Post on 22-Aug-2020
Metabolic and genomic characterization of stress tolerant industrial
Saccharomyces cerevisiae strains from TALENs-assisted multiplex editing
Yuman Gan1, 2, Yuping Lin1, Yufeng Guo1, Xianni Qi1, Qinhong Wang1*
1Key Laboratory of Systems Microbial Biotechnology, Tianjin Institute of Industrial Biotechnology,
Chinese Academy of Sciences, Tianjin 300308, China; 2University of Chinese Academy of Sciences, Beijing
100049, China;
∗Corresponding author: Qinhong Wang, Tianjin Institute of Industrial Biotechnology, Chinese Academy
of Sciences, 32 XiQiDao, Tianjin Airport Economic Area, Tianjin 300308, China.
Tel: +86 22 84861950;
E-mail: wang_qh@tib.cas.cn
One-Sentence Summary: TALENs-assisted multiplex genome editing accelerated the breeding of stress-
tolerant industrial Saccharomyces cerevisiae strains, and comparative genomic analysis uncovered the
related genomic alterations for improved phenotypes.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
ABSTRACT
TALENs-assisted multiplex editing (TAME) toolbox was previously established and used to successfully
enhance ethanol-stress tolerance of S. cerevisiae laboratory strain. Here, the TAME toolbox was
harnessed to improve and elucidate stress tolerances of S. cerevisiae industrial strain. One osmotolerant
strain and one thermotolerant strain were selected from the mutant library generated by TAME at
corresponding stress conditions, and exhibited 1.2- to 1.3-fold increases of fermentation capacities,
respectively. Genome resequencing uncovered genomic alterations in the selected stress tolerant
strains, suggesting that cell wall and membrane-related proteins might be major factors behind
improved tolerances of yeast to different stresses. Furthermore, amplified mitochondrial DNA might
also have an important impact on increased stress tolerance. Unexpectedly, none of predesigned target
potential TALENs modification sites showed any genomic variants in sequenced genomes of the selected
strains, implicating that the improved stress tolerances might be due to indirect impacts of genome-
editing via TALENs rather than introducing genomic variants at potential target sites. Our findings not
only confirmed TAME could be a useful tool to accelerate the breeding of industrial strain with multiple
stress tolerance, but also supported the previous understandings of the complicated mechanisms of
multiple stress tolerance in yeast.
Keywords: TALENs; multiplex genome editing; Saccharomyces cerevisiae; industrial strain; stress
tolerance; genome resequencing
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
INTRODUCTION
As important industrial strain, Saccharomyces cerevisiae has been broadly used in ethanol production
due to its general robustness and high productivity (Kavscek et al. 2015). To reduce production costs,
industrial fermentations prefer to be carried out at high temperature and high concentration of glucose,
thus producing high concentration of ethanol (Abdel-Banat et al. 2010). However, the industrial
fermentation conditions would cause thermal and hyperosmotic stresses as well as ethanol toxicity to
yeast cells, which lead to that massive biological macromolecules are damaged and arrested cell growth
or even cell death, eventually reducing ethanol production efficiency. Therefore, it is necessary to
improve stress tolerance of S. cerevisiae (Deparis et al. 2017).
Stress tolerance is a complicated phenotype, which is regulated by dozens of, even hundreds of
genes simultaneously. For instance, in order to adapt to elevated temperature, S. cerevisiae changes the
expression level of thousand genes to regulate cAMP-dependent protein kinase (PKA) signalling pathway,
cell cycle, lipid metabolism, and so on (Jarolim et al. 2013; Satomura et al. 2016). Previous studies
indicate that it is difficult to improve yeast stress tolerance by regulating one or several functional genes
(de Nadal et al. 2011). To overcome this obstacle, many traditional technologies are developed, such as
mutagenesis, genome shuffling, adaptive evolution, etc. Sequential mutagenesis has been used to
improve multiple stress tolerance in yeast strains (Kumari and Pramanik 2012). To improve yeast stress
tolerance, genome shuffling requires at least two strains, and mostly relies on a mutagenized pool of a
single strain or a natural pool of strains with different desirable phenotypes (Shi et al. 2009; Snoek et al.
2015). Adaptive laboratory evolution, which could accumulate desirable genomic and physiological
changes in cell populations during long term selection under specified growth conditions (Dragosits and
Mattanovich 2013), is exploited to obtain thermotolerant or ethanol-stress tolerant strains (Caspeta et
al. 2014; Voordeckers et al. 2015). Overall, these traditional approaches are feasible for the breeding of
stress tolerant strains, but laborious and relatively inefficient.
Targeted genome editing is an alternative approach for improving desirable traits of yeast, especially
TALENs and CRISPR/Cas9 systems which are considered as effective platforms because of their powerful
and multiplex genome editing capacities (Alexander 2017). For targeted genome editing, endonuclease
FokI or Cas9 generate a double strand break at targeted DNA, which can be repaired by endogenous
DNA repair pathways, thus introducing variable-length insertion/deletion mutations or specific sequence
alterations (Miller et al. 2011; Tsai et al. 2014). Recently, we established a TALENs-assisted multiplex
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
editing (TAME) toolbox to target the conserved TATA box and GC box at 66 potential modification sites
of S. cerevisiae genome and probably influence 98 genes (Zhang et al. 2015), and ethanol-stress
tolerance of S. cerevisiae laboratory strain was successfully enhanced by TAME.
Here, to improve osmotolerance and thermotolerance of S. cerevisiae industrial strain, TAME toolbox
was applied to generate a mutant library from an industrial strain ScY01 in several days. After screening
at hyperomostic or thermal stress conditions, one osmotolerant strain and one thermotolerant strain
were obtained, respectively, and stably exhibited 1.2- to 1.3-fold increases of fermentation capacities at
corresponding stress conditions. Genome resequencing analysis revealed genomic changes in coding
regions affecting the functions of encoded proteins or in intergenic regions probably influencing
transcriptional gene expression, which might be genetic factors that resulted in improved stress
tolerance of strains. Our results indicated that the TAME toolbox was a useful approach for improving
complicated and desirable traits of S. cerevisiae industrial strain, such as stress tolerances, and
metabolic and genome characterization of stress tolerant strains further confirmed the previously
elucidated mechanisms underlying different stress tolerances of yeast.
MATERIALS AND METHODS
TALENs plasmid construction
In our previous study (Zhang et al. 2015), plasmids pYES2/CT-GC and p313-GAL-TA (Table 1) with the
URA3 and HIS3 autotrophic marker genes, respectively, have been constructed to express the TALENs
pair recognizing the GGGCGG and TATAAA sequence, respectively, which allow to induce multiplex
editing in the genome of S. cerevisiae laboratory strains. To achieve similar multiplex genome editing in
S. cerevisiae industrial strain, two new plasmids pYES2/CT-GGGCGG-GAL1-ZeoR and pRS313-TATAAA-
GAL1-KanMX4 were constructed by inserting expression cassettes of the ZeoR and KanMX drug-resistant
marker genes into the plasmids pYES2/CT-GC and p313-GAL-TA, respectively, using the ClonExpress® II
One Step Cloning Kit (Vazyme Biotech Co.,Ltd, China). Specifically, the linear vector of pYES2/CT-GC was
PCR amplified using the primer pair pYES2-F/pYES2-R, the ZeoR expression cassette was PCR amplified
using the primer pair Zeocin-F/Zeocin-R from the plasmid pIS438 (Sadowski et al. 2008), and these two
PCR fragments were fused together by following the instruction of the kit. Similarly, the linear vector of
p313-GAL-TA was PCR amplified using the primer pair pRS313-F/pRS313-R, the KanMX expression
cassette was PCR amplified using the primer pair KanMX4-F/KanMX4-R from the plasmid pUG6
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
(Guldener et al. 1996). The primers used in this study were listed in Table 2. All recombinant plasmids
were sequenced by BGI (Shenzhen, China) to verify the insertion of the ZeoR and KanMX expression
cassettes.
