Post on 21-Jun-2019
1
Metabolic control of virulence genes in Brucella: 1
HutC coordinates virB expression and the histidine utilization 2
pathway by direct binding to both promoters† 3
4
Rodrigo Sieira1*, Gastón M. Arocena1, Lucas Bukata1, Diego J. Comerci1,2, and Rodolfo 5 A. Ugalde1§. 6 7
Running title: HutC-dependent expression of the Brucella virB operon 8 9
10
1Instituto de Investigaciones Biotecnológicas, Universidad Nacional de General San 11
Martín, IIB-INTECH-CONICET, San Martín 1650, Buenos Aires, Argentina. 2Comisión 12
Nacional de Energía Atómica, División Agropecuaria, Centro Atómico Ezeiza 1804, 13
Buenos Aires, Argentina. § Deceased on august 17th, 2009. 14
15
† This work is dedicated to the memory of Dr. Rodolfo A. Ugalde. 16
17
*Corresponding author: E-mail: rsieira@iib.unsam.edu.ar Mailing address: Instituto de 18
Investigaciones Biotecnológicas, Universidad Nacional de General San Martín, Av. 19
General Paz 5445 - INTI, Ed. 24. San Martín 1650, Buenos Aires, Argentina. Phone: 20
(54-11) 4580 7255. FAX: (54-11) 4752 9639. 21
22
23 Abbreviations: T4SS, Type-IV Secretion System; UCA, urocanic acid ; PvirB, virB 24 promoter; hut, histidine utilization ; Phut, hut promoter. 25 26
27
28
29
30
31
Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01124-09 JB Accepts, published online ahead of print on 23 October 2009
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
2
ABSTRACT 32
Type-IV Secretion Systems (T4SS) are multicomponent machineries involved in the 33
translocation of effector molecules across the bacterial cell envelope. The virB operon 34
of Brucella abortus codes for a T4SS that is essential for virulence and intracellular 35
multiplication of the bacterium in the host. Previous studies showed that the virB operon 36
of B. abortus is tightly regulated within the host cells. In order to identify factors 37
implicated in the control of virB expression, we searched for proteins of Brucella that 38
directly bind to the virB promoter (PvirB). Using different procedures, we isolated a 27-39
kDa protein that binds specifically to PvirB. This protein was identified as HutC, the 40
transcriptional repressor of the histidine utilization (hut) genes. Analyses of virB and hut 41
promoter activity revealed that HutC exerts two different roles: it acts as a co-activator 42
of transcription of the virB operon whereas it represses the hut genes. Such activities 43
were observed both intracellularly and in bacteria incubated under conditions that 44
resemble the intracellular environment. EMSA and DNase I Footprinting experiments 45
revealed the structure, affinity, and localization of the HutC-binding sites, and 46
supported the regulatory role of HutC in both hut and virB promoters. Taken together 47
these results indicate that Brucella coopted the function of HutC to coordinate the Hut 48
pathway with transcriptional regulation of the virB genes, probably as a way to sense its 49
own metabolic state and develop adaptive responses to overcome intracellular host 50
defences. 51
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
3
INTRODUCTION 52
Type IV secretion systems (T4SSs) are multicomponent machineries central in the 53
pathogenesis of many bacterial genera (i.e.: Brucella, Agrobacterium, Helicobacter, 54
Legionella and Bordetella) (4). T4SS function comprises recognition and translocation 55
of specific substrates across the bacterial cell envelope. The nature of the translocated 56
substrates varies from proteins to DNA-protein complexes. In addition to the well 57
studied Agrobacterium T-DNA and B. pertussis toxin, several translocated effectors 58
have been identified in Helicobacter, Legionella and Brucella (7). In every case, the 59
translocated molecules alter cellular processes in such a way that allow the pathogen to 60
overcome host defences. 61
Brucella is a gram-negative bacterium that causes brucellosis, a worldwide zoonosis 62
that affects domestic mammals. Different Brucella species vary in their host preference. 63
Brucella abortus, Brucella suis and Brucella melitensis infect cattle, pigs and goats, 64
respectively, but also infect humans. In animals, the symptoms of the disease are 65
sterility in males and abortion in pregnant females (6). In humans, brucellosis causes 66
undulant fever during the acute phase, and if it reaches chronicity can lead to 67
endocarditis, osteoarthritis and neurological damage. 68
Brucella is an intracellular parasite that persists and replicates within host macrophages. 69
After internalization, the bacterium actively controls the maturation of the so-called 70
Brucella-containing vacuole (BCV) by modulating the formation of transient 71
interactions with ER-derived membranes and late endosomes/lysosomes (26). Such 72
events are crucial for establishing the intracellular replication niche and determine the 73
intracellular fate of the bacterium. The T4SS of Brucella, which is coded by the virB 74
operon, plays a central role in this process, since virB mutants fail to reach the 75
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
4
intracellular replication compartment and are completely degraded by lysosomes (5, 15, 76
24). 77
The virB operon of B. suis is induced after internalization in macrophage-cell lines (1). 78
In B. abortus it was observed that transcription of the virB operon reaches the maximum 79
activity at 5 hours post infection. Subsequently, virB expression is rapidly repressed 80
before intracellular bacterial replication starts (23). This tightly controlled pattern of 81
expression suggests the existence of regulatory pathways that probably act in response 82
to environmental stimuli sensed by the bacterium during its intracellular trafficking. 83
Therefore, the identification of the transcription factors involved in this process may 84
lead to the understanding of the signals that govern the regulation of the VirB T4SS of 85
Brucella within the eukaryotic host cell. 86
The virB promoter (PvirB) of B. abortus comprises 430 base pairs (bp) that participate in 87
the intracellular activity of the system (23). The histone-like integration host factor 88
(IHF) binds to PvirB and induces a DNA-bending that is necessary for the intracellular 89
regulation of the virB genes (23) The quorum-sensing related protein VjbR was also 90
shown to interact with PvirB, directly controlling the virB expression in a positive manner 91
(7, 9). In addition, many other regulators affect virB expression (18). However, no direct 92
interactions with PvirB were reported for these factors, indicating that such influences 93
may be indirect. 94
Based on the knowledge of the architecture of PvirB, we designed a strategy to identify 95
additional factors that specifically bind to this promoter. Here we report the 96
identification of HutC, a protein known to regulate expression of the histidine utilization 97
(hut) genes, as a transcription factor that directly controls the activity of PvirB. Using 98
Electrophoresis Mobility Shift Assays (EMSA) and DNase I Footprinting we identified 99
the HutC-binding sites and analyzed the interaction of this regulator with both hut and 100
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
5
