Post on 26-Jun-2020
1
Is it genetic?
2
BIOLOGY 321 GENETICS MWF 8:30-9:50 am in BI 212
Dr. Carol Trent trent@biol.wwu.edu Office Hours: Mon & Wed 10-11:30am If you need to see me outside of office hours, please contact me via email to set up a specific appointment time.
3
• This class meets three days a week for 80
minutes. • We will not have a formal break during
the 80 minute session – so much genetics so little time……
• Typically, 60 minutes a week will be set aside for an informal discussion of the lecture material and the problem sets.
• These informal sessions may consist of one 60 minute session or 2 or 3 shorter sessions.
4
LECTURE DATE COURSE TOPICS
The lecture schedule may change without prior notice Week 1 Jan 6 & 8
Introduction to Genetics Mendel & model organisms Mendel & Probability
Week 2 Jan 11, 13 & 15
Meiosis & Sex-linkage Start pedigrees Fri Jan 15: QUIZ 1 (20 pts. 20 min.)
Week 3 Jan 20 & 22 HOLIDAY: Jan 18
Independent Study on Pedigree analysis: come to class on 1/20 prepared to analyze pedigrees Pedigrees and probability Start complications to Mendelian analysis Fri Jan 22: QUIZ 2 (20 pts. 20 min.)
Week 4 Jan 25, 27 & 29
Factors affecting the expression of a genetic trait Norm of reaction Complementation and other gene interactions Fri Jan 29: QUIZ 3 (20 pts. 20 min.)
Week 5 Feb 1, 3 &5
Gene interactions continued Multifactorial inheritance and complex traits
Week 6 Feb 8, 10 & 12
Horizontal Gene Transfer in Bacteria Fri Feb 12: EXAM 1 (80 pts. 80 min.)
Week 7 Feb 17, & 19 HOLIDAY: Feb 15
Independent Study/Review of Basic Molecular Biology : come to class on 2/17 prepared to discuss DNA structure, replication & transcription DNA structure and the molecular basis of mutation Mutagens & Effects of mutations on gene function Fri Feb 19: QUIZ 3 (40 pts. 40 min. )
Week 8 Feb 22, 24 & 26
Direct detection of mutation & PCR DNA fingerprinting and genetic variability Allele frequencies, Hardy Weinberg and DNA fingerprinting
Week 9 March 1, 3 & 5
Genetic linkage and recombination The generation of a genetic map & positional cloning Fri Mar 5: QUIZ 4 (40 pts. 40 min. )
Week 10 March 8, 10 & 12
Special topics such as: Cancer Genetics; Polymorphisms that confer resistance to HIV/AIDS; GM foods; Gene therapy
Finals Week Final Exam 80 pts on Thursday March 18 10:30-12:30pm
5
COURSE WEB SITE
http://fire.biol.wwu.edu/trent/trent/Biol321index.html
Lecture Materials are available on the 321 web site
BUT, they are absolutely not a substitute forcoming to class or
reading the textbook
See cautionary comments on web page
6
REQUIRED TEXT: The 9th edition of Introduction to Genetic Analysis by Anthony Griffiths et al. Earlier editions of this text are OK, but it is the student’s responsibility to check a copy* of the 9th edition to figure out reading and problem assignment equivalents *One copy of the text is on reserve in Wilson Library
7
READING ASSIGNMENTS AND PROBLEM SETS: • Each week or so you will receive a reading and
problem set assignment. • After reading through the assigned material, work
through the assigned problems at the end of the chapter and the additional problem set handed out in class.
• The answers to the problems will be available online at the Biology 321 web site. Try writing out the answers yourself before checking the posted answers.
• Make sure that you understand the genetic principles underlying the answers.
• We will review some of the assigned problems in the informal discussion sessions.
THESE ARE STUDY PROBLEMS TO PREPARE YOU FOR QUIZZES AND EXAMS. YOU ARE NOT TO HAND IN THE ANSWERS.
8
EVALUATION Mid term and Final Exams: 2 @ 80 pts. ….............. 160 Quizzes: 3 @ 20 pts and 2 @ 40 pts. ………………140 Total Points: 300 Grading Correction = 6 pts (see explanation below) REQUESTS FOR REGRADES • Requests for regrades of exam and quiz questions
must be in writing and must be submitted within one week of the return date of the graded exam/quiz.
• Inquiries or concerns about arithmetic errors in point totals or obvious mis-marks (ie on multiple choice questions, etc.) do not require a written request for correction.
• See also info on automatic grading correction
9
AUTOMATIC GRADING CORRECTION At the end of the quarter, 6 points will be automatically added to to your point total to correct for grading inaccuracies. You will forfeit all of these 6 points if you request written quiz or exam regrades during the quarter. NOTE: Inquiries or concerns about arithmetic errors in point totals or obvious mis-marks will NOT result in forfeiture of the correction points.
ACADEMIC HONESTY POLICY AND PROCEDURE See Appendix D of the 2009-2010 General Catalog http://www.wwu.edu/wwu_catalog/index.shtml
10
! ! !
No points are allocated specifically for
class participation.
! ! !
BUT: if you have a borderline grade at the end of the quarter, and you attended lectures consistently, were an active class participant and your performance on quizzes and exams has steadily improved, I will “bump” you up to the higher grade.
11
Goal of this course to stuff your brain with genetical knowledge
12
Okay, so here are the real
Goals of this course (i) To develop your analytical skills via problem solving and data analysis (ii) To introduce you to the science underlying modern genetics (you will learn some facts…) (ii) To help you become sophisticated and critical consumers of scientific information in general and genetic information in specific.