Generation and screening of mutant strains by TALENs-mediated multiplex genome
editing
The procedure to generate and screen stress tolerant mutants of industrial S. cerevisiae strain with
TALENs-assisted multiplex editing was described as Figure 1A. To facilitate improving stress tolerances of
S. cerevisiae industrial strain by TALENs-mediated multiplex genome editing, the plasmids pYES2/CT-
GGGCGG-GAL1-ZeoR and pRS313-TATAAA-GAL1-KanMX4 expressing the TALENs that were designed to
recognize the GGGCGG and TATAAA sequence, respectively (Zhang et al. 2015), were used to induce
multiplex editing in the yeast genome. These two TALENs-expressing plasmids were firstly transformed
into the previously evolved thermotolerant industrial stain ScY01 in our lab (Shui et al. 2015), which is
able to grow and ferment well at 40ºC. The positive transformants were selected on YPD plates (per liter,
10 g yeast extract, 20 g peptone, 20 g glucose and 20 g agar) containing 70 μg mL-1 zeocin and 400 μg
mL-1 geneticin G418. To induce TALENs, the transformants with TALENs-expressing plasmids were
inoculated into 20 mL YP medium (per liter, 10 g yeast extract, 20 g peptone) containing 10 g L-1
galactose, 70 μg mL-1 zeocin and 200 μg mL-1 geneticin G418 in 50-mL flasks with an initial OD600 of 0.2,
cultured at 200 rpm at 30°C for 24 h, and subcultured for serial transfers every 24 hours for 7 days, thus
allowing accumulation of TALENs-mediated multiplex genomic mutations. The resulting mutant library
was further subcultured in liquid YPD medium for serial transfers every 12 hours for 10 days to lose the
TALENs-expressing plasmids, which could eliminate disturbing effects caused by the bindings of TALENs
on the genome. To screen osmotolerant mutants, one aliquot of the mutant library was plated on YP
plates with 400 g L-1 glucose producing hyperosmotic stress and grown at 40°C for 3 days until colonies
appeared. Total 218 colonies were separately inoculated into 200 µL liquid YP medium containing 400 g
L-1 glucose on 96-well plates and grown at 40°C for 48 h. The colony showing the best cell growth in
contrast to the parent strain ScY01 and any other colonies from our experiment at hyperosmotic
condition was named ScY001T (Table 1). To screen thermotolerant mutants, the other aliquot of the
mutant library was plated on YP plates containing 200 g L-1 glucose and grown at 42°C for 4 days. Total
671 colonies were separately inoculated into 200 µL liquid YP medium containing 200 g L-1 glucose on
96-well plates and grown at elevated temperature of 42°C for 24 h. The colony showing the best cell
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
growth in contrast to the parent strain ScY01 and any other colonies from our experiment at thermal
stress condition was named ScY033T (Table 1). These two more stress tolerant industrial S. cerevisiae
strains were assessed for subsequent physiological characterization and functional genomic elucidation.
Characterization of fermentation capacity
To characterize fermentation capacities of stress tolerant industrial S. cerevisiae strains, yeast cells on
YPD plates were grown in 100-ml flasks containing 50 ml YP media with 200 g L-1 glucose at 30°C
overnight (~15 h). Cells were harvested by centrifugation and then inoculated into fermentation media.
The initial OD600 used for fermentations was 0.5. YP medium containing 400 g L-1 glucose was used for
testing fermentation capacity at hyperosmotic conditions, and fermentations were performed at 40ºC.
Fermentations at thermal stress conditions were carried out at 42ºC using YP medium containing 200 g
L-1 glucose. Fermentations at moderate stress conditions were conducted at thermal stress condition of
40ºC using 200 g L-1 glucose, or 37°C using 400 g L-1 glucose, or at normal temperature of 30ºC using 400
g L-1 glucose. YP medium containing 200 g L-1 glucose and supplemented with 2-5% (v/v) or 3%-8% (v/v)
ethanol as specified in the text was used for testing fermentation capacity at ethanol stress conditions,
and fermentations were conducted at 30ºC and 40ºC, respectively. Cell growth was monitored by
measuring OD600. Concentrations of glucose and ethanol were measured by high performance liquid
chromatography (HPLC) on an Agilent 1260 system (Agilent, USA) equipped with a refractive index
detector and a Phenomenex RFQ fast acid column (100 mm x 7.8 mm ID) (Phenomenex Inc., Torrance,
CA, USA). The column was eluted with 0.01 N H2SO4 at a flow rate of 0.6 mL min-1 at 55°C.
Spot assay for heat-shock survival
Heat-shock assays and spot assays of cell survival were performed as described previously with
some modifications (Gibney et al. 2013; Jarolim et al. 2013). Yeast colonies were grown in 10
mL tubes containing 3 mL YP medium with 20 g L-1
glucose at 30°C with shaking at 200 rpm
overnight (~15 h). Cells were harvested by centrifugation, and inoculated into 25 ml YP medium
with 200 g L-1
glucose in 50 ml flasks, to achieve an initial OD600 value of 0.2. The cell cultures
were grown to early log phase at 30°C with shaking at 220 rpm for 5 h. Two aliquots containing
an appreciate amount of cells were harvested and resuspended in 1 mL supernatants to obtain
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
cell suspensions with an OD600 of 5.0. One aliquots of cell suspension were placed on ice as a
pre-heat shock control. The other aliquots of cell suspension were transformed to 10 mL tube,
and incubated at 50°C for 30 min with shaking at 200 rpm, and immediately chilled on ice for 5
min. Both pre-heat shock and heat-shock aliquots of cell suspensions with an OD600 of 5.0 were
diluted to OD600 of 1.0, 0.3, 0.1, 0.03, 0.01, and 5 µL samples at each dilution spotted on YPD
plates (YP medium with 20 g L-1
glucose) which were incubated at 30°C for 48 h.
Genome resequencing and data analysis
Genomic DNA isolation and the sequencing libraries of the osmotolerant strain ScY001T, the
thermotolerant strain ScY033T and the parent strain ScY01 were constructed and sequenced on Illumina
HiSeq 4000 using 150-bp paired-end sequencing by GeneDenovo Co. (Guangzhou, Guangdong, China). A
mean of 21.2 million 150-bp clean reads was generated for each library. The S. cerevisiae S288c genome
as a reference was downloaded from RefSeq at the NCBI (sequence assembly version R64, RefSeq
assembly accession: GCF_000146045.2) including 16 chromosomes and the mitochondrial genome. The
Genome Analysis Toolkit (GATK v3.5) Best Practices pipeline was used to detect Single Nucleotide
Polymorphisms (SNPs) and Insertion/Deletion (InDels) (McKenna et al. 2010; DePristo et al. 2011). The
cleaned reads were mapped to the reference genome using the mapping tools BWA-mem (version
0.7.13) (Li and Durbin 2009), providing an average sequencing depth of 185x and 98% sequencing
coverage for each library. And variants were then called using GATK HaplotypeCaller. For genome
analysis, reads with mapping quality >=30 were included. Initially called SNPs were filtered with a
minimum read depth of 10 and a quality score threshold of 20 (Clevenger et al. 2015). Variants
annotation was performed using the package ANNOVAR (Wang et al. 2010).
