41 (64.1) 1.89554 ± 1.35335 .5508
Small intestine 17 (26.5) 1.5278 ± 0.62096
Other 6 (9.4) 1.7409 ± 0.83431
Tumor size (cm)
≤5 22 (34.4) 1.21251 ± 0.61498 .0066
>5 to ≤10 35 (54.7) 1.98731 ±± 1.13034
>10 7 (10.9) 2.55771 ± 1.84135
Mitoses per 50 HPFs
≤5 37 1.42596 ± 0.76332 .0031
>5 27 2.27314 ± 1.41924
Mutation status
Wild type 13 (20.3) 2.45613 ± 1.66917 .0313
c‐kit mutation 48 (75) 1.6574 ± 0.94246
PDGFRA
mutation
3 (4.7) 0.88351 ± 0.38296
Risk classification
Low 10 (15.6) 0.85553 ± 0.26006 .0481
Intermediate 15 (23.4) 1.68313 ± 1.04404
High 39 (61) 2.05982 ± 1.2241
Abbreviations: APOC2, apolipoprotein C‐II; GIST, gastrointestinal stromal
tumor; HPF, high‐power field; PDGFRA, platelet‐derived growth factor
receptor‐α
10 | CHEN ET AL.
apoptosis via the KIT/AKT signalling pathway in gastrointestinal
stromal tumours. Molecular Oncology, 9(7), 1421–1433. https://doi.
org/10.1016/j.molonc.2015.03.013
Joensuu, H., Hohenberger, P., & Corless, C. L. (2013). Gastrointestinal
stromal tumour. Lancet, 382(9896), 973–983. https://doi.org/10.
1016/S0140‐6736(13)60106‐3Jong, M. C., Hofker, M. H., & Havekes, L. M. (1999). Role of ApoCs
in lipoprotein metabolism: Functional differences between ApoC1,
ApoC2, and ApoC3. Arteriosclerosis, Thrombosis, and Vascular Biology,
19(3), 472–484.
Kim, W. K., Park, M., Kim, Y. K., Tae, Y. K., Yang, H. K., Lee, J. M., & Kim, H.
(2011). MicroRNA‐494 downregulates KIT and inhibits gastrointestinal
stromal tumor cell proliferation. Clinical Cancer Research, 17(24),
7584–7594. https://doi.org/10.1158/1078‐0432.CCR‐11‐0166LaRosa, J. C., Levy, R. I., Herbert, P., Lux, S. E., & Fredrickson, D. S. (1970).
A specific apoprotein activator for lipoprotein lipase. Biochemical and
Biophysical Research Communications, 41(1), 57–62. https://doi.org/10.
1016/0006‐291x(70)90468‐7Ling, T., Yu, F., & Cao, H. (2018). miR‐182 controls cell growth in
gastrointestinal stromal tumors by negatively regulating CYLD
expression. Oncology Reports, 40(6), 3705–3713. https://doi.org/10.
3892/or.2018.6765
Long, Z. W., Wu, J. H., Cai, H., Wang, Y. N., & Zhou, Y. (2018). MiR‐374bpromotes proliferation and inhibits apoptosis of human GIST
cells by inhibiting PTEN through activation of the PI3K/Akt
pathway. Molecules and Cells, 41(6), 532–544. https://doi.org/10.
14348/molcells.2018.2211
Lu, S., Zhu, Q., Zhang, Y., Song, W., Wilson, M. J., & Liu, P. (2015).
Dual‐functions of miR‐373 and miR‐520c by differently regulating
the activities of MMP2 and MMP9. Journal of Cellular Physiology,
230(8), 1862–1870. https://doi.org/10.1002/jcp.24914
Ma, J., Fu, G., Wu, J., Han, S., Zhang, L., Yang, M., … Wang, Y. (2016).
4‐cholesten‐3‐one suppresses lung adenocarcinoma metastasis by
regulating translocation of HMGB1, HIF1alpha and Caveolin‐1. CellDeath & Disease, 7(9), 1–10. https://doi.org/10.1038/cddis.2016.281
Nannini, M., Ravegnini, G., Angelini, S., Astolfi, A., Biasco, G., & Pantaleo,
M. A. (2015). miRNA profiling in gastrointestinal stromal tumors:
Implication as diagnostic and prognostic markers. Epigenomics, 7(6),
1033–1049. https://doi.org/10.2217/epi.15.52
Niinuma, T., Suzuki, H., Nojima, M., Nosho, K., Yamamoto, H., Takamaru,
H., … Shinomura, Y. (2012). Upregulation of miR‐196a and HOTAIR
drive malignant character in gastrointestinal stromal tumors. Cancer
Research, 72(5), 1126–1136. https://doi.org/10.1158/0008‐5472.CAN‐11‐1803
Ran, L., Sirota, I., Cao, Z., Murphy, D., Chen, Y., Shukla, S., … Chi, P. (2015).
Combined inhibition of MAP kinase and KIT signaling synergistically
destabilizes ETV1 and suppresses GIST tumor growth. Cancer
Discovery, 5(3), 304–315. https://doi.org/10.1158/2159‐8290.CD‐14‐0985
Wang, Z., Chen, Y., Lin, Y., Wang, X., Cui, X., Zhang, Z., … Qin, C. (2017).
Novel crosstalk between KLF4 and ZEB1 regulates gemcitabine
resistance in pancreatic ductal adenocarcinoma. International
Journal of Oncology, 51(4), 1239–1248. https://doi.org/10.3892/
ijo.2017.4099
Weldon, C. B., Madenci, A. L., Boikos, S. A., Janeway, K. A., George, S., von
Mehren, M., … La Quaglia, M. P. (2017). Surgical management of
wild‐type gastrointestinal stromal tumors: A report from the National
Institutes of Health Pediatric and Wildtype GIST Clinic. Journal of
Clinical Oncology, 35(5), 523–528. https://doi.org/10.1200/JCO.2016.
68.6733
Xue, A., Chang, J. W., Chung, L., Samra, J., Hugh, T., Gill, A., … Smith, R.
C. (2012). Serum apolipoprotein C‐II is prognostic for survival
after pancreatic resection for adenocarcinoma. British Journal
of Cancer, 107(11), 1883–1891. https://doi.org/10.1038/bjc.
2012.458
Ye, T. H., Yang, F. F., Zhu, Y. X., Li, Y. L., Lei, Q., Song, X. J., … Wei, Y. Q.
(2017). Inhibition of Stat3 signaling pathway by nifuroxazide
improves antitumor immunity and impairs colorectal carcinoma
metastasis. Cell Death & Disease, 8(1), 1–13. https://doi.org/10.
1038/cddis.2016.452
Yun, S., Kim, W. K., Kwon, Y., Jang, M., Bauer, S., & Kim, H. (2018). Survivin
is a novel transcription regulator of KIT and is downregulated by
miRNA‐494 in gastrointestinal stromal tumors. International Journal
of Cancer, 142(10), 2080–2093. https://doi.org/10.1002/ijc.31235
SUPPORTING INFORMATION
Additional supporting information may be found online in the
Supporting Information section.
How to cite this article: Chen Y, Qin C, Cui X, Geng W,
Xian G, Wang Z. miR‐4510 acts as a tumor suppressor in
gastrointestinal stromal tumor by targeting APOC2. J Cell
Physiol. 2020;1–11. https://doi.org/10.1002/jcp.29506
CHEN ET AL. | 11