Post on 25-May-2020
UNIVERSITV OF HAWAI'I LIBRARY
Investigating the Regulation of Fatty Acid Degradation in Pseudomonas aeruginosa
A THESIS SUBMITTED TO THE GRADUATE DMSION OF THE UNIVERSITY OF HAW AI'I IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
IN
MICROBIOLOGY
AUGUST 2006
By
David Tran Nguyen
Thesis Committee: Tung T. Hoang, Chairperson
Dulal Borthakur Paul Patek
We certify that we have read this thesis and that, in our opinion, it is satisfactory in scope
and quality as a thesis for the degree of Master of Science in Microbiology.
THESIS COMMITTEE
Chairperson
~~
ii
Abstract
Although well established in Escherichia coli, the regulatory mechanisms
involved in controlling fatty acid metabolism in Pseudomonas aeruginosa are poorly
understood. Fatty acid metabolism consists of anabolic and catabolic pathways that play
several critical roles. Fatty acid degradative processes in P. aeruginosa have been shown
to play an important clinical role, contributing to the degradation of lung surfactant
component phosphatidylchoJine, whereas fatty acid biosynthetic processes contribute to
the synthesis of acyl homoserine lactones (AHLs) quorum sensing molecules involved in
virulence response and expression.
Experiments were conducted to investigate regulatory mer.hanisms and the
regulation of fatty acid degradation in P. aeruginosa. Using transcriptional fusions, the
regulation of fatty acid biosynthesis and degradation were studied and approaches were
utilized to identify the probable transcriptional regulators. The regulatory potential of
these probable transcriptional regulators were then assessed through gene-fusion and
DNA-binding studies.
During the course of this work, a genetic tool was developed, which may
contribute to future work on the regulatory processes in P. aeruginosa. The development
of this tool and its potential applications are included in this thesis.
iii
Acknowledgements
I would like to thank Dr. Hoang for providing me with the opportunity to study in
Hawai'i and introducing me to the world of science and research. Thank you for pushing
me to my limits and challenging me, mentally, physically and emotionally. I leave not
only having gained knowledge in the field of science but also having learned a lot about
life and myself in general. You have prepared me for what lies ahead and have provided
me with the drive to take on any challenges I may encounter in the future, for that I am
thankful.
Thank you to Drs. Patek and Borthakur for taking the time to serve on my
committee, for their support and insights during my studies. I would also like to thank Dr.
Michael Schurr for providing me with the microarray data and thus the foundation for
studying the regulation of fatty acid metabolism. Thank you to Dr. Sung-Eun Lee for his
help with liquid-cbromatography-mass-spectroscopy and for taking time to help me with
my studies.
I would like to thank my labmates both former and current for their infinite
patience and understanding. I would like to thank Xiaojun (Steven) Lu, Yun Kang, and
Alton Wong for their support, encouragement and help in the lab. Thank for making me
laugh and smile when I needed it the most. I would especially like to thank Mike Son
who has been more than just a labmate and friend but also a brother. Thank you, not just
for your help with the microarray analyses or the growth curves but also for being a role
model and someone I can really look up to. I will always be grateful for all those times
you looked out for me and helped me when I was down. Things would have definitely
been a lot tougher had it not been for your companionship, thank you Mike.
iv
I would also like to thank my God-sister, chi Khanh for welcoming me into her
home and into her family when mine was thousands of miles away. Thank you for
making me feel "at home" away from home, which is the greatest gift I can ever ask for.
You have truly been my "oxygen tank." I am eternally grateful for what you have done
for me and will never forget your kindness and your generosity.
Thank you to my parents, Lan Tran and Dinh Nguyen, for your unconditional
love and support. I am grateful and will always be, for the all the opportunities that you
have given me in life. You have always been there for me, given me strength when I am
weak, cure me when I am ill and pick me up when I fall, I cannot thank you enough for
all that you have done. I love you mom and dad.
Last but certainly not least, I would like to thank my brother and sisters,
and all my friends back home for their encouragement and support. I would like to
particularly thank my sister, chi Van, for giving me the strength to carry on all those
times when things felt hopeless and for patiently listening to all my problems. Thank you
for looking out for me even though you are an ocean away and for the being the best
sister a little brother can ask for.
v
Dedication
This work
is dedicated to my
parents
Lan Tran and Dinh Nguyen
and to my
brother and sisters
anh Viet, chi Van
and
chi Anna
vi
Table of Contents
Approval Page ..................................................................................... ii
Abstract ............................................................................................. iii
Acknowledgements ............................................................................... .iv
Dedication .......................................................................................... vi
Table of Contents .................................................................................. vii
L· fF' .. 1st 0 19ures ...................................................................................... XII
List of Tables ....................................................................................... xvi
List of Abbreviations .............................................................................. xvii
Chapter One: Introduction......... ...... ...... ....... ..... ...... ... ........ ........•....•.•.• 1
1.1 Microbiology of Pseudomonas aeruginosa .. ............................................. 1
1.2 P. aeruginosa Infections and Virulence Factors .......................................... 1
1.3 P. aeruginosa and Cystic Fibrosis (CF) ................................................... 6
1.4 Fatty Acid Metabolism and Regulation ................................................... 9
1.5 Transcriptional Regulators......... .. .... .................. ......... ........................ 17
1.5.1 TetR-type Regulators ............................................................ 18
1.5.2 LysR-type Regulators ........................................................... 19
1.5.3 IclR-type Regulators ............................................................ 20
1.5.4 GntR-type Regulators ........................................................... 21
1.6 Specific Aims of Research .................................................................. 23
vii
Chapter Two: Materials and Methods ..............•.•...................................•.. 24
2.1 Media ........................................................................................... 24
2.2 Reagents ........................................................................................ 25
2.3 Bacterial Strains........................... ......... .......................................... 25
2.4 Bacterial Plasmids ............................................................................ 28
2.5 DNA Techniques.......................................................................... ... 30
2.5.1 Plasmid DNA Isolation ......................................................... 30
2.5.2 Isolation of P. aeruginosa Chromosomal DNA ............................. 30
2.5.3 Restriction Digests .............................................................. 31
2.5.4 Extraction of DNA from Agarose Gels ....................................... 31
2.5.5 Ligations .......................................................................... 31
2.5.6 Preparation of Competent Cells and Transformation ...................... 32
2.6 Polymerase Chain Reaction (PCR) Techniques ........................................... 32
2.6.1 PCR amplification ............................................................... 32
2.6.2 Oligonucleotides ................................................................ 33
2.7 Genetic Techniques ........................................................................... 34
2.7.1 Biparental Matings ............................................................... 34
2.7.2 Construction of Transcriptional Fusions in P. aeruginosa
and E. coli ........................ ................................................ 35
2.7.2.1 P. aeruginosa ............................................................ 35
2.7.2.2 E.coli.. ................................................................... 36
2.7.3 Gene Replacement ............................................................... 36
2.8 Transposon Mutagenesis ..................................................................... 38
viii
2.9 Construction of Expression Vectors ........................................................ 39
2.1 0 Electrophoresis Mobility Shift Assays (EMSA) ........................................ .40
2.10.1 Crude Extract Preparation ...................................................... 40
2.10.2 Expression and Purification ofORF PA3508 for
EMSA Studies ................................................................... 40
2.1 0.3 Streptavidin Magnetic Particle Purification ................................. .42
2.10.4 Ammonium Sulphate Precipitation ........................................... .43
2.10.5 Biotin-labelling ...•.............................................................. 43
2.1 0.6 Gel Shifts ......................................................................... 44
2.11 ~-Galactosidase Assays ..................................................................... 45
2.11.1 Inverse Regulation Studies... .................. .................. ............. 45
2.11.2 Monitoring the Regulation ofjadBA5 in iacZTranscriptionai
Fusion Strains .................................................................... 45
Chapter Three: Inverse Regulation of Fatty Acid Degradation and
Biosynthesis .................................................................... 47
3.1 Introduction ................................................................................... .47
3.2 Results .......................................................................................... 49
3.2.1 Construction ofP/adBs-lacZ, P/adE"iacZ and P/abA-lacZ
Transcriptional Fusions in P. aeruginosa .................................... 49
3.2.2 Analysis ofjad andjab Regulation Using Transcriptional
Fusion .............................................................................. 52
ix
Chapter Four: Bioinform.atic Approach ..............•...................................... 56
4.1 Introduction .................................................................................... 56
4.2 Results .......................................................................................... 57
4.2.1 Construction ofPAOl-attB:: PfadB5-1acZl4fadR::Gm
(PAl 627, PA4769, and PA5356) by Gene Replacement .................. 57
4.2.2 Characterizing PAOI-attB:: PfadB5-1acZlt.fadR::Gm
(pAI627, PA4769, and PA5356) by f3-Galactosidase Assays ............. 58
4.2.3 Construction OfPfadB.5"lacZTranscriptional Fusion in E. coli
(HPS I-A.aItB: :pCD13PSK -P fadB.5"lacZ) ..••.•......•.••••..••.•.•....•.••.•...• 63
4.2.4 Assessing the Regulatory Potential ofPA1627, PA4769,
and PAS356 by Expressing the Respective Gene Products
in the E. coli PfadBs-lacZ Transcriptional Fusion Strain ..................... 64
4.2.5 DNA Binding Studies ........................................................... 71
Chapter Five: Protein purification and EMSA .......................................... _. 78
5.1 Introduction .................................................................................... 78
5.2 Results .......................................................................................... 80
5.2.1 Analysis of Promoter Regions (PfadB5. PfadE. and PfabA) .••..••.•••.•••...... 80
5.2.2 Protein Purification Using Streptavidin Magnetic Particles ............... 80
5.2.3 DNA-binding Studies Using Consensus Sequence-Purified
Extract ............................................................................. 82
5.2.4 Identification of DNA-binding Protein by LC-MS .......................... 86
x
5.2.5 DNA-binding Studies Using E. coli Lysate .................................. 86
5.2.6 Assessing the Regulatory Potential ofPA1627, PA4769,
and PA5356 by Expressing the Respective Gene Products
in the E. coli PfadBS'iacZTranscriptional Fusion Strain ..................... 90
5.2.7 Ammonium Sulfate Precipitation ............................................. 93