virB promoters. Our results show that HutC co-activates virB expression while it 101
represses transcription of the hut genes, both intracellularly and in bacteria incubated 102
under conditions that resemble the intracellular replication niche. These findings 103
demonstrate that transcriptional regulation of the virB operon is linked to the induction 104
of the histidine utilization pathway, probably as a way to synchronize activation of 105
virulence genes with signals that involve internal metabolic variables and external 106
stimuli perceived within the eukaryotic host cell. 107
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
6
MATERIALS AND METHODS 108
Media and culture conditions 109
Brucella strains were grown in triptic soy broth (TSB) or in minimal medium 1 (MM1), 110
which is derived from MM (21). Composition of MM1 is 33 mM KH2PO4, 60.3 mM 111
K2HPO4, 0.1% yeast extract. Urocanic acid (Sigma) or L-histidine (Sigma) was added 112
to a final concentration of 5 mM as indicated. After the addition of the different carbon 113
sources pH was adjusted to 4.5, 5.5 or 7.0 with HCl, and the media were sterilized by 114
filtration through a 0.2-µm filter (Orange Scientific). Bacteria were cultured at 37˚C in a 115
rotary shaker (250 rpm). Media were supplemented with kanamycin (50 µg ml-1) as 116
needed. 117
118
Construction of plasmids: 119
pK18mob-sacB-∆hutC: Two PCRs were carried out using Pfx (Invitrogen), genomic 120
DNA of B. abortus 2308 as template, and primers dCSpeA (5’- 121
GGACTAGTATCATCGCGCCCGCAATGT-3’) and comdCA (5’- 122
CTGCAAGAAGGAGAGTATCGACCAGAATACGCTGATGCAG-3’), or dCSpeB (5’- 123
GGACTAGTCAGGCCTTGCCGATTACTG-3’) and comdCB (5’- 124
TCGATACTCTCCTTCTTGCAGTATCCCGGTGACAGCCATG-3’). Both PCR products, 125
corresponding to two 400-bp flanking regions of hutC, were annealed and used as 126
templates for a PCR performed with primers dCSpeA and dCSpeB. The product was 127
digested with SpeI and cloned into the kanamycin-resistant plasmid pK18mob-sacB 128
(22). 129
pK18mob-PvirB-lacZ: A 5-kb DNA fragment from plasmid pBluescript-PvirB::lacZ (23), 130
which contains the PvirB-lacZ transcriptional fusion, was excised with BamHI and EcoRI 131
and cloned into pK18mob in the same restriction sites. 132
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
7
pK18mob-Phut-lacZ: A 4.5-kb fragment that contains a lacZ promoter-probe cassette 133
was released from plasmid pAB2001 after digestion with SphI. The resulting fragment 134
was cloned into plasmid pK18mob at the same restriction site, generating plasmid 135
pK18mob-lacZ. A PCR performed with Taq (Invitrogen), B. abortus 2308 genomic 136
DNA as template, and primers PhutA (5’-TGAAATGCTGGCTGGATTG-3’) and PhutB 137
(5’-TCGATCAAGCCGAGATTTG-3’) was cloned into pGEM-T Easy (Promega). The 138
resulting plasmid (pGEM-Phut) was digested with EcoRI, releasing a 170-bp fragment 139
that contains the hut promoter sequences. The Phut-containing fragment was cloned into 140
pK18mob-lacZ in the EcoRI site, generating plasmid pK18mob-Phut-lacZ. Clones with 141
the transcriptional fusion Phut-lacZ oriented in the direction of the hutFC operon were 142
identified by PCR using primers PhutA and lacZ6143 (5’-CAGGGTTTTCCCAGTCACG-143
3’), and checked by DNA sequencing with the same primers. 144
pK18mob-sacB-hutC-KI: A PCR was performed using Pfx, genomic DNA of B. abortus 145
2308 as template, and primers dCSpeA and dCSpeB. The PCR product, which contains 146
the wild type hutC gene and two 400 bp flanking regions, was cloned into pGEM-T 147
easy (Promega). A 1.4 kb fragment excised from the resulting plasmid with StuI and 148
HincII was cloned into the SmaI site of pK18mob-sacB. 149
Expression vector pQE-31-hutC: PCR reactions were performed using Pfx, and primers 150
uprHut (5’-CGGGATCCGATGGCTGGCGAAGATTCGA-3’) and downrHut (5’- 151
GGTACCTCAGCCGCGAGATGGCGT-3’). The PCR product were digested with KpnI 152
and BamHI, and cloned into plasmid pQE-31 (Qiagen). 153
154
Construction of strains B. abortus ∆∆∆∆hutC and B. abortus ∆∆∆∆hutC-KI. 155
Plasmid pK18mob-sacB- ∆hutC was transferred to B. abortus 2308 by biparental 156
conjugation. Kanamycinr colonies were selected as single-homologous recombinants. 157
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
8
Selection with sucrose, excision of plasmids and generation of deletion mutants was 158
performed as described (23). PCR analyses of kanamycins colonies were carried out 159
with primers dCSpeA and dCSpeB to identify clones that contain the deletion of hutC. 160
Plasmid pK18mob-sacB-hutC-KI was transferred to B. abortus ∆hutC by biparental 161
conjugation. Kanamycinr colonies were selected as single-homologous recombinants. 162
Selection with sucrose and excision of the plasmid was performed as described (23). 163
PCR analyses of kanamycins colonies were carried out with primers dCSpeA and 164
dCSpeB. Colonies that generated the wild type pattern were selected as hutC knock in 165
strains. 166
167
Construction of strains containing single chromosomal transcriptional fusions. 168
Plasmids pK18mob-PvirB-lacZ or pK18mob-Phut-lacZ was transferred by biparental 169
conjugation into strains B. abortus 2308, B. abortus ∆hutC or B. abortus ∆hutC-KI. 170
Kanamycinr colonies were selected as single-homologous recombinants. 171
172
Electrophoresis Mobility Shift Assay (EMSA) and DNase I Footprinting 173
Construction of probes PvirB and PvirB-ihf for EMSA, running conditions and 174
determination of apparent dissociation constants were performed as described 175
previously (23). Probe Phut was constructed using primers PhutA and PhutB. Control 176
probe, which contains sequences corresponding to 226 bp of virB10 of B. abortus 2308, 177
was constructed with primers B10Qu (5’-CTATGCAACCCAGAAGGTCGG-3’) and 178
B10d2 (5’- GGGAATTCGTCAGGCACAATAAAGTCAC-3’). The unlabelled competitors 179
b1 and c2 were constructed by PCR using primers pvirdown I and pvu229 or primers 180
pvirdown I and pvu300, respectively (23). Binding reactions were performed in binding 181
buffer [15 mM Tris-HCl (pH 8.0), 0.5 mM EDTA, 10 µg ml-1 bovine serum albumin 182
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
9
(BSA), 1 mM DTT, 30 mM KCl, 6% glycerol] containing 50 µg ml-1 salmon sperm 183
DNA for isolation of HutC, or 25 µg ml-1 poly(dI·dC) (Amersham) for Kd 184
determinations and IHF-HutC competition experiments. 185
Probes PvirB and Phut for DNase I Footprinting were constructed using primer pvu144 186
and a 32P-labeled primer pvirdownI, or primer PhutA and a 32P-labeled primer PhutB, 187
respectively. Labelling reactions, purification of probes, binding reactions, DNase I 188
digestion, purification of fragments, and electrophoresis conditions were performed as 189
described previously (23). 190
191
Isolation and identification of HutC 192
The isolation of the PvirB-binding protein was performed as described previously (23) 193
with the following modifications: To diminish the risk of working with the virulent-wild 194
type strain, the protein detected by EMSA in B. abortus 2308 was isolated from cultures 195
of the avirulent strain B. abortus ∆pgm (27) harvested in exponential phase (DO600 = 196
0.5). After disruption of bacteria, ultracentrifugation, filtration and ammonium sulphate 197
