Post on 03-Jan-2016
description
Jingfu wang
The role of WT1 gene in neuroblastoma
Department of Pediatric OncologyKey Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin Medical University Cancer Institute and Hospital
The recurrence of neuroblastoma due to minimal residual disease (MRD) is often seen.
Immunotherapy is an attractive therapeutic option for controlling MRD.
Wilms tumor gene (WT1) was firstly identified as a suppressor involved in the
development of Wilms tumor. However, oncogenic properties of WT1 were recently
observed in various hematological and solid malignancies.
Over the past years, the immunotherapy using peptide vaccines against WT1 in adults
with leukemia and various solid cancers was promising.
To determine whether WT1 vaccines are applicable for neuroblastoma, firstly, we must
understand the exact function of WT1 in neuroblastoma. So the aim of this study was to
probe it.
Background/purpose
WT1 mRNA expression in the tumor tissue of 22 neuroblastomas (NBs), 5
ganglioneuromas (GNs) and 4 NB cell lines: conventional and real-time RT-
PCR.
WT1 protein expression in 20 NBs and 5 GNs: immunohistochemistry.
Effect of WT1 gene knockdown on NB cell (NB19 and NB69) proliferation:
siRNA against WT1; WST-1 assay.
Materials and methods
Table 1 Sequence of primers and probes in conventional and real time PCR
Types of PCR Primer and probe Sequence (5'-3' orientation)
Conventional PCR
WT1-F GGCATCTGAGACCAGTGAGAA
WT1-R GAGAGTCAGACTTGAAAGCAGT
GAPDH-F TGAAAGTGCTGTCTCCATGC
GAPDH-R ACCTTTGGTGAGACCTGTGG
Real time PCR WT1-F GATAACCACACAACGCCCATC
WT1-R CACACGTCGCACATCCTGAAT
WT1-P FAM-ACACCGTGCGTGTGTATTCTGTATTGG-TAMRA
β-actin-F CCCAGCACAATGAAGATCAAGATCAT
β-actin-R ATCTGCTGGAAGGTGGACAGCGA
β-actin-P FAM-TGAGCGCAAGTACTCCGTGTGGATCGGCG-TAMRA
F: forward; R: reverse; P: probe.
Materials and methods (continue)
Patient Pathology WT1 mRNA level
1 GN 7.61×10-3
2 GN 2.60×10-3
3 GN 2.30×10-3
4 GN 2.70×10-4
5 GN 1.70×10-3
6 NB 3.49×10-3
7 NB 2.45×10-3
8 NB 3.98×10-3
9 NB 8.40×10-6
10 NB 4.90×10-3
11 NB 3.40×10-4
12 NB 1.10×10-5
13 NB 2.10×10-4
14 NB 2.30×10-3
15 NB 1.30×10-3
16 NB 5.10×10-5
17 NB 7.10×10-5
18 NB 3.40×10-5
19 NB 4.30×10-3
20 NB 1.10×10-4
21 NB 4.10×10-4
22 NB 2.30×10-3
23 NB 1.45×10-3
24 NB 2.30×10-2
25 NB 4.30×10-5
26 NB 2.70×10-3
27 NB 1.00×10-4
Comparison between neuroblastoma and ganglioneuroma
Mann-Whitney Test
p=0.261
There was no difference between neuroblastoma and ganglioneuroma
Correlation of WT1 mRNA levels and histological grade
0.00E+00
5.00E-03
1.00E-02
1.50E-02
2.00E-02
2.50E-02
GN NB
WT1 mRNA expression in NBs and GNs
Comparison among Stage , , and in neuroblastomaⅠ Ⅱ Ⅲ Ⅳ
Correlation of WT1 mRNA levels and clinical stagePatient Pathology Stage WT1 mRNA level
1 NB Ⅰ 3.49×10-3
2 NB Ⅰ 2.45×10-3
3 NB Ⅰ 3.98×10-3
4 NB Ⅰ 8.40×10-6
5 NB Ⅰ 4.90×10-3
6 NB Ⅰ 3.40×10-4
7 NB Ⅱ 1.10×10-5
8 NB Ⅱ 2.10×10-4
9 NB Ⅱ 2.30×10-3
10 NB Ⅱ 1.30×10-3
11 NB Ⅱ 5.10×10-5
12 NB Ⅲ 7.10×10-5
13 NB Ⅲ 3.40×10-5
14 NB Ⅲ 4.30×10-3
15 NB Ⅲ 1.10×10-4
16 NB Ⅲ 4.10×10-4
17 NB Ⅲ 2.30×10-3
18 NB Ⅳ 1.45×10-3
19 NB Ⅳ 2.30×10-2
20 NB Ⅳ 4.30×10-5
21 NB Ⅳ 2.70×10-3
Kruskal-Wallis Test
P=0.412
There was no difference among stage groups
0.00E+00
5.00E-03
1.00E-02
1.50E-02
2.00E-02
2.50E-02
Ⅰ Ⅱ Ⅲ Ⅳ
WT1 mRNA expression in NBs and GNs (continue)
Correlation of WT1 mRNA levels and prognosis
Log-Rank test: p=0.193
Patients Pathology WT1/actin Status survival time (months)