Chapter Six: TransposoD Mutagenesis ...................................................... 96
6.1 Introduction .................................................................................... 96
6.2 Results .......................................................................................... 98
6.2.1 Transposon Mutagenesis and Insertion Sites ................................. 98
6.2.2 Characterizing PAOl-attB:: PfadB5-lacZl4fadR::Gm
(pA2601, PA3006, and PA3508) by ~actosidase Assays ............. 100
6.2.3 Assessing the Regulatory Potential of PA260 1 , PA3006,
and PA3508 by Expressing the Respective Gene Products
in the E. coli P fadB5-1acZ Transcriptional Fusion Strain ..................... 105
6.2.4 DNA-Binding Studies using E. coli Lysate (pUC18 and
PA2601, PA3006, and PA3508 derivatives) ................................. 108
6.2.5 A Closer Look at PA3508 ...................................................... 108
Chapter Seven: Dis<:DSsion .......•..••••••.•.•..•....•..••...•.....••••.•••........••.•.••••••. 121
Appendix I .....................................................................•................... 139
Referenees ....................................................................................... _.143
xi
List of Figures
Figure ~
1. PC structure and action of phospholipase and lipase ........................ 8
2. Fatty acid biosynthesis and degradative pathways .......................... 10
3. Model for FadR regulation ...................................................... 15
4. Schematic representation of mutant construction by
gene replacement... ........... .......... ......... .................. ... ......... 37
5. Mini-CTX2-mediated integration ofP/adB5"iacZ, P/adE"iacZ,
and p/abA-iacZ at the attB site of P. aeruginosa •.. .....•...••••.............. 51
6. PCR amplification ofP/adB5-iacZ, P/adE"iacZ, and P/abA-iacZ
in respective P. aeruginosa transcriptional fusion strains .................. 53
7. Inverse regulation studies in P. aeruginosa transcriptional
fusion strains ..................................................................... 54
8. PCR amplification from chromosomal DNA of
PA01-attB::P jwJJJ5"iacZ and mutant derivatives
(~AI627::GmR, ~A4769::GmR, and ~A5356::GmR) ................. 59
9. Schematic representation of gene replacement mutagenesis
strategy... . .. .. .. .. . .. . . . . .. . ..... . . . .. . .. . . .. . . . . ... . . .. .. .. ... .. .... . .. . . . . .. ... 60
10. Growth curves of P. aeruginosa transcriptional fusion strains
PAOl-attB::P/adBs-iacZ and mutant derivatives
(~AI627::GmR, ~A4769::GmR, and ~A5356::GmR) ................. 61
II. Transcriptional regulation of P/adB5-iacZ fusion in the
P. aeruginosa transcriptional fusion strain
xii
PAO l-attB:: PjadBj-lacZ and mutant derivatives
(M'AI627::GmR, M'A4769::GmR
, and M'A5356::GmR) ................ 62
12. PCR amplification ofPjadB~lacZ in respective E. coli
transcriptional fusion strains ................................................... 65
13. Growth curves of E. coli transcriptional fusion strains
expressing PA1627 or PA5356 strain ......................................... 67
14. Growth curves of E. coli transcriptional fusion strains
expressing PA4769 .............................................................. 68
15. Transcriptional regulation ofPjadBj-lacZ fusion in E. coli
transcriptional fusion expressing PA1627 or PA5356 ...................... 69
16. Transcriptional regulation ofPjadB~lacZ fusion in E. coli
transcriptional fusion strain expressing PA4769 ............................ 70
17. EMSA studies with pUC18-PA1627 lysate .................................. 72
18. EMSA studies with pUC18-PA4769 lysate .................................. 73
19. EMSA studies withpUCI8-PA5356 lysate .................................. 75
20. EMSA studies with pUCI8-PA5356lysate
(using PjadB5, PjabA and glpD as probes) ....................................... 77
21. Alignment of putative consensus sequences ................................. 79
22. Promoter region offadBA5,fadE, andfahAB ................................ 81
23. Schematic representation of streptavidin magnetic particle
protein purification strategy .................................................... 83
24. Streptavidin magnetic particle purified extract .............................. 84
25. EMSA studies with streptavidin magnetic particle-purified
xiii
extract ............................................................................. 85
26. EMSA studies with pUCI8-PA5525 lysate .................................. 88
27. EMSA studies with pUC 18-PA5525 lysate
(using PjadB5, PpM and glpD as probes) ....................................... 89
28. Growth curves of E. coli transcriptional fusion strains
expressing PA5525 .............................................................. 91
29. Transcriptional regulation of P jadBs-IacZ fusion in E. coli
transcriptional fusion strain expressing PA5525 ........................... 92
30. EMSA studies using ammonium sulfate precipitated extracts ............ 95
31. Schematic representation oftransposon mutagenesis
strategy. .. .. . .. . . ...... . . ... ... . .. .. . . . .. .. .... . . . .. .. . . . . .. . .... .. . .. .... .. . ..... 97
32. Transposon insertion sites grouped according to functional
class ................................................................................ 101
33. Growth curves of P. aeruginosa transcriptional fusion strains
PAOl-attB::PjadBs-1acZ and mutant derivatives
(M'A2601::Tn, M'AJ006::Tn, and M'AJ508::Tn) ........................ 103
34. Transcriptional regulation ofPjadBs-1acZ fusion in the
P. aeruginosa transcriptional fusion strain
PA01-attB:: PjadBS-1acZ and mutant derivatives
(M'A2601 ::Tn, M'AJ006::Tn, and M'AJ508::Tn) ........................ 104
35. Growth curves of E. coli transcriptional fusion strains
expressing PA2601, PAJ006 or PA3508 ..................................... 106
36. Transcriptional regulation of PjadBS-1acZ fusion in E. coli
xiv
transcriptional fusion expressing PA2601, PAJ006
or PAJ50S ........................................................................ 107
37. EMSA studies with pUC1S-PAJ006 and
pUC1S-PAJ50S lysates .......................................................... 109
3S. EMSA studies with pUC1S-PA2601Iysate .................................. 110
39. Organization of genes surrounding PA350S locus .......................... 112
40. EMSA studies with pUC lS-P AJ50S lysate (gradient)............... ...... 113
41. EMSA studies with pUC1S-PAJ50S lysate
(gradient using PjabA) ••••••••••• ••••••••••••••••••••••••••••••••••••••••••••••••• 115
42. Overexpression ofHiS(;-tagged PAJ50S in E. coli ........................... 116
43. Purification ofHis6-tagged PAJ50S .......................................... 117
44. EMSA studies with HiS(;-tagged PAJ50S with PjadBSand PjabA ............ 119
45. EMSA studies with HiS(;-tagged P AJ50S
(using PjabA and glpD as probes) .............................................. 120
46. Dyad symmetry element in PjadBs ••• •••••••••••••••••••••••••••••••••••••••••• 132
47. Schematic representation ofFRT-lacZ integration .......................... 140
xv
List of Tables
Table ~
1. Prokaryotic Regulator Families ................................................ 18
2. List of Bacterial Strains ......................................................... 26
3. List ofBacteria1 Plasmids ...................................................... 28
4. Oligonucleotides ................................................................. 33
5. Microarray Data:fab genes (LB vs. C16:01 C 18:1<\9) ••••••••••••••••••••••••••• 48
6. Microarray Data:fad genes (C16:01 C 18:1<\9 vs. LB) ............................ 48
7. Transposon Insertion Sites ..................................................... 99
xvi
ACP
ADP
AMP
Ap
ATP
bp
Cb
CbR
CF
CFTR
em
DDW
dNTP
DNA
DIT
EDTA
EMSA
FAS
g
Gm
GmR
h
List of Abbreviations
acyl carrier protein
adenosine diphosphate
adenosine monophosphate
ampicillin
adenosine triphosphate
base pair
carbenicillin
carbenicillin resistant/resistance
cystic fibrosis
cystic fibrosis transmembrane regulator
centimeter
deionized distilled water
deoxynucleoside triphosphate
deoxyribonucleic acid
dithiothreitol
ethylenediaminetetraacetic acid
electrophoretic mobility shift assay(s)
fatty acid synthase
gram
gentamycin
gentamycin resistant/resistance
hour
xvii
HTII
IPTG
kb
kDa
Km
I
LPS
LTTR
LB
M
MDRPA
mg
min
m1
mM
ng
OD
ORF
PC
PCR
pmol
PMSF
PIA
helix-turn-helix
isopropyl-~-D-thioga1actospyranoside
kilobase(s)
kiloda1ton
kanamycin
liter
lipopolysaccharide
LysR-type transcriptional regulator
Luria-Bertani
molar
multiple drug resistant Pseudomonas aeruginosa
milligram
minute
milliliter
millimolar
nanogram
optical density
open reading frame
phosphatidylcholine
polymerase chain reaction
picomole
phenyJmethylsulfonyl fluoride
Pseudomonas isolation agar
xviii
PMN polymorphonuclear leukocyte
RBS ribosomal binding site
RNAP RNA-polymerase
rpm revolution per minute
RT room temperature
s second
SDS sodium dodecyl sulfate
Sp streptomycin
Sue sucrose
SucR sucrose resistant/resistance
TAE tris-acetate-EDTA
TBE tris-borate-EDTA
Tc tetracycline
TdT tenninal deoxynucleotidyl transferase
Tn transposon
Tris-Hel tris-hydrochloride
)1 micro
)1g microgram
III microliter
U unit
UV ultraviolet
v volume
w weight
xix
X-Gal
°C
%
5-bromo-4-chloro-3-indoyl-f3-D-galactoside
degrees Celsius
percentage
xx
Chapter One: Introduction
1.1 Microbiology of Pseudomonas aeruginosa
Pseudomonas aeruginosa is a versatile Gram-negative bacterium that inhabits
many diverse environments such as soils, lakes, and mineral water and in association
with plants, but is also known to be an opportunistic pathogen of humans (36). Being an
opportunistic pathogen, P. aeruginosa is different from other human pathogens, given its
ability to colonize and cause disease in warm- and cold-blooded vertebrates, insects,
aquatic animals and plants (1,26, 102). P. aeruginosa is rod-shaped and ranges from 1 to
3 IJ.Ill in length and from 0.5 to 1 IJ.Ill in width (26, 9). The bacterium can be motile,
possessing one to three polar flagella (7, 19). The ability of P. aeruginosa to live in
diverse environments is partly due to its ability to inhabit in a range of temperatures,
capable of growing at temperatures from 5 to 42'C (19). A prominent characteristic of the
bacterium is its dimorphic lifestyle, existing as planktonic (individual free-swimming)
cells or as microcolonies (aggregation of cells) enclosed in an exopolysaccharide
protected biofilm (15, 16).
1.2 P. aeruginosa Infections and Virulence Factors
P. aeruginosa is a ubiquitous pathogen capable of infecting virtually all tissues in
the human body (75). The bacterium causes a wide range of infections from minor skin
infections to more serious and sometimes life-threatening complications (127). Among
those particularly at risk of P. aeruginosa infections are patients with severe burns, are
immunocompromised such as AIDS sufferers, are neutropenic due to chemotherapy, or
have cystic fibrosis (CF) (123, 132). Recently, P. aeruginosa has been determined to be
1
the leading cause of nosocomial infections and in many hospitals has become the most
common Gram-negative bacterial species associated with serious hospital-acquired
infections, particularly within intensive care units (85). The ability for P. aeruginosa to
cause such variety of human infections is related to three factors (127): i) it harbors an
arsenal of virulence factors, ii) it is resistant to a wide spectrum of antibiotics (56) and iii)
its nutritional versatility, making the bacterium extremely adaptive, which contributes to
its ability to colonize a variety of human tissues.
A variety of virulence factors contribute to the success of Pseudomonas infections.
The most prominent factors include biofilm formation, pili, flagella, lipopolysaccharide
(LPS), proteases, quorum sensing, exotoxin A and other enzymes secreted by the type III
secretion system (75). Pili and flagella are necessary for adhesion and colonization and
their importance as virulence factors is exemplified in burn wounds. Experiments
comparing infection of burn wounds by pilus- and flagella-deficient P. aeruginosa strains
clearly demonstrate that bacteria deficient in either of these structures have reduced
virulence, both in their ability to persist and disseminate (110). Their role as adhesins is
also evident in corneal infections. illcerative keratitis, a rapidly progressing inflammatory
response to bacterial corneal infection has been called the most destructive bacterial
disease of the human cornea (70). It has been demonstrated that both pili and flagella are
required for infection by binding to the host cell glycosphingolipid asialo-GMI (42). This
binding event is essential for epithelial cell invasion and cytoxicity that lead to corneal
infections (14).