precipitation the protein fractions were analyzed by EMSA using probe PvirB-ihf or the 198
control probe. The positive fraction (25-45% ammonium sulphate saturation) was 199
suspended in 35 mM phosphate buffer (pH 6.8), 3 mM β-mercaptoethanol and dialyzed 200
against the same buffer O.N. at 4°C. The solution was loaded onto a Mono-S column 201
and eluted with a linear gradient of 35 mM phosphate buffer (pH 6.8), 3 mM β-202
mercaptoethanol, 1M NaCl. DNA-binding activity of the fractions was analyzed by 203
EMSA using the probes described above. Positive fractions were subjected to affinity 204
chromatography: the biotinylated probe biot- PvirB-ihf, which corresponds to the -201 to 205
+24 region of PvirB lacking the IHF-binding site, was constructed by PCR using the 5´-206
biotinylated primer pvirdown I, the primer pvu229 and plasmid pBluescript-PvirB-IHF-207
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
10
sacB/R (23) as template. The biotinylated control probe was constructed by PCR using 208
the 5´-biotinylated primer ADP-Biot (5’-GCGATGGGCAGAGCGCCGG-3’), primer 209
PE2P3 (5’- GGATCCGGTGCTCGACGCCAA-3’)and genomic DNA of Mesorhizobium 210
loti as template. The biotinylated probes were bound to streptavidin paramagnetic 211
spheres (Promega) and a binding reaction was performed using binding buffer and the 212
positive fractions of the Mono-S column. After two washes with binding buffer with 0.2 213
M NaCl, the DNA-bound proteins were eluted with 0.85 M NaCl and analyzed by 214
12.5% SDS-PAGE. After Coomassie blue staining, six bands were observed in sample 215
obtained with the biotinylated probe biot- PvirB-ihf, whereas one of them was absent in 216
the sample obtained with the control probe. The differential band was excised form the 217
gel and analyzed by mass spectrometry in Vital probes Inc. (PA, USA). 218
219
Expression and purification of recombinant proteins 220
Recombinant IHF was prepared as described previously (23). Recombinant HutC 221
(rHutC) was prepared as follows. Plasmid pQE-31-hutC was transferred into E. coli 222
M15 (pREP4) (Qiagen) and induced with IPTG. Bacteria were harvested, suspended in 223
lysis buffer [20 mM Tris-HCl (pH 7.6), 1 mM PMSF] and disrupted by sonication. 224
After centrifugation NaCl was added to a final concentration of 0.5 M and the sample 225
was loaded into a Hi-Trap Nickel-chelating column (Amersham Biosciences). After 226
washing with buffer B [20 mM Tris-HCl (pH 7.6), 0.5 M NaCl, 100 mM imidazole] the 227
column was equilibrated with buffer A [20 mM Tris-HCl (pH 7.6), 0.5 M NaCl] and 228
eluted with a linear gradient of buffer C [20 mM Tris-HCl (pH 7.6), 0.5 M NaCl, 100 229
mM EDTA]. Eluates were analyzed in a 12.5% SDS-PAGE, and the fractions 230
containing rHutC (purity near to 95%) were pooled and dialized against buffer D [20 231
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
11
mM Tris-HCl (pH 7.6), 0.5 M NaCl, 3 mM β-mercaptoethanol]. The sample was stored 232
at -20°C with sucrose 0.5%. 233
234
ββββ-galactosidase activity determinations 235
For cultured bacteria, measurement of β-Gal activity was carried out with whole cells as 236
described (23). β-Gal activity was expressed as Miller Units [A420 / volume × OD600] 237
×100. Infection of macrophage-like J774 cells and measurement of intracellular β-Gal 238
activity with 4-methylumbelliferyl-β-D-galactoside was performed as described 239
previously (23). Intracellular β-Gal activity was expressed as relative units (R.U.): 240
{(fluorescence/fluorescence of 200 nM 4-methylumbelliferone)/[(CFU/ml)×dil.]} ×106. 241
242
Western blot experiments 243
Bacteria grown during 24 h in rich medium (TSB) were centrifuged, washed with PBS, 244
and suspended in different media as indicated. After culturing in each medium for 4 h, 245
bacteria were suspended in SDS-loading gel buffer at a concentration of 5 × 1010 246
CFU/ml and incubated at 100°C for 5 min. 10 µl of each bacterial cell lysate were 247
subjected to electrophoresis in a 12.5 % SDS-polyacrylamide gel and transferred to a 248
nitrocellulose membrane (Amersham Biosciences). Proteins were detected using a 249
mouse polyclonal antiserum against recombinant B. abortus HutC (dilution 1:1,000), a 250
secondary peroxidase-conjugated anti-mouse immunoglobulins antibody (dilution 251
1:10,000) (DakoCytomation) and developed by with SuperSignal West Pico 252
Chemiluminescent Substrate (Pierce). 253
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
12
RESULTS 254
Identification and characterization of HutC as a virB promoter-binding protein 255
To identify proteins that bind to PvirB, we performed electrophoresis mobility shift 256
assays (EMSA) using crude-protein extracts of B. abortus and probe PvirB ihf (Fig. 1A), 257
which spans positions -201 to +24 relative to the transcription start site and lacks the 258
ability to bind IHF due to a replacement of the IHF-binding site by a non-related 259
sequence. Using this procedure, we detected a protein that binds to PvirB in a specific 260
manner (data not shown). The DNA-binding protein was subsequently isolated from B. 261
abortus extracts using EMSA, ionic-exchange columns and affinity chromatography 262
(see Materials and methods). The 27.5 kDa isolated protein was identified by mass 263
spectrometry as HutC (accession no. YP_418519), a transcriptional regulator of the hut 264
(for histidine utilization) genes, which confer the ability to use histidine as carbon and 265
nitrogen source to many bacterial species (25). In Brucella, the hut genes are organized 266
as two divergent transcriptional units that code for the regulator HutC and for enzymes 267
that catalyze degradation of histidine to glutamate and formate in five steps. 268
To analyze the interaction of HutC with PvirB, we performed EMSA analyses using 269
specific or non-specific probes (schematized in Fig. 1A) and a His-tagged recombinant 270
protein (rHutC). Binding of rHutC to PvirB produced a complex observed by EMSA, 271
whereas incubation with a control probe did not generate any signal, thus indicating that 272
binding of HutC to PvirB is specific (Fig. 1B). To further characterize the region 273
recognized by HutC within the promoter, EMSA experiments were performed using 274
two unlabelled DNA fragments as competitors (Fig. 1A). As shown in Fig. 1C, the 275
formation of the rHutC-PvirB complex was impaired by competitor b1 (which spans the 276
region -201 to +24) whereas competitor c2 had no effect. These results indicate that 277
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
13
HutC binds to PvirB in a region that is localized between positions -201 and -130, which 278
contains the IHF-binding site. 279
Taking into account that both IHF and HutC bind to the same 71 bp-region, we 280
examined if these proteins affect the binding of each other to the promoter. As shown in 281
Fig. 1D, EMSA experiments performed by co-incubating probe PvirB with both proteins 282
did not generate any ternary complex, indicating that IHF and HutC do not bind to PvirB 283
simultaneously. Moreover, binding of IHF was titrated by increasing concentrations of 284