The affected genes of detected genic non-synonymous and intergenic variants (SNPs and InDels) in
comparing ScY001T with ScY01 as well as ScY033T with ScY01 are available in supplementary material
(Supplementary file 1-4), and were further analysed for enrichment in Gene Ontology (GO) terms using
DAVID Bioinformatics Resources 6.8 with a P-value cut-off of less than 0.05 and a Benjamini FDR (False
Discovery Rate) cut-off of less than 0.5 (Huang da et al. 2009) (Table S1). Copy number variants (CNV)
corresponding to potential large scale chromosomal duplications and loss were examined by using CNV-
seq package in R (Xie and Tammi 2009). The results were plotted as log ratio plots with calculated p-
values for genomic and mitochondrial genome, respectively. The genome sequencing raw data were
deposited in the NCBI Sequence Read Archive (SRA) under the accession number SRP127218.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Determination of cell wall structure and cell membrane integration
Cells were grown in 100-ml flasks containing 50 ml YP media with 200 g L-1 glucose at 30°C overnight
(~15 hours), and then inoculated into media with an initial OD600 of 0.5 after centrifugation. For
treatments at hyperosmotic stress condition, cells were cultured at 400 g L-1 glucose and 40°C for 48 h.
For treatments at thermal stress condition, cells were cultured at 200 g L-1 glucose and 42°C for 36 h. As
controls, cells were correspondingly cultured at normal condition using 200 g L-1 glucose at 30°C for 48 h
or 36 h. Cells were then harvested by centrifugation and washed twice with 0.1 M phosphate buffered
solution (PBS, pH 7.4). Cell pellets were resuspended in PBS solution. One aliquots of cell suspension
were used for monitoring cell wall structure by electron microscope. The other aliquots were used for
monitoring membrane integration by flow cytometry (FCM).
For scanning electron microscopy (SEM) analysis, samples were fixed and treated as previously
described (Niu et al. 2017). Inspection and photomicrographs were performed with a scanning electron
microscope (SU8010, Hitachi, Ltd., Japan) operating at a voltage of 1.0 kV. For transmission electron
microscopy (TEM) analysis, samples were fixed and processed as previously reported (Guan et al. 2012).
After contrasting with uranyl acetate and lead citrate, the sample were examined with transmission
electron microscope (HT7700, Hitachi, Ltd., Japan).
Determination of membrane integration by FCM analysis was conducted according to the previously
reported method (Khan et al. 2011). Briefly, cells were stained using propidium iodide (PI), which
penetrates cells with severe membrane lesions only, and make the cell be colored with red by binding
the nucleic acid. After staining for 30 min, monoparametric detection of PI fluorescence was performed
using MoFlo XDP flow cytometer (Beckman Coulter, Brea, CA, USA) with wavelength of 488/620 nm.
RESULTS AND DISCUSSION
Screening of stress-tolerant industrial S. cerevisiae by TALENs assisted multiplex editing
The TALENs recognizing the critical and conserved GC box (GGGCGG) and TATA box (TATAAA) was
previously designed to target 66 potential TALENs-mediated modification sites in the genome of S.
cerevisiae and probably influence 98 genes, thus allowing to induce genomic modification at multiple
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
sites (Zhang et al. 2015). By applying this pair of TALENs, a TALENs-assisted multiplex editing (TAME)
toolbox was established and used to successfully improve ethanol tolerance of S. cerevisiae laboratory
strain BY4741 in a short amount of time (Zhang et al. 2015). Here, this TAME toolbox was harnessed to
improve tolerances of S. cerevisiae industrial strain ScY01 to hyperosmotic and high temperature
stresses. After TAME treatment for seven rounds, a mutant library of the industrial strain ScY01 was
generated and subjected to screen stress-tolerant mutants at hyperosmotic and high temperature stress
conditions, respectively (Fig. 1). On the one hand, among total 218 colonies screened at hyperosmotic
stress condition, 12.4% of cells showed more than 1.2-fold increase of cell growth in contrast to the
parent strain ScY01, whereas 9.6% showed less than 0.8-fold decrease of cell growth than ScY01 (Fig. 1B).
The colony with the best cell growth showed a 1.3-fold increase in contrast to the initial strain ScY01,
and named ScY001T for further evaluation of osmotolerance and other stress characterization as well as
genomic analysis. On the other hand, among total 671 colonies screened at high temperature condition,
6.6% of cells showed more than 1.2-fold increase of cell growth than the parent strain ScY01, whereas
33.4% showed less than 0.8-fold decrease of cell growth than ScY01 (Fig. 1C). The colony with the best
cell growth showed a 1.4-fold increase in contrast to the parent strain ScY01, and named ScY033T for
further evaluation of thermotolerance and other stress characterization as well as genomic analysis.
Physiological characterization of stress-tolerant industrial S. cerevisiae
To evaluate whether fermentation capacities of the selected stress-tolerant mutants were also
improved at stress conditions, the selected osmotolerant strain ScY001T and thermotolerant strain
ScY033T were compared with the parent strain ScY01 at hyperosmotic and high temperature conditions,
respectively. At hyperosmotic condition caused by high concentration of 400 g L-1 glucose, ScY001T
consumed 144.3 ± 1.0 g L-1 glucose in 84 hours, which was 1.3 times as much as ScY01 (Fig. 2A).
Meanwhile, ScY001T produced 61.9 ± 0.3 g L-1 ethanol in 84 hours, which was 1.2 times more than that
of ScY01. On the other hand, ScY033T consumed 108.9 ± 2.6 g L-1 glucose in 84 hours at 42C, which was
1.2 times as much as ScY01. Meanwhile, ScY033T produced 46.3 ± 0.2 g L-1 ethanol in 84 hours, which
was 1.3 times more than that of ScY01 (Fig. 2B). These results indicated that the selected stress-tolerant
strains could also obtain enhanced fermentation capacities at stress conditions. However, glucose
consumption of both ScY001T and ScY01 got slow after fermenting for 72 hours at hyperosmotic
condition, leading to more than half of the residual glucose left in the media. Both ScY033T and ScY01
consumed only a little more than half of the glucose at higher temperature (42C). These results might
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
be due to the combination inhibitory effects of high temperature and hyperosmotic stresses, since
fermentations at hyperosmotic condition were performed at 40ºC instead of normal temperature of
30ºC and fermentation at thermal stress condition were conducted using a relatively high concentration
of glucose of 200 g L-1 glucose as well as higher temperature of 42ºC. To verify this assumption, we
compared the fermentation capacities of the stress-tolerant and parent strains at moderate stress
conditions (Supplementary Fig. S1). The parent strain ScY01 has been previously evolved to grow and
ferment well at 40ºC (Shui et al. 2015). Thus, when fermentations were conducted using 200 g L-1
glucose at 40ºC, the stress-tolerant strains ScY001T and ScY033T showed similar fermentation capacities
to the parent strain ScY01 and completely consumed glucose within 48 h (Supplementary Fig. S1A).