1 NB 8.40×10-6 alive 240.5
2 NB 1.10×10-5 alive 225.5
3 NB 3.40×10-5 alive 241
4 NB 4.30×10-5 alive 160
5 NB 5.10×10-5 alive 96
6 NB 7.10×10-5 dead 216
7 NB 1.00×10-4 alive 163
8 NB 1.10×10-4 alive 232
9 NB 2.10×10-4 alive 222
10 NB 3.40×10-4 alive 165
11 NB 4.10×10-4 alive 217.5
12 NB 1.30×10-3 alive 111
13 NB 1.45×10-3 dead 9.5
14 NB 2.30×10-3 alive 155
15 NB 2.30×10-3 dead 10
16 NB 2.45×10-3 alive 31
17 NB 2.70×10-3 dead 4
18 NB 3.49×10-3 alive 38
19 NB 3.98×10-3 alive 28
20 NB 4.30×10-3 alive 235
21 NB 4.90×10-3 alive 226
22 NB 2.30×10-2 alive 236
The WT1 mRNA expression levels did not affect the prognosis
Median: 8.55×10-4
WT1 mRNA expression in NBs and GNs (continue)
WT1 mRNA expression in neuroblastic cell lines
The highest expression appeared in NB69 without MYCN amplification (relatively low malignancy)
The levels of WT1 mRNA expression were not correlated with
histological grade, clinical stage and prognosis.
Among the four neuroblastic cells, NB69 with relatively low
malignancy exhibited the highest WT1 mRNA expression.
Summary1
WT1 does not play a significant role in the oncogenicity of
neuroblastoma.
WT1 proteins were more strongly expressed in mature ganglion cells than neuroblastic cells
Neuroblastic cells Ganglion cells
WT1 protein expression in NBs and GNs
Expression of WT1 protein in NBs and GNs (immunohistochemistry)
Tumor types
Polyclonal (C-19) Monoclonal (6F-H2)
No. of positive cases Ratio (%) No. of positive cases Ratio (%)
Neuroblastoma 2/20 10* 6/20 30**
Ganglioneuroma 5/5 100* 5/5 100**
Fisher's Exact Probability Test: *p=0.000; ** p=0.009. NB: neuroblastoma; GN: ganglioneuroma.
The positive rate was significantly higher in GNs than in NBs
WT1 protein expression in NBs and GNs (continue)
Higher WT1 protein expression in ganglion cells and higher positive rate
in GNs provides a clue that WT1 protein may be a candidate factor
inducing primitive neuroblastic cells to differentiate into mature ganglion
cell.
Summary2
A and B, Conventional RT-PCR (A) and real-time RT-PCR (B) revealed that WT1 gene was obviously knocked down in NB19 and NB69 cells.
C and D, There was no significant change on cell proliferation of NB19 between negative control and WT1 siRNA group (* p=0.937). However, silencing of WT1 gene prompted cell
growth in NB69 cell which possessed the highest WT1 mRNA expression (** p=0.001).
Effect of WT1 gene knockdown on NB cell (NB19 and NB69) proliferation
The silence of WT1 gene promoting cell growth in NB69 cells notes that
WT1 may be a factor inhibiting neuroblastic cells growth.
Summary3
WT1 may be related to cell differentiation and suppression of cell
proliferation in NB.
WT1 gene does not act as an oncogene, but participates in the
maturation of NB.
In conclusion
How to understand our findings contrast to that in adults
The adult cancers with high WT1 expression are generally derived from epithelial cells. These tumors will undergo an epithelial-mesenchymal transition (EMT), and this is often related to a worse prognosis.
In contrast, neuroblastoma is derived from primitive mesenchymal cells and WT1 normally plays a role of mesenchymal-epithelial transition (MET). The effect of forcing the cells towards an epithelial state is linked to a favorable prognosis.
Epithelial cells Mesenchymal cells
A common role of WT1:
regulating the mesenchymal-epithelial balance