HutC, which indicates that both factors compete for the binding to the promoter. 285
286
Analysis of interaction of HutC with the virB and hut promoters 287
Binding affinity of HutC to the promoters was studied by determining apparent 288
dissociation constants (Kd). EMSA experiments were carried out by incubating HutC 289
with probe PvirB or with a 220-bp radiolabelled probe corresponding to the hut promoter 290
(Phut). Kd were determined graphically from the intensity of the bands corresponding to 291
rHutC-PvirB or rHutC-Phut complexes. As shown in Fig. 2, Kd of rHutC-PvirB and rHutC-292
Phut were 24 nM and 0.75 nM, respectively. Thus, HutC had 30-fold more affinity for its 293
own promoter than for PvirB, which could be mechanistically relevant for the regulatory 294
link exerted by HutC upon Hut and VirB systems. 295
The regulation of hut genes has been extensively studied in different organisms. cis-296
urocanic acid (UCA), the first intermediate of the hut pathway, is an inducer that 297
interacts with HutC causing a conformational change that dissociates the repressor from 298
the promoter sequences (12). After dissociation, transcription of the hut genes is de-299
repressed, thus allowing synthesis of the Hut enzymes. In Klebsiella and Pseudomonas, 300
dissociation of the regulator also induces transcription of HutC itself (11, 30). To 301
analyze the effect of UCA on the DNA-binding activity of HutC, EMSA experiments 302
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
14
were carried out with rHutC and probe PvirB or Phut in the presence of the inducer. Fig.3 303
shows that higher concentrations of UCA were required for dissociating HutC from Phut 304
(50 µM) rather from PvirB (5 µM), which was consistent with the observed differences in 305
Kd. On the other hand, the addition of UCA did not have any effect on the binding of 306
IHF to the promoter, indicating that the susceptibility to the inducer is specific for HutC 307
(Fig. 3A). 308
To identify the DNA-binding sites of HutC, DNase I Footprinting experiments were 309
carried out with probes corresponding to those used for EMSA. Fig. 4A shows that in 310
Phut, HutC protected a 20 bp region that contains the 12 bp-dyad symmetric sequence 311
ATGTATATACAT (Fig 4C), which is entirely conserved in all hut promoters of the 312
closely-related genera Agrobacterium, Ochrobactrum and Rhizobium (see Fig. 4E). In 313
PvirB, however, HutC protected a 20 bp-region that contains 8 out of 12 nucleotides of 314
the conserved symmetric dyad sequence found in Phut (Fig. 4B). These differences may 315
explain why HutC had 30-fold more affinity for the binding to Phut than to PvirB. It is 316
worth to point out that the sequence recognized by HutC in PvirB is more similar to the 317
known hut operators of Klebsiella or Pseudomonas (16, 30), rather than to the HutC-318
binding site of Phut in Brucella (Fig. 4E). It can also be observed that the HutC-protected 319
region of PvirB is centered at position -188 (Fig. 4D), which is 25 bp upstream of the 320
IHF-binding site and overlaps the IHF-protected region in DNase I Footprinting 321
experiments (23), supporting the idea that the observed competition between IHF and 322
HutC was due to steric hindrance. 323
324
HutC modulates the expression of the virB operon both intracellularly and during 325
bacterial incubation in vitro 326
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
15
The intracellular expression of the virB operon was analyzed by measuring β-Gal 327
activity of transcriptional fusions between PvirB and lacZ gene. To this end, single PvirB-328
lacZ transcriptional fusion constructs (Fig. 5A) were integrated in the chromosome of 329
the wild type strain, a hutC deletion mutant, or a complemented knock-in control strain, 330
generating strains B. abortus 2308 PvirB-lacZ, B. abortus ∆hutC PvirB-lacZ, and B. 331
abortus ∆hutC-KI PvirB-lacZ. In addition, we also analyzed β-Gal activity of 332
transcriptional fusions between the hut promoter and lacZ (Fig. 5B) in the same genetic 333
backgrounds. 334
To analyze the role of HutC on virB expression within the host cell, we infected J774 335
macrophages and determined β-Gal activity of intracellular bacteria. Fig. 5C shows that, 336
whereas both wild type and control strains displayed maximal activation of virB 337
expression at 5 h p.i., the deletion mutant strain B. abortus ∆hutC PvirB-lacZ showed a 338
60% reduction of β-Gal activity. These results indicated that during the intracellular 339
infection of J774 macrophages HutC functions as co-activator of virB expression, which 340
is a role that was not previously reported for this transcriptional regulator. The analysis 341
of intracellular activity of the hut promoter showed that, as expected, HutC is a 342
repressor of hut expression (Fig. 5D). These results demonstrate that HutC participates 343
directly on the intracellular transcriptional regulation of the virB operon, and revealed 344
that this transcription factor exerts different roles (as repressor or as co-activator) 345
depending on the target promoter. 346
Using gentamicin protection assays we observed that deletion of hutC did not affect the 347
intracellular multiplication of B. abortus in J774 cells (Fig. 6A). Thus, although 348
intracellular activation of virB expression was reduced in the ∆hutC mutant, the reached 349
level of virB expression (40%) was enough for Brucella to overcome the cellular 350
defences in this experimental model of infection. However, CFU recovered from 351
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
16
spleens of mice infected with B. abortus ∆hutC were reduced by 0.8 log units (Fig. 6B). 352
As deletion of hutC turns the hut systems into a constitutively active state, expression of 353
the Hut enzymes is not abrogated in this mutant, suggesting that the observed reduction 354
of persistence in mice was likely due to the defect in the intracellular expression of the 355
virB genes. 356
As HutC was involved in the control of the intracellular expression of the virB operon, 357
we attempted to reproduce in vitro the conditions encountered by Brucella within the 358
host cell to examine the role of this regulator in cultured bacteria. Previous studies 359
carried out with B. suis suggested that the intracellular environment within the BCV is 360
acidic and nutrient-poor (1, 13). Accordingly, a minimal medium without magnesium, 361
carbon and nitrogen sources was prepared (medium MM1), pH was adjusted to 4.5, and 362
PvirB activity was examined in the different strains. Fig. 5E shows that, compared to both 363
wild type and control strains, virB expression dropped 90% in the ∆hutC mutant after 4 364
h of incubation in MM1 at pH 4.5 in the presence of 5 mM UCA in the culture medium, 365
indicating that HutC is acting as co-activator of PvirB under these in vitro conditions. It is 366
remarkable that no differences of PvirB activity were observed between strains when pH 367
was adjusted to 5.5 or when UCA was absent (data not shown), indicating that both 368
acidification and Hut induction are required for the observed HutC-dependent virB 369
expression. 370
Analysis of activity of Phut in cultured bacteria showed that hut expression was 371