When fermentations at hyperosmotic condition were performed at a moderate temperature of 37ºC
and a normal temperature of 30ºC (Supplementary Fig. S1B and S1C), much more glucose was
consumed in contrast to 42ºC (Fig. 2A and 3B). Furthermore, the osmotolerant strain ScY001T obviously
consumed glucose more quickly than ScY01 and ScY033T at 37ºC (Supplementary Fig. S1B). By contrast,
at 30ºC, ScY001T consumed glucose slightly faster at the beginning of fermentation but eventually
slower than ScY01 and ScY033T (Supplementary Fig. S1C). Therefore, these results confirmed the
combination inhibitory effects of high temperature and hyperosmotic stresses.
During the industrial production process, S. cerevisiae often suffers from multiple stresses. Thus,
strains resistant to multiple stresses would be desirable for their industrial applications. To test the
physiological response of the selected stress-tolerant strains to other stress conditions, fermentation
capacity of the selected osmotolerant strain ScY001T was evaluated at thermal stress condition, while
fermentation capacity of the selected thermotolerant strain ScY033T was detected at hyperosmotic
condition. Furthermore, both ScY001T and ScY033T were evaluated for fermentation capacities at other
stress conditions. At thermal stress condition, osmotolerant strain ScY001T consumed 144.3 ± 1.0 g L-1
glucose and produced 39.5 ± 0.2 g L-1 ethanol in 60 hours at 42ºC, which were 1.1 times as much as that
of ScY01 (Fig. 3A). At hyperosmotic stress condition, thermotolerant strain ScY033T consumed 117.3 ±
4.1 g L-1 glucose and produced 43.6 ± 2.6 g L-1 ethanol in 84 hours, which were 1.1 times as much as that
of ScY01 (Fig. 3B). These results suggested that the selected osmotolerant strain might acquire slightly
increased thermotolerance and the selected thermotolerant strain might also acquire slightly increased
osmotolerance. To evaluate the ethanol tolerance of ScY001T and ScY033T, we performed
fermentations using media supplemented with 0% (v/v), 3%(v/v), 6% (v/v) or 8% (v/v) ethanol
concentration at 30ºC (Supplementary Fig. S2) as well as with 0% (v/v), 2% (v/v), 3% (v/v) or 5% (v/v)
ethanol concentration at 40ºC (Supplementary Fig. S3). At normal condition using 200 g L-1 glucose at
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
30ºC, glucose was depleted within 18 h, and ScY001T and ScY033T exhibited similar fermentation
capacities to ScY01 (Supplementary Fig. S2A). With the increasing concentration of ethanol
supplemented in media, fermentation capacities of these strains were gradually hampered at either
30ºC and 40ºC (Supplementary Fig. S2 and S3), and completely inhibited at the condition of 5% (v/v)
ethanol at 40ºC. Overall, both ScY001T and ScY033T did not exhibit greatly different fermentation
capacities from parent ScY01 at ethanol stress condition (Supplementary Fig. S2 and S3), indicating that
the screening process of both osmotolerant and thermotolerant mutants might have no significant
impact on enrichment of ethanol-tolerant mutants.
Furthermore, the physiological responses of the selected stress-tolerant strains to short-term heat
shock were monitored by measuring cell viability through spot assay before and after heat shock
treatment. As for cells without heat shock treatment, both the selected stress-tolerant strains ScY001T
and ScY033T showed similar cell viabilities to the parent strain ScY01 (Fig. 4A). Inherently, both ScY001T
and ScY033T acquired increased long-term thermotolerance at prolonged stress conditions (Fig. 2 and 3),
but they both showed dramatically decreased cell viabilities after heat shock treatment in contrast to
ScY01 (Fig. 4B). This result implicated that there might be a trade-off mechanism for acquiring long-term
stress tolerance and maintaining short-term stress tolerance, such as heat shock response. The heat
shock response is appropriately considered to be evolutionarily selected to prevent damage caused by
an anticipated stress rather than to promote recovery from an existing insult (Verghese et al. 2012). In
contrast to potential lethal damages caused by short-term severe stresses, long-term moderate stresses
lead to sustained but nonlethal impacts on physiological activities of cells, which might provide cells a
chance to be adapted to stress conditions. It has been reported that adaptively evolved thermotolerant
S. cerevisiae strain show trade-off at ancestral temperatures and preadaptation to other stresses
(Caspeta and Nielsen 2015), and even expressed heat stress response at normal temperature of 30°C
(Caspeta et al. 2016). Furthermore, S. cerevisiae has distinct regulatory mechanism of thermotolerance
at long-term thermal stress from the heat shock response at short-term thermal stress (Shui et al. 2015).
Taken together, aiming to further improve fermentation capacities at multiple stress conditions,
more efforts of strain breeding remained to be undertaken. TAME toolbox would be a promising
approach to accelerate the breeding of multiple stress-tolerant strains, especially by performing several
rounds of TAME treatment and switching the screening conditions between different stresses.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Functional genomic elucidation of stress-tolerant industrial S. cerevisiae
To uncover the genomic alterations behind the increased stress tolerances of the selected strains, both
mutant strains ScY001T and ScY033T as well as the parent strain ScY01 were subjected to whole genome
resequencing. By comparing with the reference genome of strain S228c, the common and different SNPs
and InDels were detected in ScY001T versus ScY01 as well as ScY033T versus ScY01 (Table 3). Among the
different SNPs and InDels between ScY001T and ScY01, total 200 genes with non-synonymous variants
were annotated to result in mutant or non-functional proteins (Supplementary file 1), meanwhile total
709 genes with intergenic variants were predicted to be modulated in terms of gene expressions in the
osmotolerant mutant ScY001T (Table 3, Supplementary file 2). Among the different SNPs and InDels
between ScY033T and ScY01, total 205 genes with non-synonymous variants were annotated to result in
mutant or non-functional proteins (Supplementary file 3), meanwhile total 707 genes with intergenic
variants were predicted to be altered in terms of gene expressions in the thermotolerant mutant
ScY033T (Table 3, Supplementary file 4). Remarkably, a majority of these variants were classified as
heterozygous in either or both of stress-tolerant strains and the parent strain, where more than one
allelic variant was genotyped by genome sequencing (Supplementary file 1-4). This might be due to the
diploid nature of these strains (Shui et al. 2015). Similarly, a large portion of differential variants were
also observed to be heterozygous in another industrial diploid strain of S. cerevisiae strain Ethanol Red
and its evolved strain ISO12 (Wallace-Salinas et al. 2015). However, the difference was that the
percentage of heterozygous variants slightly increased in the previously reported evolved strain ISO12
(Wallace-Salinas et al. 2015), but obviously decreased in the stress-tolerant strains ScY001T and ScY033T
in this study (Supplementary file 1-4). It seemed that more alleles became homozygous during the TAME
treatment, which might be beneficial to eliminate the deleterious effects of heterozygous mutations
causing haploinsufficiency in diploid strains (Deutschbauer et al. 2005). For instance, Ste50, which is an
adaptor protein for osmosensory signalling pathway (Jansen et al. 2001), was detected to have a
heterozygous mutation of D109G in the parent strain ScY01 and become homozygous wild-type Ste50 in
the osmotolerant strain ScY001T (Supplementary file 1). It has been reported that mutations in the SAM
domain of Ste50 at position 30 to 104 cause signalling defects in the pathways for mating, filamentous
growth and osmotolerance (Jansen et al. 2001). Here, the mutation D109G is localized near the SAM
domain, implicating its adverse effect on osmotolerance, which was eliminated because of the
homozygous wild-type Ste50 in ScY001T. Furthermore, compared with the stress-tolerant mutants
derived from industrial diploid strains, the evolved mutants derived from laboratory haploid strains
were not reported to have heterozygous mutations (Caspeta et al. 2014; Satomura et al. 2016). Thus,
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
the identified point mutations affecting the functions of ERG3 and CDC25 could be easily verified for
their positive effects on stress tolerance by reconstructing them in the parent strains (Caspeta et al.