Dissemination of P. aeruginosa is aided by the production of proteases (92).
Proteases generally serve to destroy physical barriers and to compromise host immune
2
effectors (75). Elastase, for instance, has been shown to degrade col1agen and non
col1agen host-protein, thus disrupting the integrity of the host basement membrane (2).
Studies have also demonstrated that elastase inhibits monocytes chemotaxis, which
adversely affect the early clearance of P. aeruginosa by phagocytosis, as wel1 as the
subsequent presentation of bacterial antigens to the host immune system (61).
Studies from Frank and col1eagues (129) have reported the presence of a type III
secretion system in P. aeruginosa that appears to playa significant role in virulence (111).
The type 111 secretion system delivers many important virulence factors such as ExoS,
ExoT and ExoU into mammalian cel1s. Pseudomonas also produces several other
exotoxin proteins that are thought to be major determinants of virulence (75). Exotoxin A,
for instance, has been extensively studied and determined to block protein synthesis
within targeted cel1s via ADP-ribosylation of protein elongation factor-2 (38, 83).
Administration of the purified toxin has been shown to result in rapid destruction of
corneal epithelial cel1s fol1owed by chemotaxis of polymorphonuclear leukocytes (PMNs)
to the site of infection and eventual corneal ulceration (57). Endotoxins are also
important virulence determinants. The production of LPS by P. aeruginosa plays a key
role in pathogenesis. LPS consists of a hydrophilic moiety consisting of the O-specific
chain (O-antigen) and the core oligosaccharide, covalently linked to a lipophilic moiety
(Lipid A) that anchors LPS to the outer membrane. Lipid A constitutes the endotoxic
portion of the LPS molecule (115), while the other components contribute to other
aspects of pathogenesis. The O-antigen of LPS-smooth strains are capable of resisting
complement-mediated phagocytosis, while LPS-rough strains evade host defenses owing
to the loss of a ligand that is important for host clearance (35).
3
P. aeruginosa controls the production of many of its extracellular virulence
factors by a mechanism that monitors bacterial cell density and allows communication
between bacteria by cell-to-cell signaling. Bacteria are capable of sensing their
environment, process information, and react appropriately through the phenomenon
called quorum-sensing. Central to this cell-to-cell signaling system is the lasR gene that
encodes a protein critical for the initiation of the quorum-sensing response, which is
responsible for virulence factor production and biofilm formation. Recently, a study on a
P. aeruginosa strain, with a disruption in the lasR regulatory gene was shown to be
incapable of disseminating to distal host sites from a colonized burn wound (108). The
large number of virulence factors and its ability to produce them in a coordinated, cell
density--dependent manner surely contribute to the success of P. aeruginosa as a
pathogen.
Due to the high intrinsic resistance of P. aeruginosa to antimicrobial agents,
effective antibiotic therapy has been problematic (107). This intrinsic resistance is
attributable to biofilm formation, low permeability of the outer membrane, the presence
of ~-lactamases (45) and multi drug efflux pumps (65). Biofilm formation significantly
increases resistance to antibiotics compared to what is normally observed in planktonic
cells. Studies have shown that when cells exist in a biofilm, they can become 1 0-1000
times more resistant to the effects of antimicrobial agents (101). Several mechanisms
contribute to this resistance including physical and chemical diffusion barriers, slow
growth of the biofilm due to nutrient limitation and induction of a general stress response
(77). The low permeability of the outer membrane is in part due to the highly charged
bacterial surface of P. aeruginosa, which is stabilized by divalent cations and is thought
4
to reduce the passage of hydrophobic antibiotics (95). Small hydrophilic antimicrobial
agents, such as ~-lactams may enter the bacteria via porin proteins but at low frequency,
compared to E. coli for instance, P. aeruginosa has only 1 to 5% the permeability for ~
lactams (43). Resistance to ~-lactams is additionally heightened by the presence of
periplasmic ~-lactamases (44). The presence of various efflux systems including mexAB
oprM (74), mexCD-oprJ (97) and mexEF-oprN (96), which are capable of exporting
structurally unrelated antibiotics, allow P. aeruginosa to be resistant to multiple drugs.
The emergence of multi-drug resistant P. aeruginosa (MDRPA) is currently becoming a
major concern in the hospital setting, as effective antimicrobial options are severely
limited. MDRP A are resistant to at least three drugs in the following classes: ~ -lactams,
carbapenems, aminoglycosides, and fluoroquinolones and the number of MDRPA
isolates have been increasing. The emergence of MDRPA isolates during therapy was
reported in 27-72% of patients with initially susceptible P. aeruginosa isolates (87).
The genus Pseudomonas is notable for the large number and variety of
compounds that can serve as carbon and energy sources and P. aeruginosa is no
exception. P. aeruginosa has the ability to metabolize various compounds for carbon and
energy sources including mannose, fructose, glucose, ribose, xylose, glycerol, acetate and
many C4 to Cs fatty acids utilizing the Entner-Douddoroff pathway, the pentose
phosphate pathway and the tricarboxylic acid cycle (13). In addition, P. aeruginosa can
grow at temperature ranging from 5-42"C (19). Considered by many to be an aerobic
organism, P. aeruginosa is also capable of growing anaerobically if certain substrates are
available, for example, nitrates or arginine. Genetic exchange, including transformation,
5
transduction, and conjugation, help P. aeruginosa adapt to changing conditions by
acquiring new genetic information (124).
1.3 P. aeruginosa and Cystic Fibrosis (CF)
P. aeruginosa is most prominently associated with causing significant morbidity
and mortality in cystic fibrosis (CF) patients. CF is an autosomal recessive disorder
resulting from mutation of the cyclic AMP (cAMP)-regulated chloride ion channel
protein known as the cystic fibrosis transmembrane conductance regulator (CFTR) (107).
The electrolyte imbalance that results causes dehydration within the lungs and the
production of a viscous mucous which significantly impairs mucociliary clearance
mechanisms, allowing persistant bacterial colonization (64). Although CF patients can
become infected with other microorganisms such as Burkholderia cepacia complex,
Staphylococcus aureus, Haemophilus injluenzae, and atypical mycobacteria, P.
aeruginosa predominates and more than 80% of CF patients over the age of 26 years are
colonized by P. aeruginosa (33). Recent evidence suggests that the CFTR protein, in
addition to its role in salt transport, may influence P. aeruginosa lung infection directly
through its role as an epithelial cell receptor (94). Mutations in CFTR are known to cause
under-sialylation of epithelial cell surface receptors, which increases P. aeruginosa
adherence to host tissue (27, 67). Cbronic infection with P. aeruginosa accounts most of
the pulmonary deterioration and mortality in CF patients, and P. aeruginosa is usually the
only pathogen recovered postmortem from the sputum and lung tissue (32).
The genome of P. aeruginosa contains 5570 genes (118), and analysis of the
annotated sequence reveals the presence of a substantial number of genes encoding
6
putative factors that may facilitate the colonization of different habitats (17, 118). Its rich
gene pool contributes to it ubiquitous nature and enables it to colonize multiple niches
and utilize a variety of compounds as energy sources (117). Although the factors that
enable P. aeruginosa to colonize different tissues are generally understood, the sources of
energy that are available to sustain P. aeruginosa in relatively nutrient-poor environments
such as the lung, in particular the lung of CF patients has not been addressed. How P.
aeruginosa is capable of reaching high cell density required for the expression of
virulence factors remains to be answered.
The working hypothesis is that pulmonary lung surfactant may provide this
necessary source of energy. Pulmonary lung surfactant is synthesized by alveolar type II
epithelial cells and is secreted into the alveolar lumen and into other parts of the lung.
Lung surfactant is essential for the proper functioning of the lung in several respects by i)
maintaining alveolar patency thus preventing small airway collapse (29), ii) promoting
mucociliary clearance (60, 82), iii) acting as part of the innate immune response and host
defense to prevent pulmonary infections (62, 79, 98), iv) possessing anti-inflammatory
properties (132) and v) scavenging oxygen-radicals and enhancing antioxidant activities
inside the cell (78). It consists of surfactant proteins but is composed primarily of lipids
of which phosphatidylcholine (PC) is the predominant component, making up -80% of
the complex mixture (4, 51). The action ofphospholipases and lipases on PC, which are
both a part of P. aeruginosa virulence arsenal (3, 126), liberate lipid components that can
potentially serve as sources of carbon in the lung. It has been demonstrated that P.
aeruginosa phospholipase C cleaves the amphipathic PC molecule (72), and although the
action of lipases on PC has not been investigated, a similar action can be inferred (Figure
7
Upases
1
Phospholipase C
Figure 1. Phosphatidylcholine (PC) structure showing cleavage sites of lipases and phospholipase C. Cleavage by lipases release glycerophosporylcholine and two fatty acids. Cleavage by phospholipase C liberates diacylglycerol and phosphorylcholine. R and R' represent the acyl fatty acid tails of PC.
8
1). The metabolism of PC offers a very rich nutrient source for P. aeruginosa allowing it
to sustain itself and multiply in the lung. It has been suggested that the action of these
enzymes on PC contribute significantly to the pathology associated with P. aeruginosa
related lung infections (72), thus the degradation of PC not only affords high cell-density
growth by liberating fatty acids as carbon and energy sources but also directly contributes
to disease.
1.4 Fatty Acid Metabolism and Regulation
Fatty acid metabolism is a fundamental component of the cellular metabolic
network and fatty acids are the essential building blocks for membrane phospholipid
formation (133). Fatty acids are synthesized for incorporation into phospholipid
membranes while exogenously supplied fatty acids can serve as carbon and energy
sources when coupled to the citric acid cycle via ~-oxidation (59). Most bacteria
synthesize fatty acids using a series of discrete proteins, each catalyzing one reaction in
the pathway (133). The bacterial system, also known as dissociated, type II fatty acid
synthase (F ASII), is a collection of individual enzymes encoded by separate genes.
Figure 2 outlines the major steps in the P. aeruginosa FASII (52). Much like in E. coli,
P. aeruginosa FASII is can be divided into two separate stages, composed ofan initiation
step followed by cycles of elongation. Acetyl-CoA carboxylase (AccABCD) catalyzes
the first committed reaction of fatty acid biosynthesis, forming malonyl-CoA from acetyl
CoA. The malonyl moiety from the malonyl-CoA product is then transferred to ACP
(acyl carrier protein) by malonyl-CoA:ACP transacylase (FabD). Fatty acid synthesis is
initiated by the Claisen condensation of malonyl-ACP with acetyl-CoA catalyzed by ~-
9
R - _0. R -
0C0A a~
Figure 2. Fatty acid biosynthesis and degradative pathways. (A) The fatty acid biosynthesis (Fab) pathway of P. aeruginosa (55) showing the biosyntheses of the two virulence controlling acylated-homoserine lactones (N-(butyryl)-L-homoserine lactone and N-(3-oxododecanoyl)-L-homoserine lactone). Although the complete fatty acid degradation (Fad) pathway(s) of P. aeruginosa have not yet been established, (B) shows the well known long-chain (~C12) Fad pathway of E. coli (12) and references therein; figure adapted from reference (12). Regulatory mechanisms of Fab and Fad by FadR from bacteria other than E. coli, including Pseudomonas, have not been characterized. In E. coli, FadR inversely regulates both Fab and Fad by up-regulating fab-genes and repressing fad-genes in rich media without long-chain fatty acid. However, in the presence of fatty acid (~C12),fab-genes are down-regulated and fad-genes are induced (23).
