Post on 28-Dec-2015
Microsatellite Identification in the Thick-Microsatellite Identification in the Thick-billed Parrot (billed Parrot (Rhynchopsitta Rhynchopsitta
pachyrhynchapachyrhyncha)) By: By:
Daniel Acosta Daniel Acosta Howard Hughes Medical Institute-NMSU Research Howard Hughes Medical Institute-NMSU Research
ScholarScholar
Dr. Wright’s LabDr. Wright’s LabDepartment of BiologyDepartment of Biology
Thick-billed Parrot
• International Union for Conservation of Nature (IUCN 2007)
• World Parrot Trust
• Historic range: Southwestern United States and Northern Mexico (Snyder et. al., 1999)
• Habitat degradation and fragmentation from logging
Genetic Variation• High degree of genetic variation to reduce
the impact of founder effect, which may lead to genetic differentiation
• To adapt to a changing environment and to avoid reduced reproductive fitness.
• Importance to any translocation.
Microsatellites
• Microsatellites are simple sequence repeats (1-6) base pairs long: e.g. GTGTGTGTGTGT or ACGACGACGACGACGACGACG found in the genome of both prokaryotic and eukaryotic organisms
• Found in coding and non-coding regions
• They have a high mutation rate and high variability in natural populations.
• High degree of polymorphism
• All of these characteristics makes microsatellites a class of genetic marker that is highly useful to assess genetic variation.
Methods: Isolation of Microsatellites
DNA Extraction
Boil clone in TE buffer
Genetic LibraryPCR
T3/T7
T3/T7/GT10(Zane et. al. 2002)
(Kongrit et. al., 2008)
Methods: Primer Design Sequencing Primer Design
Test for amplification in thick-billed parrot DNA
Optimize Primers
Polymorphism
CCGAGTAGGACAGAGCCTTGGGTGGCATGGTTTAGTGGGAGGTGTCCCTGCCCACGGCATGGGGTTTGGAACTAGATGATCTTAAGGTCCTTTACAGCCCTAACTGTTCTATGATTCTATTGGGTCTCAAGGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCATTTTCCTCTTCAGGGTGGAATAAGAGCCTTGAATTACAACATTAAACCTTTTAAATGG
Polymorphism
• Having genetic diversity
• Proportion of loci polymorphic: Number of polymorphic loci / total number of loci sampled
• We can also calculate allelic diversity: If we have sampled 6 loci and the diversity is as follows (1, 3, 3, 2, 2, 3) Allelic diversity=(1+3+3+2+2+1) / 6 = 2
• These calculations tell us a great deal about the genetic variation of the target population
Progress and Future Goals
• Up to date: 3 primers we designed and 4 designed for other species.
• These primers have been optimized for [Mg] and annealing temperature.
• We now propose to use these primers to assess the genetic variation not only of the wild population, but of the captive population.
• Compare wild population to captive population
Acknowledgements
• Howard Hughes Medical Institute-NMSU Research Program • Dr. Timothy Wright • Ph. D Student Erin Schirtzinger• Ph. D Student Swati Mukherjee• Ph. D Student Alejandro Salinas• Nadine Lamberski @ San Diego Zoo• Kari L. Schmidt. @ American Museum of Natural History
References
IUCN 2007. Rhynchopsitta pachyrhyncha. <http://www.iucnredlist.org/search/details.php/19715/all> (March 26, 2 008 2007).
Kongrit, C. et. at. (2008). Isolation and characterization of dinucleotide
microsatellite loci in the Asian elephant (Elephas maximus). Molecular
Ecology 8, 175-177
Snyder, N. F. R., E. C. Enkerlin-Hoeflich, and M. A. Cruz-Neto. 1999. Thick-billed Parrot (Rhynchopsitta pachyrhyncha) The Birds of North America 24
Zane, L., Bargelloni, L., & Patarnello, T. (2002). Strategies for microsatellite
isolation: a review. Molecular Ecology 11, 1-16g
Picture Sources• http://www.avianweb.com/images/birds/parrots/thickbilledparrots/thickbilled.jpg
• (map) http://content.cdlib.org/xtf/data/13030/xw/ft0f59n6xw/figures/ft0f59n6xw_00001.gif
• http://www.aviary.org/~aviary/images/thick-billed%20parrots.jpg
• http://www.dkimages.com/discover/previews/928/55058803.JPG
• http://www.sabo.org/images/tbpanest.jpg
• http://www.expeditionswest.com/adventures/2004/sierra_madre/JourneyOneSatevo/images/DSCF3627.jpg