2014; Satomura et al. 2016). By contrast, it would be difficult to verify the effects of the identified
genomic mutations on stress tolerance in industrial diploid strains due to their homo-/heterozygosity,
but worthwhile to make further efforts in the future.
Based on Gene Ontology (GO) Cellular Component (CC) enrichment analysis (Huang da et al. 2009),
the affected genes of non-synonymous variants in both ScY001T and ScY033T showed similar
enrichments, and were mostly enriched for integral component of membrane and cell wall related
proteins (Fig. 5A, Table S1). Besides the enrichment for cell wall and membrane related components,
some affected genes were enriched for vacuole. GO Molecular Function (MF) enrichment analysis
indicated that the affected genes of non-synonymous variants in ScY001T were specifically enriched for
structural constituent of cell wall, while those in ScY033T were specifically enriched for receptor activity
proteins (Fig. 5A, Table S1). Furthermore, according to GO Biological Process (BP) enrichment analysis,
only the affected genes of non-synonymous variants in ScY001T were found to be enriched in biological
processes including fungal-type cell wall organization, transmembrane transport and flocculation related
processes proteins (Fig. 5A, Table S1). Membrane-associated stress proteins include not only chaperones
but also other proteins (Horvath et al. 2008). Wallace-Salinas et al. reported that non-synonymous
variants were significantly enriched in GO terms related to cell periphery, membranes and cell wall
during the adaptive evolution of an industrial S. cerevisiae strain to combined heat and hydrolysate
stress (Wallace-Salinas et al. 2015). Our observations were consisted with the previous findings,
suggesting that cell wall and membrane-related proteins might be major genomic targets behind
improved tolerances of industrial S. cerevisiae strain to different stresses.
Furthermore, variations in non-coding regions have been investigated to have an important impact
on phenotypic diversity given their influence on gene expression level (Connelly et al. 2013). Based on
GO term enrichment analysis, the affected genes of intergenic variants in ScY033T and ScY001T were
also found to have enrichments for cell wall-related cellular components, molecular functions and
biological processes (Fig. 5B, Table S1), suggesting that gene expression of cell wall-related proteins
might be reshaped in the stress-tolerant strains due to these intergenic variants. Remarkably, both the
affected genes of intergenic variants in ScY001T and ScY033T were enriched for the biological process of
response to stress, and those in ScY001T had a specific enrichment for cellular components of
cytoplasmic stress granule. These results implicated that altering gene expression of stress response
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
related genes might be another genomic targets behind improved tolerances of industrial S. cerevisiae
strain to different stresses. Satomura et al. also reported that evolved thermotolerant strains showed
highly up-regulated gene expression involved in response to stress and heat, due to a CDC25 point
mutation that led to the downregulation of the cAMP-dependent protein kinase (PKA) signalling
pathway (Satomura et al. 2016). However, the effects of intergenic variants were too complicated to be
verified.
DNA copy number variation (CNV) — amplification or deletion of DNA segments — is also an
important source of genetic variation, changing the original number of DNA copies that could lead to
phenotypic variations. Thus, CNVs of the selected stress-tolerant strains were assessed for not only
nuclear genomic DNA (ncDNA) but also mitochondrial genomic DNA (mtDNA) (Fig. 6 and 7).
Amplification-type CNVs seemed to be prevalent on mtDNA of ScY001T (Fig. 6A). Distribution histograms
of amplification-type (blue in Fig. 6B) and deletion-type (red in Fig. 6B) CNVs clearly displayed that
amplification-type and deletion-type CNVs were equally distributed across nuclear chromosomes while
the majority of CNVs were amplification-type on mtDNA (Fig. 6B). Similarly, amplification-type CNVs of
ScY033T were also observed on mtDNA instead of nuclear chromosomes (Fig. 7). These observations
implicated that the stress-tolerant mutants ScY001T and ScY033T might have more mtDNA copies or
more mitochondria than the parent strain ScY01. Mitochondria are the sites for producing ATP through
respiration, and also seen to regulate nuclear gene expression and cellular functions (Whelan and
Zuckerbraun 2013). Previous study reported that ATP is an important factor for yeast cells to maintain
normal physiological levels at stress conditions (Postmus et al. 2011). The mechanism underlying mtDNA
amplifications in the stress-tolerant strains remained to be discovered.
In our previous study (Zhang et al. 2015), ethanol tolerance of a laboratory strain BY4741 was rapidly
improved by coupling TAME accelerated genome evolution with the screening method of using ethanol
as selective stress. However, when applying the same strategy to the industrial strain ScY01, we did not
obtain any mutations with enhanced ethanol tolerance (data not shown). These differential results
implicated that the consequence of TALENs-mediated genome editing in the industrial strain might be
different from that in the laboratory strain. Furthermore, genome sequencing of the ethanol-tolerant
laboratory strain showed that seven sites (10.6%) of a total of 66 potential TALENs modification sites
contained the TALENs-induced InDels (Zhang et al. 2015). Unexpectedly, in this study, none of potential
predesigned TALENs modification sites were found to have any genomic variants in sequenced genomes
of ScY001T and ScY033T. Thus, the improved stress tolerances of TAME treated cells might be due to
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
non-target genomic modifications (Zhang et al. 2015) and indirect impacts of genome-editing via TALENs
rather than introducing genomic variants at potential predesigned target sites. Compared with S.
cerevisiae laboratory strains, the genome editing via CRISPR/Cas9 in an industrial strain is relatively
difficult to be established because of low transformation and genome editing efficiencies (Stovicek et al.
2015). Similar difficulties might exist in genome editing via TALENs in an industrial strain. Furthermore, it
has been reported that oligonucleotide directed gene editing activates damage response pathway and
replication fork stress in mammalian cells (Bonner et al. 2012). Although there were no genomic variants
introduced into industrial strains by genome editing via TALENs, double strand breaks generated by
TALENs might induce DNA replication stress thereby triggering stress responses of yeast cells.
Alteration of cell wall structure and cell membrane integration in stress-tolerant strains
When cells are exposed to various environmental stresses, cell wall and membrane act as the first
barrier against external stresses. Some recent demonstrated that cell wall remodeling as well as
alteration of membrane composition and structure seem to be the primary mechanisms required for
protection against cell damage in stress-tolerant strains (Caspeta et al. 2014; Wallace-Salinas et al. 2015;
Kitichantaropas et al. 2016). Furthermore, genomic variants of stress-tolerant strains in this study
converged on genes related to cell wall, cell periphery and cell membrane (Fig. 5, Supplementary file 5).
Thus, we determined and compared cell wall structure and cell membrane integration of stress-tolerant
strains ScY001T and ScY033T with the parent strain ScY01 at hyperosmotic and thermal stress conditions
using electron microscope and flow cytometry.