10
ketoacyl-ACP synthase III (FabH) to fonn acetoacetyl-ACP. Four enzymes then catalyze
each round of elongation. The ~keto group is reduced by the NADPH-dependent ~
ketoacyl-ACP reductase (FabG), and the resulting ~-hydroxyacyl-ACP is dehydrated by
the ~-hydroxyacyl-ACP dehydratase (FabA or FabZ) to enoyl-ACP. The final step in the
cycle is catalyzed by the NAD(p)H-dependent enoyl-ACP reductase (FabI or FabJ),
which produces an acyl-ACP. Additional cycles of elongation are initiated by the ~
ketoacyl-ACP syntase (FabB or FabF), which elongates the acyl-ACP by two carbons to
from a f3-ketoacyl-ACP (52). Elongation ends when the fatty acyl chain reaches the
appropriate length that can be used for membrane phospholipid or lipopolysaccharide
synthesis (133). In addition to contributing to membrane phospholipid components, P.
aeruginosa like many Gram-negative pathogenic bacteria utilizes the fatty acid
biosynthesis pathway to synthesize acylated homo serine lactones (AHLs), which are used
to monitor cell density and to regulate many virulence factors by quorum sensing and
response (39, 71, 90, 93). The AHLs derive their invariant lactone rings from S
adenosylmethionine (SAM) and their variable acyl chains from the cellular acyl-ACP
pool.
While the fatty acid degradative pathway (Fad) in P. aeruginosa has not been
characterized, the pathway is well established in E. coli and can serve as a basis for
understanding the ~-oxidative systems of other bacteria. The pathway by which E. coli
degrades fatty acids is substantially similar to the ~-oxidative pathways present in the
mitochondria of mammals and other eukaryotic organisms (12) and is shown in Figure 2.
The synthesis of at least five proteins involved in fatty acid degradation is coordinately
induced when long-chain fatty acids are present in the growth medium (12). The fad-
11
regulon is primarily responsible for the transport, activation, and ~-oxidation of both
medium-chain (C7 to CII) and long-chain (C12 to CIS) fatty acids, and their expression is
specificaIIy controlled by the fadR gene product. The first step of fatty acid degradation is
the activation of free fatty acid to an acyl-CoA thioester by acyl-CoA synthetase (FadD)
as shown Figure 2. In E. coli, purifications studies have confirmed the existence of a
single acyl-CoA synthetase with broad specificity for medium- and long-chain fatty acids
(63, 89). In contrast, present mutational analysis studies in our laboratory suggest the
existence of at least four probable acyl-CoA synthetases in P. aeruginosa. Two operator
sites for the FadR repressor in the regulatory region of fadD have been identified and
confirmed by DNase footprinting experiments in E. coli (6). Promoter mapping studies of
the potentiaifadDs in P. aeruginosa are currently underway in our laboratory to identify
putative operator sites.
Knowledge of the next enzyme involved in the ~-oxidation pathway, acyl-CoA
dehydrogenase (fadE) has up until recently been very limited. FadE is responsible for the
first step of the ~-oxidation cycle of fatty acid degradation in E. coli, oxidizing acyl -CoA
thioester to 2-enoyl-CoA by transferring two electrons from the substrate to a flavin
adenine dinucleotide (FAD) cofactor (Figure 2). Much of the available genetic and
biochemical information specific to the E. coli acyl-CoA dehydrogenase reaction has
come from the doctoral dissertation ofK. Klein (K. Klein, Ph.D. Dissertation, Universitat
zu KoIn, KoIn, Germany, 1973). Although probable mutants (fadE) lacking
dehydrogenase activity have been isolated and mapped (63) the identity offadE in E. coli
remained a mystery. Recently, however, the identity of the fadE in E. coli was
determined through transcriptional array analysis of the FadR regulon (11).
12
FadBA is the only known operon of the fad-regulon in E. coli, and encodes the
other p-oxidation enzymes that are a part of a multi-enzyme complex having broad
substrate specificity (12). The complex has been shown to have an (J.2P2 structure and is
associated with five enzyme activities (Figure 2), 3-ketoacyl-CoA thiolase, enoyl-CoA
hydratase, L-3-hydroxyacyl-CoA dehydrogenase, cis-tl3-trans- ~-enoyl-CoA isomerase,
and 3-hydroxyacyl-CoA epimerase (5, 86, 91, 99). Saturated fatty acid oxidation requires
enoyl-CoA hydratase, L-3-hydroxyacyl-CoA dehydrogenase and 3-ketoacyl-CoA
thiolase activites whereas unsaturated fatty acids require two additional activities cis-tl3-
trans- ~-enoyl-CoA isomerase and 3-hydroxyacyl-CoA epimerase encoded by the
complex. With each cycle of the p-oxidation pathway, the activated fatty acyl-CoA loses
a two-carbon fragment as acetyl-CoA and reduces one molecule of FAD and one
molecule of NAD. The acetyl-CoA generated by CoA-dependent thiolytic cleavage is
metabolized by the TCA cycle whereas the shortened fatty acyl-CoA molecule re-enters
the degradation cycle.
PC metabolism as mentioned above liberates lipid components that can
potentially serve as a carbon and energy sources for P. aeruginosa, thus the p-oxidation
pathway may contribute to the degradation of the PC molecule allowing the bacterium to
survive in the lung of infected individuals. Recent studies in our laboratory support this
hypothesis showing that p-oxidation plays an important role in PC metabolism in vivo.
This potential for lung surfactant PC to serve as a carbon and energy source in the lung,
in addition to the involvement of fatty acid metabolism in quorum-sensing and virulence
expression makes fatty acid metabolism regulation in P. aeruginosa a topic of interest
(Figure 2). In E. coli, expression of the fatty acid p-oxidative or degradative (fat!) genes
13
of the fatty acid degradation regulon is regulated at two levels. Firstly, most other carbon
sources are preferred over fatty acids, thus fad gene expression is under general
regulation by the global cAMP-dependent catabolite repression system. Secondly, fad
gene expression is under the control of a specific regulatory mechanism exerted by the
transcriptional factor, FadR, which plays a dual role in fatty acid metabolism regulation,
influencing both fatty acid degradation as well as biosynthetic processes (' coordinated
inverse' regulation) (Figure 2). FadR acts as a transcriptional repressor ofthefadregulon,
repressing genes essential for fatty acid transport, activation and ~-oxidation, including
fadL, fadD, fadE, fadBA, fadH, fadJ and fad! (11). Concurrently, FadR acts a
transcriptional activator of key enzymes required for unsaturated fatty acid biosynthesis,
fabA andfabB (10, 49). FadR has also been shown to be required for the activation of the
iclR gene, which encodes a specific repressor of the glyoxylate (ace) operon (40). Thus,
FadR regulates the conversion of fatty acids to acetyl-CoA and the utilization of this fina1
product in the citric acid cycle (59).
FadR is a helix-tum-helix DNA binding protein of GntR family (46) with a
molecular weight of 26.6 kDa The regulatory protein exists as a homodimer in solution
and binds DNA as a dimer (104). The following model describes the mechanism ofFadR
regulation of the fatty acid metabolism. In the absence of an exogenous source of long
chain fatty acids, FadR is bound to all of its cognate operators acting both to repress
transcription of the fad genes and to activate the transcription ofthefab genes (Figure 3).
Upon addition of an exogenous supply of long-chain fatty acid, the fatty acid enters the
cell and is converted to its acyl-CoA thioester. The acyl-CoA binds to FadR resulting in a
conformational change that causes FadR to dissociate from all its operators. Dissociation
14
+ Fatty
()--==:-0 Acid
• ladBA
Oc FadR () lad84
0 --==:-ladE .cRNA ladE
polymerase
• cAcyl-CoA () ~ •
fabAB - Fatty fabAB Acid
Figure 3. Model of fatty acid metabolism regulation in E. coli. The cell on the left depicts basal level expression of the FadR-reguiated processes. The fadR gene (not shown) produces FadR, which binds its cognate operators, repressing transcription of fadBA andfadE, while activating transcription from thefabAB promoter (sawtooth lines). The cell on the right depicts a cell induced by addition of fatty acid. The fatty acid is converted to acyl-CoA upon transport into the cell, which binds to FadR and releases it from its cognate operator DNAs. This release results in the de-repression of fadBA and fadE and decreased transcription of fahAR This figure is adapted from Figure I of reference (17).
15
results in the induction of the fad genes because RNA polymerase can now fully use the
fad promoters, and the fab genes are repressed because there would be no DNA-bound
FadR to aid in RNA polymerase function (18). The recently described crystal structure of
FadR in the presence of its target DNA and its cognate inducer supports this model and
reveals the molecular basis of acyl-CoA-responsive regulation. The crystal structure of
FadR reveals a two domain dimeric molecule where the N-terminal domains bind DNA,
and the C-terminal domains bind acyl-CoA. The DNA binding domain has a winged
helix motif, and the C-terminal domain resembles the sensor domain of the Tet repressor
(127). Analysis of the FadR-DNA complex reveals a novel winged helix-tum-helix
protein-DNA interaction, involving sequence-specific contacts from the wing to the
minor groove of the target DNA (122). Three residues, His-65, Arg-35 and Arg-45,
which are invariant in the known sequences ofFadR (Haemophilus injluenzae and Vibrio
cholerae) appear to interact directly with the target DNA, while other conserved residues
appear to be involved in indirectly stabilizing protein-DNA interaction through salt
bridge and electrostatic interactions (127). The binding of acyl-CoA results in dramatic
conformational changes throughout the protein, the net effect of which is the
rearrangement of the DNA binding domains in the dimer resulting in a separation of the
DNA recognition helices and loss of DNA binding (122). Thus, binding of the effector
molecule controls the separation between the recognition helices, and thus the ability to
interact with the DNA helix. Mutagenesis experiments have identified Gly-216, Glu-218,
Ser-219, Trp-223, and Lys-228 as components of the acyl-CoA binding site (127). The
transcription factor most similar to FadR from a structural and mechanistic point of view
is the tetracycline repressor, TetR (122). However, unlike TetR and many other DNA-
16
binding proteins, FadR does not autoregulate its synthesis (49). FadR regulation seems
likely in bacteria closely related to E. coli but whether it exists in more divergent bacteria
remains to be addressed. A FadR-like protein has been discovered H injluenzae that
shares 47% identity to the E. coli FadR (103, 104) and incomplete open reading frames
(ORFs), which strongly match the E. coli FadR sequence, has been reported in V.
cholerae and V. alginolyticus. Thus it would appear that FadR regulation might be
broadly distributed in Gram-negative bacteria
1.5 Transcriptional Regulators
Prokaryotic transcriptional regulators are classified into families on the basis of
sequence similarity and structural and functional criteria. Most microbial regulators
involved in transcriptional control are two-domain proteins with a signal-receiving
domain and a DNA-binding domain, which transduces the signal. Structural analyses
have revealed that the helix-tum-helix (HTH) signature is the most recurrent DNA
binding motif in prokaryotic transcriptional factors (105). Almost 95% of all
transcriptional factors described in prokaryotes use the HTH motif to bind to their target
DNA sequences (105). Table 1 lists some of the important families of microbial
transcriptional regulators, whether the members are preferentially repressors or activators,
some of the functions regulated by each family and the active conformations. Further
discussion of transcriptional regulators will focus on GntR, IcIR, TetR, and LysR-type
regulators because of their direct relevance to this study.