13
Goal One: To develop your analytical skills via problem solving and data analysis
Over the course of the quarter you will receive several reading and problem assignments • the problem assignments will be a combination of textbook
problems and problems from old quizzes and exams • we will work through some problems during lecture and during the
informal “discussion” sessions • these informal sessions will be most useful if come prepared to tell
me what you are having problems with • so, ideally, before you come to the discussion, you have will have
reviewed the lecture material and worked (or at least tried to work) most of the assigned problems -- so you know where the trouble spots are.
• BEFORE EACH LECTURE: take time to review lecture notes and figure out which material has gelled and makes sense and which material is not falling into place
14
Review Assignment Set 1 http://fire.biol.wwu.edu/trent/trent/assignmentset1.pdf
15
Goal Two: To introduce you to the science underlying modern genetics (you will learn some facts…) Themes: • transmission genetics • molecular genetics • genomics • special topics
16
Transmission Genetics: the transfer of genetic information from generation to generation of a cell or individual Includes: • Chromosome mechanics including mitosis,
meiosis, linkage and crossing-over • Mendelian genetics (simple and complex
traits) Phenotypes representing simple (pigmented versus non-pigmented) and complex (more versus less pigment) traits are illustrated in this picture sent by a former Western biology major
17
Is it genetic?
The complex relationship between genotype and phenotype To what extent are variations in behavior within a group of individuals due to variations in genotype? In other words to what extent is our behavior “determined” by our genes? Do we have any clues to the answer to this question?
18
Molecular genetics • molecular definition of the gene • the molecular basis of information storage
and expression of genetic information • the molecular basis of mutation >gi|17488858|ref|XM_010627.4| Homo sapiens SRY (sex determining region Y)-box 13 (SOX13) GGCATGTGAGCGGGAAGCCTAGGCTGCCAGCCGCGAGGACCGCACGGAGGAGGAGCAGGAGCGCGGAGCCGCGAGCCCCGAGCCCCGAGCCCGGCGCCTGGCTGAGTAGATGTCCATGAGGAGCCCCATCTCTGCCCAGCTGGCCCTGGATGGCGTTGGCACCATGGTGAACTGCACCATCAAGTCAGAGGAGAAGAAAGAGCCTTGCCACGAGGCCCCCCAGGGCTCAGCCACTGCCGCTGAACCTCAGCCTGGAGACCCAGCCCGGGCCTCCCAGGATAGTGCTGACCCCCAAGCTCCAGCCCAGGGGAATTTCAGGGGCTCCTGGGACTGTAGCTCTCCAGAGGGTAATGGGTCCCCAGAACCCAAGAGACCAGGAGTGTCGGAGGCTGCCTCTGGAAGCCAGGAGAAGCTGGACTTCAACCGAAATTTGAAAGAAGTGGTGCCAGCCATAGAGAAGCTGTTGTCCAGTGACTGGAAGGAGAGGTTTCTAGGAAGGAACTCTATGGAAGCCAAAGATGTCAAAGGGACCAAGAGAGCCTAGCAGAGAAGGAGCTCCAGCTTCTGGTCATGATTCACCAGCTGTCCACCCTGCGGGACCAGCTCCTGACAGCCCACTCGGAGCAGAAGAACATGGCTGCCATGCTGTTTGAGAAGCAGCAGCAGCAGATGGAGCTTGCCCGGCAGCAGCAGGAGCAGATTGCAAAGCAGCAGCAGCAGCTGATTCAGCAGCAGCATAAGATCAACCTCCTTCAGCAGCAGATCCAGCAGGTTAACATGCCTTATGTCATGATCCCAGCCTTCCCCCCAAGCCACCAACCTCTGCCTGTCACCCCTGACTCCCAGCTGGCCTTACCCATTCAGCCCATTCCCTGCAAACCAGTGGAGTATCCGCTGCAGCTGCTGCACAGCCCCCCTGCCCCAGTGGTGAAGAGGCCTGGGGCCATGGCCACCCACCACCCCCTGCAGGAGCCCTCCCAGCCCCTGAACCTCACAGCCAAGCCCAAGGCCCCCGAGCTGCCCAACACCTCCAGCTCCCCAAGCCTGAAGATGAGCAGCTGTGTGCCCCGCCCCCCCAGCCATGGAGGCCCCACGCGGGACCTGCAGTCCAGC T ………….. {SO WHAT?}
19
Biologist live in privileged times: in the past several years, the complete genome sequences of representatives from all the major groups of organisms on earth have been determined and more genome sequences are being completed at a rapid rate Genomics • a genome is the entire complement of
genetic information in a set of chromosomes
• genomics is the molecular characterization of entire genomes including the complete sequence of DNA of each chromosome and all of the encoded proteins
20
• The DNA sequence of our genome and that of
the chimpanzee differ by only a few %: • Which of these genetic differences between the
two genomes make us human?
21
Goal three : To help you become sophisticated and critical consumers of scientific information in general and genetic information in specific. Required Readings Assignments (distributed in class and also available on the course web site) Zebrafish researchers hook gene for human skin color Science 310: 1754 Dec. 16, 2005
Model organism and an animal from your aquarium: the zebrafish Brachydanio rerio
22
Zebrafish researchers hook gene for human skin color Science 310: 1754 Dec. 16, 2005 http://fire.biol.wwu.edu/trent/trent/zebrafishskincolor.pdf This article reflects important themes that we will explore in this course: • The value of studying model organisms • The molecular basis of allelic variation and how it affects
phenotype • In complex traits, allelic variation in more than one gene
underlies phenotypic variation • Allele frequencies vary with the population under
consideration • The genetic control of many traits is not yet fully
understood • The complicated & confusing business of gene names.
Genes are often named for the phenotype produced by a mutation in the gene: the golden mutation in zebrafish defined the golden gene; the equivalent gene in humans, though, was named for the protein it specifies: SLC24A5 = solute carrier family 24, member 5.