Based on the inspection by scanning electron microscope (SEM), the stress-tolerant strains,
especially ScY033T, had more rough surfaces than ScY01 at hyperosmotic stress condition (Fig. 8A), and
transmission electron microscope (TEM) analysis further recognized fimbriate cell surfaces of ScY001T
and ScY033T in comparison with ScY01 (Supplementary Fig. S4). On the other hand, at thermal stress
condition, ScY001T and ScY033T showed slightly more surfaces than ScY01 according to SEM analysis
(Fig. 8A), and their relatively short hairy surfaces were observed by using TEM analysis (Supplementary
Fig. S4). These results suggested that cell walls of the stress-tolerant strains ScY001T and ScY033T might
be remodeled in comparison with the parent strain ScY01, leading to a more robust wall to protect cells
against hyperosmotic or thermal stresses. Furthermore, genomic variants related to cell wall might be
responsible for cell wall remodeling of the stress-tolerant strains. For instance, compared with ScY01,
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
both ScY001T and ScY033T had non-synonymous variants related to cellular surface properties such as
adhesion (AGA1, FIG2), and biofilm and flocculation (FLO1, FLO5, FLO9) (Supplementary file 5), which
were also observed to be mutant in previously reported thermotolerant strain (Wallace-Salinas et al.
2015). Besides, SED1 encoding major stress-induced structural GPI-cell wall glycoprotein also showed
non-synonymous mutations in ScY001T and ScY033T (Supplementary file 5). Interestingly, 16 and 14 of
24 PAU genes encoding structural constituent of cell wall, which might be differentially induced and
possess specific roles for the adaptation of S. cerevisiae to certain environmental stresses (Luo et al.
2009), were found to have intergenic mutations in ScY001T and ScY033T, respectively (Supplementary
file 5). This observation further confirmed that cell wall remodeling of ScY001T and ScY033T might be
due to these genomic variants. In addition, the same stress-tolerant strain showed more rough cell
surface at hyperosmotic stress condition than at thermal stress condition, indicating more activated cell
wall remodeling at hyperosmotic stress condition.
Besides cell wall remodeling, cell membrane integration might be also modified due to genomic
variants in ScY001T and ScY033T (Supplementary file 5). Flow cytometric monitoring of propidium iodide
(PI) uptake has been well-established to inspect cell membrane integration (Davey et al. 2011). Under
control conditions without stress, percentages of PI-stained cells were lower than 5% for both the
stress-tolerant stress ScY001T and ScY033T and the parent strain ScY01 (Fig. 8B). By contrast,
percentage of PI-stained cells of ScY01 increased to 16.6 ± 0.5% at hyperosmotic stress condition and
19.6 ± 0.2% at thermal stress condition, respectively. Compared with ScY01, ScY001T showed slightly
lower percentage of PI-stained cells at hyperosmotic stress condition and apparently lower percentage
(10.9 ± 0.1%) of PI-stained cells at thermal stress condition. On the other hand, ScY033T showed
significantly lower percentage (6.0 ± 0.1%) of PI-stained cells at hyperosmotic stress condition but
similar percentage of PI-stained cells at thermal stress condition in contrast to ScY01. These results
suggested that the stress-tolerant strains might develop more robust cell membranes to different
extent. Meanwhile, many genes (Supplementary file 5), which encode membrane-associated proteins,
membrane transporters, integral component of membrane, etc., were found to have non-synonymous
variants in the stress-tolerant stress ScY001T and ScY033T, which might be beneficial to cell membrane
integration at stress conditions. Overall, the stress-tolerant stress ScY001T and ScY033T seemed to
remodel cell wall and alter cell membrane integration to different extent by developing related genomic
variants, thus protecting cells from adverse stresses. Further efforts, however, are required to clarify the
precise molecular mechanisms underlying stress tolerance of these strains.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
In the future, further improvement of transformation and genome editing efficiencies of S. cerevisiae
industrial strains would be beneficial to the application of the TAME toolbox in the breeding of multiple
stress-tolerant strains. TAME-introduced genomic mutations were generated and accumulated when
the TALENs-induced double strand breaks (DSBs) were being fixed through the NHEJ (nonhomologous
end joining) pathway of DSB repair. In yeast, two major competing pathways including homologous
recombination (HR) and NHEJ are involved in DSB repair (Aylon et al. 2004), but the NHEJ efficiency is
pretty low (Li et al. 2011). It was recently reviewed that inhibiting critical NHEJ proteins, such as Ligase
IV, a serine/threonine protein kinase DNA-PK responsible for initiating the NHEJ pathway and the
heterodimeric Ku complex for binding DSB ends, could enhance HR-mediated genome editing
(Pawelczak et al. 2018). On the contrary, inhibition of HR activity would increase the NHEJ efficiency,
thereby providing a promising approach to improve the TALENs-mediated genome editing efficiency and
increase the rate of TALENs-introduced genomic mutations in industrial S. cerevisiae strains. In addition,
population genomics studies reported that phenotypic variation of S. cerevisiae isolates correlates with
genomic variation (Liti et al. 2009). Therefore, comparative genome analysis between S. cerevisiae
industrial and lab strains would identify the genomic variants that might determine the differential
consequence of TAME treatment in these strains, thus providing clues to further improve the TAME
efficiency in industrial strains by modulating these genomic variants.
ACKNOWLEDGEMENTS
We thank Dr. Guoqiang Zhang for constructing the TALENs-expressing plasmids with drug-resistant
marker genes. We thank Lixian Wang and Huanhuan Zhai (Technical Support Center, Tianjin Institute of
Industrial Biotechnology, Chinese Academy of Sciences) for technical assistance in flow cytometry and
electron microscope, respectively.
FUNDING
This work was supported by the National Science Foundation of China (31470214 and 31700077), the
National Science Foundation of Tianjin (16JCYBJC43100) and the Science and Technology Support
Program of Tianjin, China (15PTCYSY00020), and funding from the Science and Technology Foundation
for Selected Overseas Chinese Scholar of Tianjin to Yuping Lin.
Conflict of interest. None declared.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
REFERENCES
Abdel-Banat BM, Hoshida H, Ano A et al. High-temperature fermentation: how can processes for ethanol
production at high temperatures become superior to the traditional process using mesophilic
yeast? Appl Microbiol Biot 2010;85:861–7.
Alexander WG. A history of genome editing in Saccharomyces cerevisiae. Yeast. 2017. DOI:
10.1002/yea.3300.
Aylon Y, Kupiec M. DSB repair: the yeast paradigm. DNA Repair (Amst) 2004;3:797–815.
Bonner M, Strouse B, Applegate M et al. DNA damage response pathway and replication fork stress
during oligonucleotide directed gene editing. Mol Ther-Nucl Acids 2012;1:e18.
Caspeta L, Nielsen J. Thermotolerant yeast strains adapted by laboratory evolution show trade-off at
ancestral temperatures and preadaptation to other stresses. mBio 2015;6:e00431.
Caspeta L, Chen Y, Nielsen J. Thermotolerant yeasts selected by adaptive evolution express heat stress
response at 30°C. Sci Rep 2016;6:27003.
Caspeta L, Chen Y, Ghiaci P et al. Altered sterol composition renders yeast thermotolerant. Science
2014;346:75–8.
Clevenger J, Chavarro C, Pearl SA et al. Single nucleotide polymorphism identification in polyploids: a
review, example, and recommendations. Mol Plant 2015;8:831–46.
Connelly CF, Skelly DA, Dunham MJ et al. Population genomics and transcriptional consequences of
regulatory motif variation in globally diverse Saccharomyces cerevisiae strains. Mol Biol Evol
2013;30:1605–13.