17
Table 1. Prokaryotic regulator families
Family Action Some Regulated Function Active Conformation
*LysR activator/repressor carbon and nitrogen metabolism tetramer
*TetR repressor biosynthesis of antibiotics, efflux dimer pumps, osmotic stress, etc.
*IclR repressor/activator carbon metabolism, efflux pumps tetramer
*GntR repressor/activator general metabolism dimer (padR)
AsnC activator/repressor amino acid biosynthesis octamer
MarR activator/repressor multiple antibiotic resistance dimer
Crp activator/repressor global responses, catabolite repression dimer and anaerobiosis
>I< Correspond to families relevant to this study. This table has been adapted from reference (105).
1.5.1 TetR-type regulators
TetR family members are particularly abundant in microbes exposed to
environmental changes, such as soil microorganisms, plant and animal pathogens,
extremophiles and methanogenic bacteria (105). In P. aeruginosa PAOl, there are 38
transcriptional regulators that are members of the TetR family. Generally, members of the
TetR family are involved in the adaptation to complex and changing environments. All
members of the family whose functions are known are repressors and probably function
in a similar way. The binding of an inducer molecule to the non-conserved domain causes
18
confonnational changes in the conserved DNA-binding domain that result in the release
of the repressor from the cognate promoter (105).
1.5.2 LysR-type regulators
LysR-type transcriptional regulators (LTIRs) comprise the largest family of
prokaryotic regulatory proteins identified thus far (47, 113). The family includes over 100
members and has been identified in diverse bacterial genera (121). Although a large
group of L TIRs regulate a single target operon, such as CatR, which specifically controls
the calBCA expression for catechol metabolism in Pseudomonas putida, some members
are capable of controlling more than one. The NahR protein for instance, is a master
regulator for the regulon of naphthalene degradation and controls both the nah and sal
operons required for metabolism of naphthalene to salicylate and pyruvate, and salicylate
conversion respectively (112,131).
Generally, the gene for L TIRs lies upstream of its target-regulated gene cluster
and is transcribed in the opposite direction, although exceptions do exist (121). L TIRs
usually act as transcriptional activators for their target metabolic operons in the presence
of a chemical inducer and are capable of repressing their own expression. Both
autorepression and activation of the catabolic operon promoter are exerted on the same
binding site (121). Since most studies have focused on the mechanisms of target gene
activation, relatively little is known about repression mechanisms (121).
L TIRs appear to be genera11y composed of 394 to 403 amino acid residues with a
molecular mass of between 32 and 37 kDa and evidence thus far supports LTIRs
functioning as tetramers (121). Members of the LysR family have a conserved domain
19
organization. The DNA binding region with a predicted HTII motif is located in N
terminus of the protein, while inducer recognition and multimerization domains are
located in the C-terminus (121). Because of its tetrameric form, LTIRs interact with
several sites on the DNA of the promoter region and the activator binding sites appear to
be consistently upstream of the transcription start site. ClcR for example, which is
involved in regulating the clcABD operon for cblorocatechol metabolism, protects a 27-
bp region from -79 to -53 and a 10-bp region from -37 to -28 relative to the start site
(121).
1.5.3 IelR-type regulators
IciR-type regulators have a similar structure as the LTIRs (113) but rather
dissimilar amino acid sequences (121). Generally, Ic1R-type regulators are transcriptional
repressors (50), however, those that are involved in regulating catabolic pathways have
all been described as activators. PcaU of P. pulido is an activator for the protocatechuate
pathway but in the absence of its inducer is capable of acting as a repressor (120). Similar
to LTIRs, the gene for Ic1R-type regulators generally lies upstream of its target gene
cluster and is transcribed in the opposite direction. Like L TIRs, IclR -type regulators are
capable of repressing their own expression (22).
The size ofIclR-type regulators is around 238 to 280 amino acids with molecular
masses between 25 to 30 kDa. IclR family members have an HTII DNA binding motif in
the N-terminal domain (21) and a C-terminal domain that is involved in subunit
multimerization and effector binding (66). The IclR-type regulators seem to exist as a
dimer of a dimer or in other words as tetramers in its active DNA binding form (121).
20
Because the two subunits within one IclR dimer only interacts at the interface of their
DNA binding domains, the distance between the HTH motifs within one dimer is
relatively short and results in a structure favorable for binding relatively short (12- to 14-
bp) palindromic DNA sequences (121).
There is no clear consensus on the binding site for IclR regulators but it appears
that it usually lies upstream of the transcription start site. For example, MhpR and PeaR,
which are involved in controlling protocatechuate and 3-(3-Hydroxyphenyl)-propionic
acid metabolism respectively, both bind upstream of their target operon start sites. IclR
type regulators bind their promoter DNA in the absence of effector, and adding effector
does not appear to enhance protein-DNA interactions in some representative IclR family
members. The addition of chemical effectors does however enhance formation of
regulator-DNA-RNA polymerase (RNAP) complexes compared to the situation without
(41) suggesting that the role of the regulatory protein may be to recruit RNAP to the
promoter.
1.5.4 GntR-type regulators
Members of the GntR family are generally transcriptional repressors in the
absence of pathway substrates (121). As is seen in family members that control the
degradation of aromatic compounds, the presence of pathway substrates relieves
repression through the interaction of the regulator with its effector molecule (31).
Although most members of the GntR family are negative regulators, BpbR2, which is a
part of the biphenyl catabolic regulon seems to act as an activator. Not much is known
about the mechanism through which BpbR2 activates transcription, however, gel shift
21
assays have demonstrated that purified BpbR2 binds to its own promoter region more
strongly in the presence of inducers than in their absence (125).
GntR-like regulators are between 239 and 254 amino acids long with a molecular
mass of around 27 kDa (121). Haydon and Guest first described bacterial regulators of
the GntR family as having conserved N-terminal DNA binding domains but variable C
terminal effector binding and oligomerization domains (46).
Simple hindrance for RNAP binding or open-complex formation seems to be the
general repression mechanism of GntR-like regulators (121). GntR proteins bind either
the promoter region or between the transcription and translation start sites. One member
of the family, BphS of Pseudomonas spp., which regulates (chIoro )-biphenyl metabolism,
binds to four region of its cognate promoter with varying affinities (88).
22
1.6 Specific Aims of Research
Current knowledge of fatty acid metabolism in P. aeruginosa is limited to the
fatty acid biosynthetic pathway, not much is known about fatty acid degradation or how
fatty acid metabolism is regulated. The objective of this study is to investigate the
regulation of fatty metabolism in P. aeruginosa and use various approaches to attempt to
identify a regulator of the fatty acid degradation pathway. The specific aims of this study
are:
1. Construct transcriptional fusion strains that would aid in the study of fatty acid
metabolism in P. aeruginosa.
2. Use the transcriptional fusion strain to investigate how fatty acid biosynthesis and
degradation are regulated.
3. Employ different strategies to identify a regulator of fatty acid degradation and
assess their potential to regulate the fadBA5 operon. The strategies are as follows:
a. Use bioinformatics to identify potential regulators based on homology to E.
coli FadR.
b. Use different protein purification schemes to isolate and identify a protein
that interacts with thefadBA5 operon.
c. Use transposon mutagenesis to screen and identify potential transcriptional
regulators ofthefadBA5 operon.
23
Chapter Two: Materials and Methods
2.1 Media
The following media were used during the course of the experiments described in
this thesis. Luria-Bertani (LB) broth consisted of 1.0 % tryptone, 0.5 % yeast extract, and
0.05 % NaCI and was purchased pre-formulated from Teknova (Half Moon Bay, CA).
The same formulation containing 1.5 % agar was used for preparation of LB agar plates.
Pseudomonas isolation agar (PIA) was purchased from Difco Laboratories. M9 media
was used as described in Sambrook et al., 2001 (109). M9 media ingredients per liter
include 6 g Na2HP04, 3 g KH2P04, 0.5 g NaCI. and 1 g NILC!. The medium was
autoclaved and MgS04 and eaCh were added to 1 mM and 0.1 mM final concentration
after cooling.
When necessary, respective media were supplemented with antibiotics after being
allowed to cool following autoclaving. All antibiotics were purchased from Teknova.
Ampicillin (Ap) was dissolved in deionized distilled water (DDW) at a concentration of
100 mg/ml, filter sterilized through a 0.22 J.lffi filter and stored frozen in aliquots at -
20·C. Carbenicillin (Cb) was dissolved in DDW at a concentration of 500 mglml and
stored in aliquots at - 20·C. Gentamycin (Om) was dissolved in sterile DDW at a
concentration of 40 mg/ml, filter sterilized and stored at 4·C. Streptomycin (Sp) was
dissolved in DDW at a concentration of 25 mg/ml, filter sterilized and stored at 4 ·C.
Kanamycin (Km) was dissolved in sterile DDW at a concentration of 35 mg/ml, filter
sterilized and stored at 4·C. Tetracycline (Tc) was dissolved in 70% ethanol at a
concentration of 10 mg/ml and stored at -20·C. Ap was used in E. coli at a final
concentration of 100 Ilg/ml, while Om, Sp, and Tc were used at a final concentration of
24
15 flglml,25 flglml, and 10 flgIml respectively. Km was used at a final concentration of
35 flglml. In P. aeruginosa Cb was used at 500 flgIml final concentration, while Gm and
Tc were used at 150 flglml and 200 flglml respectively.
2.2 Reagents
Reagents used for agarose gel electrophoresis were high and low-melting point
agarose from Sigma. The buffers used were IX TAE (0.04 M Tris-acetate, 0.001 M
EDTA, pH 8.0) and O.5X TBE (0.045 M Tris-bomte, 0.001 M EDTA, pH 8.0). TAE was
routinely used for agarose gel electrophoresis and TBE was used for acrylamide gel
electrophoresis followed by electroblotting and gel shift assays. The 6X DNA loading
buffer and 2X protein loading buffer was prepared as described in Sambrook et al. 200 I
(l09).
X-Gal (5-bromo-4-chloro-3-indoyl-~-D-galactoside) (Sigma, St. Louis, MO) was
dissolved in dimethylformamide at a concentration of20 mglml and stored as aliquots at-
20°C. The X-Gal indicator was incorpomted into PIA media by adding 80 flgIml final
concentration to cooled media after autoclaving.
DNA standards were purchased from New England Biolabs (NEB), and dissolved
at a concentration of 0.1 flgIfll in TE buffer (10 mM Tris-HCI, pH 8.0, 1 mM EDTA)
containing IX DNA loading buffer then stored at 4°C. For use as standards, 5 fll of the
DNA solution was loaded per lane.
2.3 Bacterial Strains
25
The bacterial strains utilized in the various experiments described in this thesis are
listed in Table 2.