repressed in the wild type strain, and de-repressed in the ∆hutC mutant (Fig. 5F), which 372
is in agreement with the results obtained with intracellular bacteria (Fig. 5C-D). The 373
fact that HutC is repressing Phut in the wild type strain indicates that under such 374
conditions the regulator is bound to the operator site. Thus, the cytoplasmic 375
concentration of UCA within Brucella might be low enough to allow the interaction of 376
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
17
HutC with its DNA-binding sites, even in the presence of 5 mM extracellular UCA. 377
This can be explained if, after hut induction, the Hut enzymes metabolize UCA as it is 378
incorporated, which is feasible, given that UCA is a metabolizable inducer. Therefore, 379
to determine whether the Hut system was induced in such conditions, cultured bacteria 380
were analyzed using an anti-HutC antiserum. Western blot analyses of bacteria 381
incubated in MM1 at pH 4.5 revealed that the levels of HutC are higher in the presence 382
of the inducer (Fig. 7), which indicates that the Hut system is induced in response to 383
UCA. The analysis of OD600 during 48 h of incubation in MM1 at pH 4.5 indicated that 384
growth of Brucella was arrested under these conditions, regardless of the addition of 385
UCA or histidine (data not shown). However, by increasing the pH value to 5.5, we 386
observed that Brucella was able to grow using UCA but not histidine (Fig. 8), which is 387
in agreement with previous studies that revealed that many strains of Brucella 388
incorporate and metabolize UCA as efficiently as mesoerythritol, xylose or ribose (2, 389
10). 390
Taken together, these results demonstrate that the Hut and VirB systems are interrelated 391
by means of a regulatory mechanism that involves induction of a catabolic pathway and 392
the action of HutC upon two different promoters. 393
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
18
DISCUSSION 394
The aim of this study was to identify signals and transcription factors directly involved 395
in the control of expression of the virB genes. Using EMSA, affinity purification assays, 396
and mass spectrometry, we isolated and identified a protein that binds to PvirB in a 397
specific manner. This protein is homologous to HutC, a well-studied transcriptional 398
regulator of the hut operons. This finding prompted us to hypothesize that the 399
interaction of HutC with the virB promoter could represent a link that coordinates 400
regulation of the virB genes of Brucella with induction of the histidine utilization 401
pathway. 402
Our results showed that in Brucella, HutC modulates expression of the virB operon both 403
within the eukaryotic host cell and in bacteria incubated under conditions that resemble 404
the cellular intraphagosomal environment (Fig. 5). The analyses revealed that instead of 405
repressing transcription, as it occurs in all known hut promoters, HutC co-activates 406
transcription of the virB genes under both conditions tested. Control experiments carried 407
out using the same experimental methods corroborated that HutC is indeed repressing 408
the hut promoter while it is co-activating PvirB (Fig. 5), which demonstrated that HutC 409
performs opposite functions depending on the target promoter. 410
Until now, the regulatory mechanism reported for HutC was based on steric hindrance 411
of RNA polymerase (RNApol) holoenzyme access to the hut promoters (12). In the case 412
of PvirB, the fact that the HutC-binding site is localized at position -188 accounts for the 413
different role that HutC exerts on this system. Interestingly, among the list of repressors 414
that were also found to activate transcription (e.g.: CytR, LuxR, Lrp) (17, 19, 28), Fur 415
represses promoters by occluding RNApol access while it activates other promoters 416
through binding to regions far upstream of the transcription start site (8). This latter 417
example highlights similarities with the Brucella HutC that deserve to be further 418
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
19
analyzed. Although the mechanism of HutC-mediated co-activation remains to be 419
determined, it can be speculated that it operates through the modulation of a 420
downstream-acting primary activator (e.g.: VjbR), probably by means of a mechanism 421
such as repositioning (3). Alternatively, HutC may act on PvirB by interfering with the 422
activity of negative regulators. 423
β-gal activity assays of bacteria incubated in vitro revealed that PvirB was co-activated 424
by HutC only under specific conditions that required pH 4.5 and a nutrient-deprived 425
medium (Fig. 5E), which are conditions similar to that encountered by Brucella within 426
the host cell (1, 13). In addition, the HutC-mediated regulation of PvirB required the 427
presence of UCA in the culture medium. Western blot experiments and analyses of 428
OD600 of bacterial cultures revealed that Brucella induces the Hut system in response to 429
UCA, and it is able to grow using this compound as a sole carbon source but not 430
histidine (Fig. 8). Taken together, these findings indicate that Brucella is specially 431
adapted to utilize this metabolite, which is in agreement with previous reports that 432
showed that Brucella efficiently incorporates and metabolizes UCA (2, 10). This raises 433
an intriguing question: does Brucella incorporate and metabolize UCA during its life 434
cycle within the host? It is known that UCA is present at high concentrations in 435
mammalian skin and skin secretions, where it acts as ultraviolet photoprotector or as 436
immunosuppresor (14). Nevertheless, to our knowledge, the published literature does 437
not provide information about the concentration of this compound in tissues other than 438
skin. Therefore, we cannot rule out the possibility that Brucella incorporates and 439
metabolizes UCA at a particular stage of the infection, which could provide a signal for 440
the bacterium to enhance virB expression when it is needed to overcome host defences. 441
The analyses of the interaction of HutC with both virB and hut promoters showed that 442
there is a hierarchical order of Kd values, which may have a mechanistic significance for 443
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
20
the regulation of both systems (Fig. 2). HutC binds to PvirB with lower affinity (apparent 444
Kd = 24 nM). As affinity for Phut is 30-fold higher (apparent Kd = 0.75 nM), basal levels 445
of HutC might be sufficient for repressing the hut genes without affecting virB 446
expression. Only after induction by UCA the levels of HutC increase reaching the 447
required concentration for the binding to PvirB, as it was confirmed by western blot (Fig. 448
7). The different susceptibilities to UCA observed for the hut and virB promoters may 449
also be part of a mechanism by which, as the inducer is catabolized, HutC is enabled to 450
interact sequentially with the operator sequences. If the intracellular concentration of 451
UCA drops below 50 µM, then HutC is able to interact with Phut and repress hut 452
transcription (Fig. 3B). In this way, as consumption of UCA proceeds, HutC is 453