Davey HM, Hexley P. Red but not dead? Membranes of stressed Saccharomyces cerevisiae are
permeable to propidium iodide. Environ Microbiol 2011;13:163–71.
de Nadal E, Ammerer G, Posas F. Controlling gene expression in response to stress. Nat Rev Genet
2011;12:833–45.
Deparis Q, Claes A, Foulquie-Moreno MR et al. Engineering tolerance to industrially relevant stress
factors in yeast cell factories. FEMS Yeast Res 2017;17: DOI: 10.1093/femsyr/fox036.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
DePristo MA, Banks E, Poplin R et al. A framework for variation discovery and genotyping using next-
generation DNA sequencing data. Nat Genet 2011;43:491–8.
Dragosits M, Mattanovich D. Adaptive laboratory evolution -- principles and applications for
biotechnology. Microb Cell Fact 2013;12:64.
Gibney PA, Lu C, Caudy AA et al. Yeast metabolic and signaling genes are required for heat-shock survival
and have little overlap with the heat-induced genes. P Natl Acad Sci USA 2013;110:E4393–402.
Guan B, Lei J, Su S et al. Absence of Yps7p, a putative glycosylphosphatidylinositol-linked aspartyl
protease in Pichia pastoris, results in aberrant cell wall composition and increased osmotic stress
resistance. FEMS Yeast Res 2012;12:969–79.
Guldener U, Heck S, Fiedler T et al. A new efficient gene disruption cassette for repeated use in budding
yeast. Nucleic Acids Res 1996;24:2519–24.
Horvath I, Multhoff G, Sonnleitner A et al. Membrane-associated stress proteins: more than simply
chaperones. Biochim Biophys Acta 2008;1778:1653–64.
Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using
DAVID bioinformatics resources. Nat Protoc 2009;4:44–57.
Jarolim S, Ayer A, Pillay B et al. Saccharomyces cerevisiae genes involved in survival of heat shock. G3
2013;3:2321–33.
Kavscek M, Strazar M, Curk T et al. Yeast as a cell factory: current state and perspectives. Microb Cell
Fact 2015;14:94.
Khan A, Ahmad A, Akhtar F et al. Induction of oxidative stress as a possible mechanism of the antifungal
action of three phenylpropanoids. FEMS Yeast Res 2011;11:114–22.
Kitichantaropas Y, Boonchird C, Sugiyama M et al. Cellular mechanisms contributing to multiple stress
tolerance in Saccharomyces cerevisiae strains with potential use in high-temperature ethanol
fermentation. AMB Express 2016;6:107.
Kumari R, Pramanik K. Improvement of multiple stress tolerance in yeast strain by sequential
mutagenesis for enhanced bioethanol production. J Biosci Bioeng 2012;114:622–29.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics
2009;25:1754–60.
Li T, Huang S, Zhao X et al. Modularly assembled designer TAL effector nucleases for targeted gene
knockout and gene replacement in eukaryotes. Nucleic Acids Res 2011;39:6315–25.
Liti G, Carter DM, Moses AM et al. Population genomics of domestic and wild yeasts. Nature
2009;458:337–41.
Luo Z, van Vuuren HJ. Functional analyses of PAU genes in Saccharomyces cerevisiae. Microbiology
2009;155:4036–49.
McKenna A, Hanna M, Banks E et al. The genome analysis toolkit: a MapReduce framework for analyzing
next-generation DNA sequencing data. Genome Res 2010;20:1297–303.
Miller JC, Tan S, Qiao G et al. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol
2011;29:143–8.
Niu L, Nomura K, Iwahashi H et al. Petit-High Pressure Carbon Dioxide stress increases synthesis of S-
Adenosylmethionine and phosphatidylcholine in yeast Saccharomyces cerevisiae. Biophys Chem
2017;231:79–86.
Pawelczak KS, Gavande NS, VanderVere-Carozza PS et al. Modulating DNA repair pathways to improve
precision genome engineering. ACS Chem Biol 2018;13:389–96.
Postmus J, Tuzun I, Bekker M et al. Dynamic regulation of mitochondrial respiratory chain efficiency in
Saccharomyces cerevisiae. Microbiology 2011;157:3500–11.
Sadowski I, Lourenco P, Parent J. Dominant marker vectors for selecting yeast mating products. Yeast
2008;25:595–9.
Satomura A, Miura N, Kuroda K et al. Reconstruction of thermotolerant yeast by one-point mutation
identified through whole-genome analyses of adaptively-evolved strains. Sci Rep 2016;6:23157.
Shi DJ, Wang CL, Wang KM. Genome shuffling to improve thermotolerance, ethanol tolerance and
ethanol productivity of Saccharomyces cerevisiae. J Ind Microbiol Biot 2009;36:139–47.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Shui W, Xiong Y, Xiao W et al. Understanding the mechanism of thermotolerance distinct from heat
shock response through proteomic analysis of industrial strains of Saccharomyces cerevisiae. Mol
Cell Proteomics 2015;14:1885–97.
Snoek T, Picca Nicolino M, Van den Bremt S et al. Large-scale robot-assisted genome shuffling yields
industrial Saccharomyces cerevisiae yeasts with increased ethanol tolerance. Biotechnol Biofuels
2015;8:32.
Stovicek V, Borodina I, Forster J. CRISPR–Cas system enables fast and simple genome editing of industrial
Saccharomyces cerevisiae strains. Metab Eng Commun 2015;2:13–22.
Tsai SQ, Wyvekens N, Khayter C et al. Dimeric CRISPR RNA-guided FokI nucleases for highly specific
genome editing. Nat Biotechnol 2014;32:569–76.
Verghese J, Abrams J, Wang Y et al. Biology of the heat shock response and protein chaperones: budding
yeast (Saccharomyces cerevisiae) as a model system. Microbiol Mol Biol R 2012;76:115–58.
Voordeckers K, Kominek J, Das A et al. Adaptation to high ethanol reveals complex evolutionary
pathways. PLoS Genet 2015;11:e1005635.
Wallace-Salinas V, Brink DP, Ahren D et al. Cell periphery-related proteins as major genomic targets
behind the adaptive evolution of an industrial Saccharomyces cerevisiae strain to combined heat
and hydrolysate stress. BMC genomics 2015;16:514.
Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput
sequencing data. Nucleic Acids Res 2010;38:e164.
Whelan SP, Zuckerbraun BS. Mitochondrial signaling: forwards, backwards, and in between. Oxid Med
Cell Longev. 2013;2013:351613.
Xie C, Tammi MT. CNV-seq, a new method to detect copy number variation using high-throughput
sequencing. BMC Bioinformatics 2009;10:80.
Zhang G, Lin Y, Qi X et al. TALENs-assisted multiplex editing for accelerated genome evolution to
improve yeast phenotypes. ACS Synthc Bio 2015;4:1101–11.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 1. Screening of industrial S. cerevisiae by TALENs-assisted multiplex editing
(TAME) for improving stress tolerance. (A) Diagram of TAME for improvement of
industrial yeast stress tolerance. (B) Screening of the mutant strains for improved
osmotolerance at 40ºC using YP media with 400 g L-1 glucose. The cell growth of the parent
strain ScY01 reached an OD600 of 1.13. (C) Screening of the mutant strains for improved
thermotolerance at 42ºC using YP media with 200 g L-1 glucose. The cell growth of the
parent strain ScY01 reached an OD600 of 0.75. The relative cell growths in (B) and (C) were
calculated in contrast to the parent strain ScY01 at the certain stress condition. The red
lines in (B) and (C) represent the same cell growth to the parent strain ScY01 at the same
test conditions.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 2. Physiological characterization of industrial S. cerevisiae mutants with improved
stress tolerance. (A) Characterization of osmotolerant industrial S. cerevisiae mutants.