Table 2. List of Bacterial Strains
Strain Genotype Reference/Source
E.coli
DHSa (f.lSOdlacZLJM15, a(lacZY A-argF)U169 Bethesda Research deoRrecAl endAl hsdR17 (rK-mK+) Laboratories, supE44).-thi-l gyrA96 relAl Gaithersburg, MD
ER2S66-mob F- 'f...-jhuA2 [Ion] ompT lacZ::17 gene 1 gal T.Hoang sulAll L1(mcrC-mrr) 114::1810 R(mcr-73::miniTnlO)2 R(zgb-120::TnlO)l (Tets) endAl [dcm]recA::RP4-2Tc::Mu Km
ER2S66 F- 'f...-jhuA2 [Ion] ompT lacZ::17 genel gal New England sulA11 L1(mcrC-mrr) 114::1810 R(mcr- Biolabs, Beverly, 73::miniTn10)2 R(zgb-120::TnlO)l (Tets) MA endAl [dcm]
SMI0-Apir thi thr leu tonA lacY supE recA::RP4-2- (SI) Tc::Mu Km ').pir
HPSI e14- (mcrA) recAl endAl gyrA96 thi-1 T.Hoang hsdR17 supE44 relAl a(lac-proAB) rif zxx::miniTn5Lac4 (lacP'" lacZaM1S)
HPSl::pir116 el4- (mcrA) recAl endAl gyrA96 thi-l T.Hoang hsdR17 supE44 relAl a(lac-proAB) rif zxx::miniTn5Lac4 (lacP'" lacZaMlS) pir116
HPSl- HPSI with'f...attB::pCD13PSK- this study
26
Strain AattB::pCD13PSKP/adBs-lacZ
P. aeruginosa
PAOl
PAOl-attB::P/adBASlacZ
Genotype
prototroph
PAOt withattB::P/ad.w-lacZ
PAOl-attB::P/attE-1acZ PAOl with attB::PjattE-1acZ
PAOl-attB::P/abAB" lacZ
PAOl-attB::P/adBSlacZlM'A1627::GmR
PAOl-attB::PjadBSlacZlM'A4769::GmR
PAOl-attB::P/adBSlacZl M' A5356::GmR
PAOl-attB::PjadBSlacZlM'A2601::Tn
PAO l-attB::P/adBslacZl M' A3006::Tn
PAOl-attB::PjadBSlacZlM'A3508::Tn
PAOl with attB::P/abAB"lacZ
PAOt with attB::PjadBs-lacZ M'A1627::GmR
PAOt with attB::P/adBs-1acZ M'A4769::GmR
PAOl with attB::P/adBs-1acZ M'A5356::GmR
PAOt with attB::P/adBs-lacZM' A2601 ::Tn
PAOI with attB::PjadBs-1acZM'A3006::Tn
PAOl with attB::PjadBs-1acZM' A3508::Tn
27
Reference/Source
M. Vasil
this study
this study
this study
this study
this study
this study
this study
this study
this study
2.4 Bacterial Plasmids
The bacterial plasmids used and constructed in this study are listed in Table 3.
Table 3. List of Bacterial PIasmids
Plasmids Properties Reference/Source
pPS856 ApR, GmR; GmR-FRT cassette vector (53)
pBTIO GmR; Himar-l mariner mini transposon (69) vector
pPICK KmR; temperature sensitive (100)
pTZ120 ApR; lacZ operon fusion vector (114)
pTZ120-PjadBs-1acZ ApR; l20-bp HindIII and blunt fragment this study ofPAOl chromosomal DNA cloned into HindIII + SmaI cut pTZ120
pTZ120-PjadE""lacZ ApR; 270-bp HindIIl and blunt fragment this study ofPAOl chromosomal DNA cloned into HindIII + SmaI cut pTZ120
pTZ120-P jabAe-1acZ ApR; 320-bp HindIII and blunt fragment this study ofPAOl chromosomal DNA cloned into HindIII + SmaI cut pTZ120
pEX18T ApR; oriT + sacB +, gene replacement (53) vector
pEX18T-PA1627 ApR; 955-bp EcoRI- HindIII fragment of this study PAOI chromosomal DNA cloned into EcoRI+ HindIII cut pEX18T
pEX18T-PA4769 ApR; 1.4-kb EcoRI - HindIII fragment of this study PAOl chromosomal DNA cloned into EcoRI+ HindIII cut pEX18T
EEX18T -P A5356 ApR; l.3-kb EcoRI- HindIII fragment of this study
28
Plasmids Pro~erties Reference/Source PAD 1 chromosomal DNA cloned into EcoRl + Hindfll cut pEX18T
pEX18T-PA1627::Gm ApR, GmR ; l.l-kb PstI fragment of this study pPS856 cloned into PstI cut pEX18T::PA1627
pEX18T-PA4769::Gm ApR, GmR; l.l-kb SmaI fragment of this study pPS856 cloned into SgfI (blunt) cut pEX18T::PA4769
pEX18T-PA5356::Gm ApR, GmR ; l.l-kb SmaI fragment of this study pPS856 cloned into MluI (blunt) cut pEX18T::PA5356
mini-CTX2 Tef; integration vector (54)
mini-CTX2-PjadB5-1acZ TetR; 3.5-kb Hindfll andAjlll (blunt) this study fragment ofpTZ120::PjadB5cloned into Hindfll + SmaI cut mini-CTX2
mini-CTX2-PjadE"lacZ Tef; 3.6-kb Hindfll and Ajlll (blunt) this study fragment ofpTZ120::PjadE cloned into Hindfll + SmaI cut mini-CTX2
mini-CTX2-PjabAB-lacZ Tef; 3.7-kb Hindfll andAjlll (blunt) this study fragment ofpTZ120::PjabA cloned into Hindfll + SmaI cut mini-CTX2
pCD13PSK SpR; integration vector (100)
pCD13PSK-PjadB,-lacZ SpR; 4.6-kb SapI (blunt) fragment of (100) mini-CTX2::PjadB5-lacZ cloned into NspI cut (blunt) pCD13PSK
pUC18/19 ApR; cloning vectors (130)
pUC18-PA2601 ApR; 1.4-kb EcoRl- Hindfll fragment of this study PAD 1 chromosomal DNA cloned into EcoRl+ Hindfll cut pUCl8
pUC18-PA3006 ApR; 1.3-kb EcoRl- Hindfll fragment of this study PAOl chromosomal DNA cloned into EcoRl+ Hindfll cut pUC18
29
Plasmids
pUC I 8-PA3508
pUC18-PA5525
pUC I 8-PA1627
pUC I 9-PA4769
pUCI8-PA5356
pET28a
pET28a-P A3508
2.5 DNA Techniques
Properties Reference/Source
ApR; 1.4-kb EcoRI- HindIll fragment of this study PAD I chromosomal DNA cloned into EcoRI+ HindIll cut pUCl8
ApR; 1.3-kb EcoRI- HindIll fragment of this study PADI chromosomal DNA cloned into EcoRI+ HindIll cut pUCl8
ApR; 955-bp EcoRI- HindIll fragment of this study PAOl chromosomal DNA cloned into EcoRI+ Hint/ill cut pUCl8
ApR; l.4-kb EcoRI- HindIll fragment of this study PAD I chromosomal DNA cloned into EcoRI+ HindIll cut pUCl9
ApR; 1.3-kb EcoRI- HindIll fragment of this study PAOl chromosomal DNA cloned into EcoRI+ HindIll cut pUCl8
KmR; T7 expression vector Novagen, Madison, WI
ApR; 1.4-kb EcoRI-NdeI fragment of this study PADI chromosomal DNA cloned into EcoRI+NdeI cut pET28a
2.5.1 Plasmid DNA Isolation
For plasmid DNA isolations, standard plasmid purification or 'mini-prep' (Zymo
Research Corp.) was performed as directed by the manufacturer.
The protocol above was routinely used for isolation of high-copy number
plasmids. For the isolation of low-copy number plasmids, essentially the same protocol
was utilized except nuclease (QIAGEN) was added prior to the washing step to minimize
30
DNA degradation. The isolation procedure was then continued essentially as described
above.
2.5.2 Isolation of P. aeruginosa Chromosomal DNA
P. aeruginosa chromosomal DNA was isolated using the lsoQuick Nucleic Acid
Extraction kit (ORCA Research, Bortell, W A) utilizing buffers and protocol described by
the manufacturer.
2.5.3 Restriction Digests
Restriction digests were performed using enzymes purchased from New England
Biolabs (NEB). Buffers from the enzyme supplier were used and reactions were
incubated at 37'C or as specified by the supplier for a minimum of 1 hr. Blunt-ending
was carried out by adding 1 ¢ of2 mM dNTPs and 3 U ofT4 DNA polymerase directly
to the digest, followed by an additional incubation at 37·C for 30 min.
2.5.4 Extraction of DNA from Agarose Gels
DNA samples were usually ran on 1 % agarose gels and viewed under UV
following ethidium bromide staining. Bands of desired sizes were excised from the
agarose gel and DNA extracted utilizing the Zymo Gel Extraction protocol then stored at
- 20·C. These extractions were performed on any DNA fragments separated on agarose
for the purpose of ligation, biotin labeling or sequencing of PCR products.
2.5.5 Ligations
31
Ligations were performed by using a 4:1 (insert:vector) ratio. T4 DNA ligase was
purchased from Invitrogen or NEB. Ligation reactions were incubated overnight at RT in
IX ligase buffer, using 1 U of T4 DNA ligase. Samples were usually used for
transformation immediately or stored at - 20'C for later use.
2.5.6. Preparation of Competent Cells and Transformation
Cultures of the desired strains were grown overnight at 37'C in 5 ml LB broth.
The entire overnight culture was used to inoculate 500 ml of fresh LB media and grown
with shaking at 37'C to log phase (OD6oo - 0.5). Cells were then immediately harvested
by centrifugation (20 min, 7500 rpm, 4 'C) in pre-chilled sterilized centrifuge tube using a
Beckman floor model centrifuge. The supernatant was decanted and the cell pellet
resuspended in 40 ml ice-cold sterile 0.1 M MgCh and then chilled on ice for 5 min. The
cells were then sedimented as before, the supernatant decanted and the cell pellet
resuspended in 20 ml ice-cold sterile TG-salts (75 mM CaCh, 6 mM MgCI2. 15%
glycerol). After incubation on ice for 20 min, the suspension was sedimented as described
above and the pellet resuspended in 10 ml ice-cold TG-salts. Competent cells were
chilled on ice from 4 h to overnight, and then aliquots of 200 JJl were transferred into pre
chilled microfuge tubes and stored at - SOT. For transformation, 10 JJl of ligation mixture
or 5 JJl of plasmid DNA preparation was added to 0.2 ml of competent cells transferred
into a thin-walled glass tube sitting on ice. After incubation for 30 min on ice, the
suspension was heat-shocked for 2 min at 42 'C, then 1 ml of LB broth was added and the
tubes were shaken at 37'C for I h before plating 150 JJl aliquots onto selective media
32
2.6 Polymerase Chain Reaction (PCR) Techniques
2.6.1 PCR amplification
Standard reaction mixtures contained IX Pfo buffer, 200 !JM dNTPs, 30 pmol of
each oligonucleotide, PAOl chromosomal DNA/plasmid template, 5 U of TaqlPfu.
General reaction conditions were as follows: 94SC for I min, followed by 34 cycles of
94SC for I min, 50-70"C for 30 s, and 70-72"C for I minlkb. PCR were carried out
using the EppendorfMastercycler gradient.
2.6.2 Oligonucleotides
The oligonucleotides used in this study are listed in Table 4.