subsequently enabled to bind to PvirB and activate virB transcription when the inducer 454
concentration decreases below 5 µM (Fig. 3A). 455
The differences observed in affinity and susceptibility to UCA are likely due to the 456
different architectures observed for the Phut and PvirB HutC-binding sites (Fig. 4). It is 457
interesting to note that the sequence of the HutC-binding site of the B. abortus Phut is 458
present in all hut promoters of other closely-related α-proteobacteria (Fig. 4E), which 459
indicates that the ancestral sequence recognized by HutC is fully conserved among this 460
taxonomic group. Instead, the sequence recognized in PvirB resembles more the HutC-461
binding site of Klebsiella or Pseudomonas rather than that of α-proteobacterial hut 462
promoters (see Fig. 4E). This observation could evidence an evolutionary trace of the 463
acquisition of the virB operon and its regulatory sequences, which may have occurred 464
during a horizontal transfer event in the common ancestor of Brucella (29). It is worth 465
to mention that both HutC-binding motifs found in PvirB and Phut are unique in the 466
genome of B. abortus. However, we identified additional sequences that bind HutC with 467
high affinity, which are currently being investigated (R. Sieira, unpublished results). 468
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
21
Such sequences are located within intergenic regions, upstream of open reading frames 469
unrelated to the recently discovered T4SS substrates of Brucella VceA and VceC. 470
EMSA experiments showed that HutC competes with IHF for the binding to PvirB (Fig. 471
1D). In our previous work, we found that during vegetative growth the virB expression 472
is IHF-dependent at pH 7.0 but not at pH 4.5 (23). Here, the opposite situation was 473
observed for HutC, since virB expression is HutC-dependent at pH 4.5, but not at pH 474
5.5 or 7.6 (data not shown). Based on these observations, we hypothyesize that a 475
sequential participation of IHF and HutC may be required for the proper induction of 476
virB expression. IHF probably acts by supporting a promoter structure necessary for 477
recruiting transcription factors. As BCV maturation proceeds, induction of the hut 478
system under acidic conditions may displace IHF from its binding-site, co-activating 479
expression of the virB operon in a HutC-dependent manner. In this way, induction of 480
the Hut catabolic pathway probably functions in Brucella as a way to sense homeostatic 481
variations and develop adaptive responses to ensure their survival within the host. 482
Our results showed that in Brucella, a catabolic pathway is directly linked to the 483
regulation of expression of a T4SS. Another example of interrelation between histidine 484
utilization an transcription of virulence genes was evidenced by mutations that alter 485
expression of Hut enzymes in Pseudomonas aeruginosa, which result in a decreased 486
transcription of Type-III Secretion System (T3SS) effectors and a consequent reduction 487
of cytotoxicity of the bacterium (20). Many pathogenic bacteria have acquired genes 488
coding for virulence factors through horizontal transfer, which implies that such foreign 489
genetic information had been integrated into pre-existing regulatory networks of the 490
new context. Acquisition of a functional HutC-binding site within PvirB during the 491
evolution of Brucella may eventually have resulted in a cooptation of a negative 492
regulatory protein to perform a new role; co-activating transcription of virulence genes 493
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
22
by means of a mechanism that involves the integration of acidic and metabolic stress 494
signals. 495
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
23
ACKNOWLEDGEMENTS 496
We thank Jeanette E. Polcz, María Georgina Davies and Dr. Juan E. Ugalde for critical 497
reading of the manuscript. We also thank Joseph Connolly for help with mass 498
spectrometry. This work was supported by grants PICT05-38207 to R.S., PICT05-499
38272 to D.J.C., and PICT06-651 to R.A.U. from Agencia Nacional de Promoción 500
Científica y Tecnológica, Buenos Aires, Argentina. 501
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
24
REFERENCES 502
1. Boschiroli, M. L., S. Ouahrani-Bettache, V. Foulongne, S. Michaux-503
Charachon, G. Bourg, A. Allardet-Servent, C. Cazevieille, J. P. Liautard, 504 M. Ramuz, and D. O'Callaghan. 2002. The Brucella suis virB operon is 505 induced intracellularly in macrophages. Proc Natl Acad Sci U S A 99:1544-9. 506
2. Broughton, E. S., and K. L. Jahans. 1997. The differentiation of Brucella 507 species by substrate specific tetrazolium reduction. Vet Microbiol 57:253-71. 508
3. Browning, D. F., and S. J. Busby. 2004. The regulation of bacterial 509 transcription initiation. Nat Rev Microbiol 2:57-65. 510
4. Cascales, E., and P. J. Christie. 2003. The versatile bacterial type IV secretion 511 systems. Nat Rev Microbiol 1:137-49. 512
5. Comerci, D. J., M. J. Martinez-Lorenzo, R. Sieira, J. P. Gorvel, and R. A. 513 Ugalde. 2001. Essential role of the VirB machinery in the maturation of the 514 Brucella abortus-containing vacuole. Cell Microbiol 3:159-68. 515
6. Corbel, M. J. 1997. Brucellosis: an overview. Emerg Infect Dis 3:213-21. 516 7. de Jong, M. F., Y. H. Sun, A. B. den Hartigh, J. M. van Dijl, and R. M. 517
Tsolis. 2008. Identification of VceA and VceC, two members of the VjbR 518 regulon that are translocated into macrophages by the Brucella type IV secretion 519 system. Mol Microbiol 70:1378-96. 520
8. Delany, I., R. Rappuoli, and V. Scarlato. 2004. Fur functions as an activator 521 and as a repressor of putative virulence genes in Neisseria meningitidis. Mol 522 Microbiol 52:1081-90. 523
9. Delrue, R. M., C. Deschamps, S. Leonard, C. Nijskens, I. Danese, J. M. 524 Schaus, S. Bonnot, J. Ferooz, A. Tibor, X. De Bolle, and J. J. Letesson. 2005. 525 A quorum-sensing regulator controls expression of both the type IV secretion 526 system and the flagellar apparatus of Brucella melitensis. Cell Microbiol 527 7:1151-61. 528
10. Dorrell, N., P. Guigue-Talet, S. Spencer, V. Foulonge, D. O'Callaghan, and 529 B. W. Wren. 1999. Investigation into the role of the response regulator NtrC in 530 the metabolism and virulence of Brucella suis. Microb Pathog 27:1-11. 531
11. Goldberg, R. B., and B. Magasanik. 1975. Gene order of the histidine 532 utilization (hut) operons in Klebsiella aerogenes. J Bacteriol 122:1025-31. 533
12. Hu, L., S. L. Allison, and A. T. Phillips. 1989. Identification of multiple 534 repressor recognition sites in the hut system of Pseudomonas putida. J Bacteriol 535 171:4189-95. 536
13. Kohler, S., V. Foulongne, S. Ouahrani-Bettache, G. Bourg, J. Teyssier, M. 537 Ramuz, and J. P. Liautard. 2002. The analysis of the intramacrophagic 538 virulome of Brucella suis deciphers the environment encountered by the 539 pathogen inside the macrophage host cell. Proc Natl Acad Sci U S A 99:15711-540 6. 541
14. Norval, M., P. McLoone, A. Lesiak, and J. Narbutt. 2008. The effect of 542 chronic ultraviolet radiation on the human immune system. Photochem 543 Photobiol 84:19-28. 544