Fermentations of the osmotolerant strain ScY001T and parent strain ScY01 were
performed at 40ºC using YP media with 400 g L-1 glucose. (B) Characterization of
thermotolerant industrial S. cerevisiae mutants. Fermentations of the thermotolerant
strain ScY033T and parent strain ScY01 were performed at 42ºC using YP media with 200 g
L-1 glucose. Initial OD600 of 0.5 was used for all the fermentations. Data represent the mean
and standard error of duplicate cultures at each condition.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 3. Physiological characterization of the osmotolerant strain ScY001T and the
thermotolerant strain ScY033T at other stress conditions. (A) Fermentation profiles of the
osmotolerant strain ScY001T and parent strain ScY01 at thermal stress condition of 42ºC
using YP media with 200 g L-1 glucose. (B) Fermentation profiles of the thermotolerant
strain ScY033T and parent strain ScY01 at hyperosmotic condition at 40ºC using YP media
with 400 g L-1 glucose. Initial OD600 of 0.5 was used for all the fermentations. Data
represent the mean and standard error of duplicate cultures at each condition.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 4. The physiological response of the osmotolerant strain ScY001T and the
thermotolerant strain ScY033T to heat shock treatment. (A) Spot assay of cells before heat
shock treatment. (B) Spot assay of cells after heat shock treatment. Strains ScY001T,
ScY033T and ScY01 were grown in biological duplicates to early-log phase in YP medium
containing 20 g L-1 glucose. Cells were harvested and resuspended to 5.0 OD600. One
aliquot of the 5.0 OD600 cell suspension without heat shock treatment and the other
aliquot after treated at 50°C for 30 min were serially diluted to the OD600 indicated and
spotted on YPD plates after. The plates were incubated for 2 days at 30°C and imaged.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 5. Enriched Gene Ontology (GO) terms of genes influenced by genic
nonsynonymous (A) and intergenic (B) variants in mutant strains ScY001T (blue line) and
ScY033T (red line). The affected genes of detected genic non-synonymous and intergenic
variants (SNPs and InDels) in comparing ScY001T with ScY01 as well as ScY03T with ScY01
were analysed for enrichment in Gene Ontology (GO) terms using DAVID Bioinformatics
Resources 6.8 (Ashburner et al., 2000, Huang da et al., 2009). The percentage associated
with each GO terms including GO Biological Process (BP), GO Cellular Component (CC), GO
Molecular Function (MF) was calculated as the percentage of genes involved in the
corresponding GO terms among the pool of genes that were influenced by genic
nonsynonymous or intergenic variants.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 6. Copy number variation (CNV) between ScY001T and ScY01 in nuclear and
mitochondrial genomes. (A) A log2 ratio plot for copy number variation in mitochondrial
genome generated by CNV-seq. The red and blue colored plots represent amplification-
type and deletion-type CNVs, respectively. The red and blue color gradients represent the
p-value calculated on each of the ratios where an increase in brightness shows a decrease
in p-value. (B) Log2 ratio distribution for CNVs on nuclear genome (left) and mitochondrial
genome (right).
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 7. Copy number variation (CNV) between ScY033T and ScY01 in nuclear and
mitochondrial genomes. (A) A log2 ratio plot for copy number variation in mitochondrial
genome generated by CNV-seq. The red and blue colored plots represent amplification-
type and deletion-type CNVs, respectively. The red and blue color gradients represent the
p-value calculated on each of the ratios where an increase in brightness shows a decrease
in p-value. (B) Log2 ratio distribution for CNVs on nuclear genome (left) and mitochondrial
genome (right).
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Figure 8. Scanning electronic microscope images (A) and percentage of PI-stained cells (B)
of the stress-tolerant (ScY001T and ScY033T) and parent (ScY01) strains at different
conditions. Hyperosmotic stress condition was performed using 400 g L-1 glucose at 40°C,
and cells were cultured for 48 h. Thermal stress condition was conducted at 42°C using 200
g L-1 glucose, and cells were cultured for 36 h. As controls, cells were correspondingly
cultured at normal condition using 200 g L-1 glucose at 30°C for 48 h or 36 h. The
percentage of PI-stained cells was analyzed and calculated by flow cytometer. Data
represent the mean and standard error of duplicate cultures at each condition.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Table 1 Plasmids and S. cerevisiae strains used in this study
Plasmids or strains Description Reference or
source
Plasmids
pYES2/CT-GC 2μ plasmid, autotrophic URA3 gene Zhang et al., 2015
p313-GAL-TA CEN plasmid, autotrophic HIS3 gene Zhang et al., 2015
pYES2/CT-GGGCGG-GAL1-ZeoR 2μ plasmid, ZeoR used for genome editing This study
pRS313-TATAAA-GAL1-KanMX4 CEN plasmid, KanMX4, used for genome editing This study
Strains
ScY01 Evolved thermotolerant strain, diploid Shui et al., 2015
ScY001T Osmotolerant strain, diploid This study
ScY033T Thermotolerant strain, diploid This study
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Table 2 Primers used in this study
Name Sequence (5' → 3') Application
pYES2-F ATCCACATGTGTTTTTAGTA Amplifying the linear vector of pYES2/CT-GC without URA3 expression cassette pYES2-R ATCTTGACTGATTTTTCCAT
Zeocin-F AAAATCAGTCAAGATCATATGCCCACACACCATAG Amplifying the ZeoR expression cassette
Zeocin-R AAAACACATGTGGATGATATCAGCTTGCAAATTAA
pRS313-F CCGGGCACGGATTAGAAGCC Amplifying the linear vector of p313-GAL-TA without HIS3 expression cassette pRS313-R GGGATCCACTAGTTCTAGAG
KanMX4-F GAACTAGTGGATCCCCCCGGGCGTACGCTGCAGGT Amplifying the KanMX expression cassette
KanMX4-R CTAATCCGTGCCCGGCGGCCGATCGATGAATTCGA
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018
Table 3 Results of the variant calling and analysis.
Variants (SNPs & InDels) Count
ScY001T vs. ScY01 ScY033T vs. ScY01
General statistics
Total number (vs. S288c) 69487 & 7010 69529 & 6991
Background variants 67782 & 6496 67811 & 6493
Mutant variants 1705 & 514 1718 & 498
Location of mutant variants
Intergenic variants 812 & 410 838 & 387
Coding region variants 861 & 94 846 & 102
Unknown 32 & 10 34 & 9
Effect of coding region variants
Synonymous effects 480 & 0 466 & 0
Non-synonymous effects 381 & 94 380 & 102
Genes with non-synonymous effects 177 & 48 a 178 & 49
b
Genes with intergenic variants 380 & 485 c 401 & 474
d
aThe total number of genes with non-synonymous SNPs or/and InDels in ScY001T vs. ScY01 is 200.
bThe total
number of genes with non-synonymous SNPs or/and InDels in ScY033T vs. ScY01 is 205. cThe total number of genes
with intergenic SNPs or/and InDels in ScY001T vs. ScY01 is 709. d
The total number of genes with intergenic SNPs
or/and InDels in ScY033T vs. ScY01 is 707.
Downloaded from https://academic.oup.com/femsyr/advance-article-abstract/doi/10.1093/femsyr/foy045/4975274by Chalmers University of Technology / The Library useron 18 April 2018