Table 4. Oligonucleotides
Primer Name
lacZ-fusion construction #274-fabAB(p1 )-Hindill #277:fabAB-PEI #384-fadE-HindIIl #385:fadE-SmaI #287:fadBA5(p4)-Hindill #289:fadBA5-P5 #45I-M13-FP2
Bioinformatics #534-HindIIl-PAI627 #535-PAI627-EcoRI #536-HindIIl-PA4769 #537-PA4769-EcoRI #538-EcoRI-P A5356 #539-P A5356-HindIII #582-5'-1627 #583-1627-3'
Regulator purification #499-PfadB5-concatamer
Sequence·
5' -CTGCAAGCTTATCGGGAGAACTGCCTGCAG-3' 5' -AATCCCCGGGCTGCAGGGTTGTGGCGGTTC-3' 5' -CGTGAAGCTTGGCCTTCAGGGTCTGCGGATC-3' 5' -TTGGCCCGGGTTTGTCACGTT ATAGGCG-3' 5' -TGAATAAGCTTGCGCAGAGGGCCTGGAGGAG-3' 5' -GCAAACGCTCGA TTCATACGCC-3' 5'-GATTAAGTTGGGT AACGCCAG-3'
5'-TAAGTTAAAGCTTTCCGGGCTTGCAGCTGC-3' 5'-TATAAGAATTCGCGCACCTGGTTGAGCAGG-3' 5'-ATGGTAAGCTTCCTCTCI I I IICGCGCTGG-3' 5'-TAAGAA TTCACCTCTATCCCTCAAGCGCGAC-3' 5'-ACTAGAATTCACCTTCAGCCGATGGCAGAG -3' 5'-ATTTAAGCTTGCGGCGAGGGTAGCACGTTC -3' 5' -ATTCATCCGATGATTGGATG-3' 5' -ATTCAAGGCGTGAGTCATG-3'
5' -CTGCCGGAATGTGTGCGCACCCAA)3-3'
33
Primer Name #504-PfadB5-reverse #561-KpnI-PA5525 #562-P A5525-HindIII
Transposon Mutagenesis #550-EcoRI-PA2601 #551-PA2601-HindIII #546-EcoRI-P A3006 #547-PA3006-HindIII #544-EcoRI-PA3508 #545-PA3508-HindIII #559-NdeI-P A3508
Sequencing #139-Taq-up #524-HIBI7 #463-GmR-RT #525-3' -Om-reverse #526-marinerTn-reverse
EMSA Studies
Sequence-5' -biotin-TTGGGTGCGCACACA TTCCG-3' 5'-ACCGGTACCCGCGGCAGCAAC-3' 5'-AAAGCTTCTGTTCGCTGCATTGC-3'
5'-AAATGAATTCGACCACCGAGAAGCGCTGCC-3' 5'-AAGCTTTTCCGTCTTTTCGTTTCCCAAGGC-3' 5'-AGATGAATTCGGCGACTTGAAGCCGAGTTC-3' 5'-T AAATAAGCTTGCCGTCACGGGCCTCAGAC-3' 5'-ATTAGAATTCGGTATCGACGGCATGGCCAG-3' 5'-TTAATAAGCTTCGGCGAAGGCGCGCACCTG-3' 5'-ACCGCCATATGGATAAGTCAG-3'
5' -GGGCATATGCTGCCCCTCTTTGAGCC-3' 5' -CGGATTTCCGGATNGA YKSNGGNTC-3' 5' -GAGCAGCCGCGTAGTGAG-3' 5' -AAGTACCGCCACCTAAC-3' 5 '-CTGTATGGAACGGGATG-3 ,
#563-glpD-SG-For 5' -ACGCCCA TTTCAAGCAGCAA-3' #564-glpD-SG-Rev 5' -TGCTTGCACAGGTAGTCCACTT-3' - Restriction sites are underlined
2.7 Genetic Techniques
2.7.1 Biparental Matings
Plasmids containing the oriT were transferred from E. coli strains SMIO-lpir or
ER2566-mob to P. aeruginosa strains by biparental mating (116). This involved growing
both donor and recipient strains to early log-phase with shaking at 37·C. Then, 0.5 ml of
each culture was mixed in the same 1.5 ml microfuge tube and centrifuged at 8,000 rpm
for 1 min at RT to pellet the cells. The supernatant was decanted, leaving -50 )Jl of
residual liquid in the tube which was used to resuspend the cell pellet. The suspension
was then spotted onto a pre-warmed 1 em diameter cellulose acetate membrane filter
(Sartorius, Germany) placed onto an LB plate. Following ON incubation at 3TC, the
34
celIs were resuspended from the filter by vortexing in 1 ml of LB and 150 jJl of the celI
suspension plated onto PIA + Om medium. The plates were incubated at 37'C until
colonies appeared.
2.7.2 Construction of Transcriptional Fusions in P. aeruginosa and E. coB
2.7.2.1 P. aeruginosa
The PfahA-lacZ transcriptional fusion in P. aeruginosa was constructed in several
steps. The fabAB regulatory region, encompassing nucleotides 23-339 upstream of the
translational initiation codon, was amplified using primers 274 and 277 and PAOl
chromosomal DNA isolated with the IsoQuick Nucleic Acid Extraction Kit (ORCA
Research Inc., BothelI, WA). Cycle conditions for this and subsequent amplifications are
94.5'C for 1 min folIowed by 30 cycles of 94.5'C for 1 min, 58'C for 30 s and 70'C for
30 slkb using Pfu polymerase (Stratagene, La JolIa, CA). The 320-bp fragment was
digested with HindlII and cloned into pTZ120 (114) digested with HindIlI and SmaI to
yield pTZI20-PfahA. This created a transcriptional fusion of the PfahA with the lacZ-gene
on pTZ120. Similarly, the PfllllE"iacZ and PftulBS""lacZ transcriptional fusions were
constructed by amplifying the fadE and the fadB5 promoters; encompassing nucleotides
78-347 and 148-266 upstream of the respective start codon, and PCR were performed
using primers 384 and 385 and primers 287 and 289 from PAOl chromosomal DNA. The
resulting 268-bp and 120-bp fragments were cloned into pTZ120 as described above to
yield pTZ120-PfadE and pTZI20-PfadBS, respectively. For integration into the P.
aeruginosa genome, the PfabA-lacZ, PfadE"/acZ and PftulBS""/acZ fusions were digested with
AjlIII, blunt-ended, and digested with HindlII; these fragments were then sub-cloned
35
between the HindIJl and SmaJ sites of mini-CTX2 (54) to yield mini-CTX2::PfabA-laC4
mini-CTX2::PfadE"iacZ, and miniCTX2::PfadBs-iacZ, respectively. Chromosomal
integration of these mini-CTX2 lacZ-fusion vectors in P. aeruginosa and excision of
unwanted plasmid sequences were performed essentially as described in (54). Insertions
at the chromosomal attB-locus was verified by PCR using primer 451 along with primer
274,287, or 384 forfabA,fadB5, andfadE respectively.
2.7.2.2 E. coli
Construction of the transcriptional fusion in E. coli utilized the miniCTX2::PfadBS
lacZ vector created for the construction of the P. aeruginosa transcriptional fusion. The
PfadBS-1acZ fusion was excised from miniCTX2::PfadBs-lacZ using SapI, then blunt-ended
using T4 DNA polymerase. The resulting fragment was then cloned into pCD13PSK,
which was digested with NspI and blunt-ended with T4 DNA polymerase. The resulting
construct, pCD13PSK-PfadBs-iacZ was transformed into strain HPSlIpPICK via heat
shock and blue-white selection performed on LB + Sp + X-Gal at 30° C. After ON
incubation, plates were transferred to 37°C to cure the cells of the pPICK plasmid and
blue colonies selected. Successful integration of the PfadBs-lacZ fusion at the lattB site
was verified by PCR.
2.7.3 Gene Replacement
For gene-replacement, the previously described strategy utilizing the gene
replacement vector pEX18T was employed (53). PotentiaifadR loci were amplified using
oligonucleotides that contain EcoRI and HindIJl restriction sites, which allowed for
36
bIa sacB • •
PAI627.:6m pEX18T::PA1627::Gm
PA162T FRT FRT 'PA1627
PAOI. :"PfadBAli-IacZ chromosome PAI627
1 st homologous recombination event selected on Gm-containing media
FRT FRT on7 sacB b/a 0';
----~=x() .()C~--==~·~==~·~===·~~====~~ PAI627' 6m B 'PA1627 PAI627
I
2nd homogous recombination event selected FRT FRT on media containing 6% sucrose + Gm
--c::::a:O • ()C::J--PA1627' 6mB 'PA1627
Figure 4. Schematic representation of mutant construction by gene replacement. The gene replacement vector, pEX18T, harboring the inactivated gene of interest (pA1627) is introduced into the PAOl transcriptional fusion strain. The first recombination event leads to the formation of a merodiploid that is selected for on PIA + Om media. The vector backbone is removed via sacB-mediated recombination on PIA + Om + 5% sucrose media leaving the inactivated gene of interest in the chromosome.
37
subsequent digestion of the PCR product. The resulting EcoRl-HindIII was cloned into
the EcoRl-HindIlI-cleaved gene replacement vector pEX18T. Central regions of the
potentiaifadR loci were then replaced with a GmR-cassette obtained from pPS856. The
resulting constructs were transformed into the mobilizer strain ER2566-mob and
conjugally transferred by biparental mating into PAOl-attB::PJadBS'lacZ. Successful gene
replacement at the PAOI fadR loci was obtained in several steps (Figure 4). First, a
fadR::GmRfadR+ merodiploid strain due to integration of the non-replicative pEX18T
plasmid into the chromosome was obtained after selection on PIA + Gm media. Second,
colonies obtained on PIA + Gm were streaked on PIA + Gm + 5% Suc to force a second
recombination event leading to the removal of the plasmid backbone. Carbenicillin
sensitivity was tested by patching onto PIA + Om and PIA + Cb. Lastly, GmR SucR CbS
patches were then restreaked onto PIA + Gm + 5% Suc media and after the appearance of
isolated colonies, were verified for the insertion of GmR -cassette at the fadR loci by PCR
The following primers were used for verification: primers 582 and 583; primers 536 and
537; and primers 538 and 539 were used for PA1627, PA4769, and PA5356 respectively.
2.8 Transposon Mutagenesis
The lacZ transcriptional fusion strain PAOl-attB::PJadBS'lacZ was subjected to
transposon mutagenesis using the mini transposon vector, pBT20. The transposon in
pBT20 is catalyzed by the Himar-l mariner transposase. The pBT20 vector was
conjugally transferred by biparental mating into PAOl-attB::PJadB;-lacZ essentially
following the protocol described in Kulasekara et aI., 2005 (69). The donor strain (SMIO
').pir) harboring the pBT20 vector and recipient PAOl-attB::PJadBj-IacZ were scraped
38
from overnight plates, LB + Ap and PIA respectively, and resuspended in 2 mI of LB.
The concentration of the cell suspension was adjusted to OD600 of 40 for the donor and
OD6OO of 20 for the recipient. Next, 25 j.ll of donor and recipient were mixed and spotted
onto a dry LB agar plate and incubated at 37°C for 4 h. Mating mixtures were scraped
and resuspended in 3 mI of LB. Then, 300 j.LI from this suspension was plated onto PIA +
X-Gal and incubated at 37°C.