15. O'Callaghan, D., C. Cazevieille, A. Allardet-Servent, M. L. Boschiroli, G. 545 Bourg, V. Foulongne, P. Frutos, Y. Kulakov, and M. Ramuz. 1999. A 546 homologue of the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl 547 type IV secretion systems is essential for intracellular survival of Brucella suis. 548 Mol Microbiol 33:1210-20. 549
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
25
16. Osuna, R., A. Schwacha, and R. A. Bender. 1994. Identification of the hutUH 550 operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. J 551 Bacteriol 176:5525-9. 552
17. Pompeani, A. J., J. J. Irgon, M. F. Berger, M. L. Bulyk, N. S. Wingreen, and 553 B. L. Bassler. 2008. The Vibrio harveyi master quorum-sensing regulator, 554 LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition 555 and binding specificity at target promoters. Mol Microbiol 70:76-88. 556
18. Rambow-Larsen, A. A., E. M. Petersen, C. R. Gourley, and G. A. Splitter. 557 2009. Brucella regulators: self-control in a hostile environment. Trends 558 Microbiol. 559
19. Rasmussen, P. B., B. Holst, and P. Valentin-Hansen. 1996. Dual-function 560 regulators: the cAMP receptor protein and the CytR regulator can act either to 561 repress or to activate transcription depending on the context. Proc Natl Acad Sci 562 U S A 93:10151-5. 563
20. Rietsch, A., M. C. Wolfgang, and J. J. Mekalanos. 2004. Effect of metabolic 564 imbalance on expression of type III secretion genes in Pseudomonas aeruginosa. 565 Infect Immun 72:1383-90. 566
21. Rouot, B., M. T. Alvarez-Martinez, C. Marius, P. Menanteau, L. 567
Guilloteau, R. A. Boigegrain, R. Zumbihl, D. O'Callaghan, N. Domke, and 568 C. Baron. 2003. Production of the type IV secretion system differs among 569 Brucella species as revealed with VirB5- and VirB8-specific antisera. Infect 570 Immun 71:1075-82. 571
22. Schafer, A., A. Tauch, W. Jager, J. Kalinowski, G. Thierbach, and A. 572 Puhler. 1994. Small mobilizable multi-purpose cloning vectors derived from the 573 Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the 574 chromosome of Corynebacterium glutamicum. Gene 145:69-73. 575
23. Sieira, R., D. J. Comerci, L. I. Pietrasanta, and R. A. Ugalde. 2004. 576 Integration host factor is involved in transcriptional regulation of the Brucella 577 abortus virB operon. Mol Microbiol 54:808-22. 578
24. Sieira, R., D. J. Comerci, D. O. Sanchez, and R. A. Ugalde. 2000. A 579 homologue of an operon required for DNA transfer in Agrobacterium is required 580 in Brucella abortus for virulence and intracellular multiplication. J Bacteriol 581 182:4849-55. 582
25. Smith, G. R., and B. Magasanik. 1971. Nature and self-regulated synthesis of 583 the repressor of the hut operons in Salmonella typhimurium. Proc Natl Acad Sci 584 U S A 68:1493-7. 585
26. Starr, T., T. W. Ng, T. D. Wehrly, L. A. Knodler, and J. Celli. 2008. 586 Brucella intracellular replication requires trafficking through the late 587 endosomal/lysosomal compartment. Traffic 9:678-94. 588
27. Ugalde, J. E., C. Czibener, M. F. Feldman, and R. A. Ugalde. 2000. 589 Identification and characterization of the Brucella abortus phosphoglucomutase 590 gene: role of lipopolysaccharide in virulence and intracellular multiplication. 591 Infect Immun 68:5716-23. 592
28. van der Woude, M. W., L. S. Kaltenbach, and D. A. Low. 1995. Leucine-593 responsive regulatory protein plays dual roles as both an activator and a 594 repressor of the Escherichia coli pap fimbrial operon. Mol Microbiol 17:303-12. 595
29. Wattam, A. R., K. P. Williams, E. E. Snyder, N. F. Almeida, Jr., M. Shukla, 596
A. W. Dickerman, O. R. Crasta, R. Kenyon, J. Lu, J. M. Shallom, H. Yoo, 597 T. A. Ficht, R. M. Tsolis, C. Munk, R. Tapia, C. S. Han, J. C. Detter, D. 598 Bruce, T. S. Brettin, B. W. Sobral, S. M. Boyle, and J. C. Setubal. 2009. 599
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
26
Analysis of ten Brucella genomes reveals evidence for horizontal gene transfer 600 despite a preferred intracellular lifestyle. J Bacteriol 191:3569-79. 601
30. Zhang, X. X., and P. B. Rainey. 2007. Genetic analysis of the histidine 602 utilization (hut) genes in Pseudomonas fluorescens SBW25. Genetics 176:2165-603 76. 604
605
606
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
27
FIGURE LEGENDS 607
Figure 1: Analysis of binding of rHutC to PvirB. A. Schematic representation of genomic 608
sequences corresponding to PvirB (grey bar) and the first gene of the virB operon (virB1) 609
(stripped bar); radioactive-labelled probes used for EMSA (black bars); and unlabelled 610
competitors (white bars). White box: IHF-binding site. B. Specificity of binding of 611
rHutC to PvirB. EMSA performed with rHutC and a control probe or probe PvirB. C. 612
Competition assay. EMSA performed with probe PvirB, unlabelled competitors and 613
rHutC. The mass of unlabelled competitors added to each reaction was as follows: lanes 614
1 and 2, no competitor; lanes 3 and 5, 150 ng; lanes 4 and 6, 300 ng. Mass of rHutC: 615
lane1, no rHutC; lanes 2-6: 33 ng. D. Co-incubation of rHutC and rIHF with PvirB. 616
EMSA performed with probe PvirB, rIHF and/or rHutC at the indicated concentrations. 617
618
Figure 2: Analysis of binding affinity of HutC to PvirB or Phut. A. EMSA performed with 619
probe PvirB and increasing concentrations of rHutC. B. Determination of the apparent 620
dissociation constant of rHutC for the binding to PvirB. Intensity of the bands obtained 621
from two independent experiments performed as shown in (A) was measured. The 622
apparent dissociation constant (Kd) was determined graphically from the plot of 623
fractions of free and protein-bound probes. C. EMSA performed with probe Phut and 624
increasing concentrations of rHutC. D. Determination of the apparent dissociation 625
constant of rHutC for binding to Phut. Intensity of the bands obtained from two 626
independent experiments performed as shown in (C) was measured and the apparent 627
dissociation constant (Kd) was determined as in (B). 628
629
Figure 3: Effect of UCA on DNA-binding activity of HutC. A. EMSA performed with 630
rIHF or rHutC incubated with probe PvirB and increasing concentrations of UCA as 631
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
28
indicated. Concentration of rIHF: 70 nM; Concentration of rHutC: 25 nM. B. EMSA 632
performed with rHutC incubated with probe Phut and increasing concentrations of UCA 633
as indicated. Concentration of rHutC: 0.55 nM. 634
635
Figure 4: Identification of the HutC-binding sites. A. DNase I Footprinting experiment 636
carried out with probe Phut and increasing concentrations of HutC as indicated. Lanes A 637
and G are DNA sequence reactions performed by the Sanger method. The HutC-638
protected region is indicated by an open rectangle. Arrowheads indicate DNase I-639
hypersensitized sites. B. DNase I Footprinting experiment carried out with probe PvirB 640
and increasing concentrations of HutC as indicated. HutC-protected region and 641
hypersensitized sites are indicated as in (A). C. Schematic representation of the HutC-642
protected sequences in Phut. Protected region and DNase I-hypersensitized sites are 643
indicated as in (A). Nucleotides that match the previously described HutC-binding sites 644
of Klebsiella or Pseudomonas are highlighted in grey. D. Schematic representation of 645
the HutC-protected sequences in PvirB. Protected region and DNase I-hypersensitized 646
sites are indicated as in (B). IHF-binding site sequences are indicated as bold italic 647
letters. Nucleotides that match the previously described HutC-binding sites are indicated 648
as in (C). D. Comparison of the 14 pb-sequences located at the center of the HutC-649
protected regions of the B. abortus Phut and PvirB, the HutC-binding sites of the hut 650
operators of Klebsiella and Pseudomonas, and sequences located within the hut 651
promoter regions of different closely-related α-proteobacterial species. Dyad symmetry 652
of sequences is indicated by arrows. 653
654
Figure 5: Role of HutC in control of activity of the virB and hut promoters. Schematic 655
representation of the PvirB-lacZ (A) and Phut-lacZ (B) transcriptional fusion constructs. 656
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
29
C. Intracellular β-Gal activity of strains B. abortus PvirB-lacZ (wt), B. abortus ∆hutC 657
PvirB-lacZ (∆hutC) or B. abortus ∆hutC-KI PvirB-lacZ (KI). Cultures of J774 658
macrophages were infected with strains harbouring lacZ transcriptional fusions. At 5 h 659
p.i., cells were disrupted and β-galactosidase activity of intracellular bacteria was 660
determined. D. Intracellular β-Gal activity of strains B. abortus Phut-lacZ (wt), B. 661
abortus ∆hutC Phut-lacZ (∆hutC) or B. abortus ∆hutC-KI Phut-lacZ (KI). Intracellular β-662
galactosidase activity was determined as in (C). E. β-Gal activity of strains B. abortus 663
PvirB-lacZ (wt), B. abortus ∆hutC PvirB-lacZ (∆hutC) or B. abortus ∆hutC-KI PvirB-lacZ 664
(KI) cultured in MM1 5 mM UCA at pH 4.5. Promoter activity of cultured bacteria was 665
determined as follows: strains were grown in rich medium (TSB) until exponential 666
phase (OD600 0.5-1). Subsequently, bacteria were harvested, suspended in MM1 5 mM 667
UCA, and β-galactosidase activity was determined after 4 h of cultivation. F. β-Gal 668
activity of strains B. abortus Phut-lacZ (wt), B. abortus ∆hutC Phut-lacZ (∆hutC) or B. 669
abortus ∆hutC-KI Phut-lacZ (KI) cultured in MM1 5 mM UCA at pH 4.5. Promoter 670
activity of cultured bacteria was determined as in (C). Values are means ± standard 671
deviations of duplicate wells from a representative of two experiments. *, P < 0.05, **, 672
P < 0.01 (compared to the wild type strain). 673
674
Figure 6: A. Intracellular replication of B. abortus 2308 and the deletion mutant B. 675
abortus ∆hutC in J774 macrophages. 1×105 macrophages per well were inoculated with 676
5×106 CFU of bacteria. After 1 h of incubation at 37°C, cells were washed with PBS, 677
and gentamicin and sterptomycin were added. CFU were determinated at the indicated 678
times. B. abortus 2308 (open circles), B. abortus ∆hutC (solid circles). B. Persistence of 679
B. abortus 2308, the deletion mutant B. abortus ∆hutC, and the knock-in control strain 680
B. abortus ∆hutC-KI in mice. 60-day old female mice were inoculated intraperioteneally 681
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
30
with 1×105 CFU of B. abortus 2308 (open circles), B. abortus ∆hutC (solid circles) or B. 682
abortus ∆hutC-KI (open triangles). After 12 weeks mice were sacrificed and 683
CFU/spleen was determined. Values are means and individual determinations from a 684
representative of two independent experiments. n = 4. *, P < 0.05. 685
686
Figure 7: Western blot analysis. 687
A. B. abortus 2308 (wt), B. abortus ∆hutC (∆hutC), or B. abortus ∆hutC -KI (KI) were 688
grown in TSB until stationary phase of growth. Samples corresponding to equal 689
numbers of bacteria were submitted to 12.5% SDS-PAGE, transferred to nitrocellulose 690
membranes and developed with a mouse anti-HutC polyclonal anti-serum. 691
B. B. abortus 2308 wild type strain was grown in TSB until exponential phase (OD600 = 692
0.5-1). Subsequently, bacteria were harvested, suspended and incubated during 4 h in 693
MM1 at pH 7.0 or 4.5 with or without 5 mM UCA. Samples corresponding to equal 694
numbers of bacteria were analyzed as in (A). 695
696
Figure 8: Growth curve of B. abortus 2308 in MM1 at pH 5.5. 697
Bacteria were grown in TSB until exponential phase (OD600 = 0.5-1). Subsequently, 698
bacteria were harvested, suspended and cultured in MM1 at pH 5.5 supplemented with 5 699
mM UCA (solid circles), 5 mM histidine (solid triangles), or without the addition of any 700
carbon source (open circles). OD600 and CFU/ml were determined at different times as 701
indicated. Values are mean ± standard deviations of duplicate samples from a 702
representative of two independent experiments. 703
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
2
_
+
5
+
6
+
3
+
4
+
1
_
_
b1 c2
+1
-201
-130 +24
Labelled
probes
Unlabelled
competitors
b1
PvirB
c2
virB1
IHF
A B C
rHutC
rHutC
(ng) _ _
Probe
rHutC
CompetitorControl PvirB
free probe
654522654522
free probe
free probe
IHF
rHutC (nM)
IHF (nM)
D25
_
85
40
65
40
45
40
35
40
25
40
_
40
PvirB-ihf-PvirB
rHutC-PvirB
rHutC-PvirB
-PvirB
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
0 0.1
50.2
5
0.75
0.5
21
rHutC
nM0 10
05020
1052
rHutC
nM
0
0,25
0,5
0,75
1
0 1 2 3 4 5
Fra
ction
rHutC (nM)
Kd = 0.75 nM
Fra
ction
0
0,25
0,5
0,75
1
0 20 40 60 80 100
rHutC (nM)
Kd = 24 nM
A B DC
rHutC
freeprobe
rHutC
freeprobe
hut-P-PvirB
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
+ + + + +_
+ + + + + + + + ++ __
rIHF rHutC
UCA (µM) 0 0.05
0.55 50 0 0.
050.
55 50
rHutC
0 0.05
0.55 50
free
probe
rHutC-Phut
rHutC
rIHF
A BUCA (µM)
free
probe
-PvirB
-PvirB
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
E
D
C
caccgcataccacttgtatataagattttgttaaaaaagaattttctaatagaaccaatagtggcgtatggtgaacatatattctaaaacaattttttcttaaaagattatcttggttat
IHFHutC
-188.5
tgtttcacaataatgtatatacatattatggaaacaacaaagtgttattacatatatgtataatacctttgt
HutC
A G _ _10 5020
HutC (nM)
4030 A G _ _5 10 1005020
HutC (nM)A B
Consensus of the HutC-binding site of the Klebsiella and Pseudomonas hut promoters
Consensus of the HutC-binding site of different α-Proteobacteria hut promoters
CTTGTATGTACAAG Pseudomonas fluorescens SBW25
AATGTATATACATA Brucella abortus 2308
CTTGTATAGACAAG Klebsiella aerogenes
CTTGTATATAAGAT Brucella abortus 2308virB
promoter
Agrobacterium tumefaciens C58 Cereon
Mesorhizobium loti MAFF303099
Rhizobium etli CFN42
Ochrobactrum anthropi ATCC49188TATGTATATACATT
TATGTATATACATT
TATGTATATACATG
TATGTATATACATA
hut
promoters
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
C
A B
E F
D
0
100
200
300
400
0
400
800
1200
β-G
al A
ctivity (
R.U
.)
lacZ
PvirB
lacZ
PhutFC
IHUG
**
wt0
∆hutC KI
300
200
100
β-G
al. A
ctivity (
M.U
.)
wt0
∆hutC KI
200
100
β-G
al. A
ctivity (
M.U
.)
*
wt ∆hutC KI wt ∆hutC KI
β-G
al A
ctivity (
R.U
.)
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
3
4
5
Log (
CF
U/s
ple
en)
*
wt ∆hutC KI
6
210
0
106
104
103
102
101
105
CF
U/m
l
10 20 30 40 500
time p.i. (hs.)
A B
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
TSB
wt ∆hutC KI
MM1
7.0 4.5
Strain
pH
UCA_+ +_
A B
HutC HutC
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
time (hs.)
0 10 20 30 40 50
0
0,5
1
1,5
2
2,5
3
108
107
109
109
CF
U/m
lO
D600/O
D600(t
=0)
on June 20, 2019 by guesthttp://jb.asm
.org/D
ownloaded from