Transposon insertion sites were determined by sequencing the flanking region of
the transposon using a semi-random PCR method utilizing nested primers (primer 524 or
139 along with the nested primers i) 463, ii) 525, then iii) 526). Touchdown PCR method
consisted of two phases. Phase I consisted of an initial step of 95°C, followed by 25
cycles of denaturation at 95°C for 45 s, annealing at variable temperatures for 45 s, and
extension at 72°C for 2 min. The annealing temperature was set at 60°C in the first cycle
and, at each of the 24 subsequent cycles; it was decreased by 0.5°C increments per cycle.
Phase 2 consisted of 25 cycles of 95°C for 45 s, 50°C for 45 s, and 72°C for 2 min (73).
Alternatively; the touchup PCR method was used, which consisted of 3 phases. Phase I
consisted 10 cycles of 95°C for 30 s, 42°C for 25 s, and 72°C for 2 min. Phase 2 consisted
of 30 cycles of 95°C for 30 s, 52°C for 25 s, and 72°C for 2 min. Phase 3 consisted of 34
cycles of 95°C for 30 s, 54°C for 30 s, and 72°C for 1.5 min. PCR products were extracted
and sequenced using primer 526 at local facilities.
2.9 Construction of Expression Vectors
Potential fadR loci were amplified from P AOl chromosomal DNA using
oligonucleotides that contain EcoRI and HindIII restriction sites, which allowed for
39
subsequent digestion of the PCR product. The EcoRl-HindIII digested PCR product was
cloned into the EcoRl-HindIII-cleaved cloning vector pUCI8/19. Alternatively, thefadR
loci were obtained from the various previously constructed gene replacement vector
derivatives, pEXI8T:;fadR. The resulting constructs were then transformed into HPSI
AattB::pC013PSK-PjadBs-IacZ by heat shock and selected on LB + Ap. Transformants
were verified by digestion using restriction sites unique to the insert and vector.
2.10 Electrophoresis Mobility Shift Assays (EMSA)
2.10.1 Crode Extract Preparation
Cultures of the desired strains were grown overnight at 37°C in 5 mI of LB. A
portion of the culture was used for a 1: I 00 inoculation into fresh LB media and grown
with shaking at 37°C to log phase (00600- I). The cells were harvested by centrifugation
(10 min, 8,000 rpm, 4°C) in a Beckman floor model centrifuge. The supernatant was
decanted and the pellet resuspended either in MCAC-O buffer (20 mM Tris-HCI pH 7.9,
0.5 M NaCl) containing 10 J1lImI lysozyme, 1 mM PMSF, 1 mM EOTA, 0.1 % Triton X-
100 or 20 mM Tris-HCI pH 8, 0.5 mM EOTA, 1 mM OTT, 5% (v/v) glycerol containing
SO mM NaCl, 1 mM PMSF and 10 J1lImI lysozyme for (NRt)2S04 precipitation. The cell
suspension was then subjected to cycles of freeze-thawing at -80°C until the bacterial
cells were lysed. Clarified lysate was obtained by ultracentrifugation (2 h, 47,000 rpm,
4°C) in a Beckman floor model ultracentrifuge. The clarified lysate was then dialyzed
against 1 L of 10 mM Tris-HCI, pH 7.5 three times prior to subsequent studies.
2.10.2 Expression and Purification ORF PA3508 for EMSA Studies
40
The ORF PA350S was expressed and purified using the T7 RNA polymerase
expression system. Plasmid pET2Sa-PA350S was constructed by amplifying the PA350S
region from pUCIS-PA350S using primers 544 and 559 listed in Table 4. This fragment
was then digested with NdeI and HindIII and subcloned in-frame into the pET2Sa
expression vector digested with the same enzymes, which produced a His6-tag at the N
terminus. The vector was then transformed into the E. coli expression strain ER2566 by
heat shock described above in Section 2.5.6. The host strain ER2566 (Table 2) contains
the gene for T7 RNA polymerase and is under the control of the IPTG-inducible lac
promoter (119). The transformed ER2566 strain containing pET2Sa-PA350S was grown
in 5 rnl LB + KID overnight at 37°C. The entire overnight culture (5 rnl) was used to
inoculate 500 rnl of pre-warmed (37°C) LB + KID and grown with shaking at RT for S h
(OD600 - 0.1). The culture was then moved and grown with shaking at 37°C until OD6OQ-
0.7. Cells were then transferred back to RT and grown for 1 h prior to inducing with 1
mM IPTG. After growing at RT for an additional S h, cells were harvested by
centrifugation WC, S,OOO rpm, 10 min) and resuspended in MCAC-O buffer containing
10 fJ.gfmllysozyme, 7.5 units of DNAse I, 1 mM PMSF, 1 mM EDTA and 0.1% Triton x-
100. The cell suspension was then subjected to cycles of freeze-thawing at -SO°C until the
bacterial cells were lysed. Clarified lysate was obtained by ultracentrifugation (2 h,
4S,000 rpm, 4°C) in a Beckman floor model ultracentrifuge. HiS6-tagged PA350S was
purified on Ni+-NTA column. Column was washed with 300 rnl of MCAC-40 + 1 mM
PMSF and eluted with 5 rnl of MCAC-200 buffer. Purified protein sample was then
dialyzed against 1 L of 10 mM Tris-HC1, pH 7.5 three times prior to EMSA studies.
41
Protein concentration was detennined by Bradford assay (8) using BSA as a
standard.
2.10.3 Streptavidin Magnetic Particles Purification
P. aeruginosa PAOl clarified lysate was prepared as described in Section 2.10.1.
In addition, the clarified lysate was concentrated down to 2 ml with an Amicon Ultra
10,000 MW spin column (Millipore Corporation, Bedford, MA). Concatamers of the
fadB5 consensus sequence, amplified with primers 499 and 504 (60 pmole each), was
used to purify the regulator from P. aeruginosa clarified lysate. PCR conditions to
generate concatamers of the fadB5 consensus sequence were 94.5"C for 2 minutes
followed by 34 cycles of 94.5'C for 45 s, 55'C for 40 s and 68'for 45 s + 5 s/cycle using
Pfu (Stratagene, La Jolla, CA). Concatamers of various sizes in the PCR reaction were
purified away from primers using the DNA CleaniConcentrator™-5 kit (Zymo Research
Corporation). The biotinylated PCR product was used to purify the regulator from P.
aeruginosa clarified lysate with Roche streptavidin magnetic particles and a magnetic
particle separator (Roche, Indianapolis, IN) as directed by the manufacturer; Briefly,
biotinylated PCR product (-240 pmole) was incubated with 1 mg of streptavidin
magnetic particles in 250 j.tl of TENIOO binding buffer (10 mM Tris-HCI, 1 mM EDTA,
100 mM NaCl, pH 7.5) for 30 min, then washed twice with equal volumes of TENIOOO
washing buffer (10 mM Tris-HCI, 1 mM EDTA, 1 M NaCl, pH 7.5). DNA-bound
streptavidin magnetic particles were then incubated with 175 j.tl clarified lysate and 50 j.tl
protein-binding buffer composed of 20 mM Hepes, pH 7.6, 1 mM EDT A, 10 mM
(NI4):zS04. 1 mM OTT, 1% Tween 20 (w/v), 150 mM KCl containing 12.5 !Jog of
42
poly(dI-C) and 0.125 Ilg of poly-L-lysine for 60 minutes at 4°C. Following binding,
particles were washed three times with equal volumes of protein-binding buffer and
eluted in a total volume of 45 J.1l with 2.0 M KCl in protein-binding buffer (20 roM
Hepes, pH 7.6,1 roM EDTA, 10 roM CNH4)2S04.1 roM DTT, 1% Tween 20 (w/v), 150
roM KCI). The partially purified lysate was then dialyzed against 30 roM Tris-HCl, pH
8.0, 0.2 roM EDT A, 200 roM NaCI. Recovered lysate was then used in EMSA studies.
2.10.4 Ammonium Sulfate Precipitation
Crude extract was prepared as described in Section 2.10.1 and subjected to
ammonium sulfate precipitation. After ultracentrifugation, the crude extract was treated
with a saturated solution of CNH4)2S04 to precipitate proteins at 30-60% in 5%
increments and at a final precipitation step at 80%. Precipitate was allowed to form at 4°C
for 1 h under gentle stirring with a magnetic stir bar. Protein precipitated at each step was
recovered by centrifugation (10 min, 12,500 rpm, 4°C) and resuspended in 20 roM Tris
HCl pH 7.5. Resuspended protein was then dialyzed three times against 1 L of 10 roM
Tris-HCl, pH 7.5 prior to EMSA studies.
2.10.5 Biotin-labelling
DNA fragments used for EMSA were labeled with biotin at the 3' end using the
Biotin 3' End DNA Labelling Kit from Pierce (Rockford, IL). Briefly, the promoter
regions of fadB5 and fabA, and other DNA fragments of interest were amplified from
PAOl chromosomal DNA (PfadB5 and PfabA were amplified as above for lacZ gene fusions
with primers 287 + 289 and 274 + 277 respectively; primers 563 + 564 were used to
43
amplify glpD), and ran on 2% agarose gel. DNA bands were extracted as described in
Section 2.5.4 and the concentration adjusted to 1 ).1M using the Beckman
Spectrophotometer. On ice, the following components were added: 25,.u ofDDW, 10,.u
of SX TdT (terminal deoxynucleotidyl transferase) Reaction buffer, 5 ,.u unlabeled DNA
(1 ).lM), 5 111 biotin-N4-CTP (5 ).lM), and 5 111 TdT (2 Villi). Reactions were then
incubated at 37"C for 30 min. Following incubation; reactions were terminated by adding
2.5 ,.u 0.2 M EDTA. TdT was extracted from the reaction by adding 50 ,.u
chloroform:isoamyl alcohol (24:1). The mixture was then vortexed briefly and
centrifuged (2 min, 13,200 rpm, Rn in a microcentrifuge to separate the phases. The
aqueous phase was removed and stored at -20°C until use.
2.10.6 Gel Shifts
Concentrated protein preparations were incubated with the PfadB5 and the PfabA
regulatory fragments or glpD (amplified as above for lacZ gene fusions with primers 287
+ 289 and 274 + 277; primers 563 + 564 for g/pD), and gel mobility shift was performed
to demonstrate DNA binding. The amplified fragments were biotin labeled at the 3'-end
using the Pierce biotin 3'-end labeling kit (Rockford, IL) described in Seetion 2.10.5.
The labeled DNA was purified through a Zymo DNA CleaniConcentrator™-5 column.
Binding conditions for DNA and purified proteins were 20 mM Hepes, pH 7.6, I mM
EDTA, 10 mM (N~)2S04. 1 mM DIT, 1% Tween 20 (w/v), 150 mM KCl, 1 )1g of
poly(dl-C) and O.ll1g ofpoly-L-lysine, the reaction was incubated at RT for 30 minutes.
Each binding reactions were loaded on a 8% native polyacrylamide gel and ran for 120
minutes at 100 V. Gels were blotted onto Immobilon™-Ny+ membranes (Millipore,
44
Bedford, MA) with a Biorad Mini Trans-Blot Cell (Hercules, CA). Detection of
biotinylated DNA was performed with the New England BioLabs Phototope-Star®
Chemiluminescent Detection Kit. Chemiluminescent detection of membranes was
performed on the Biorad ChemiDoc EQ System.
2.11 p-Galactosidase Assays
2.11.1 Inverse Regulation Studies
IJ-Galactosidase activities were measured for the three integrated gene fusions
(P/abA-1acZ. p/tUJE-1acZ and PfadBs-lacZ) in three different growth conditions. Cells
harboring the fusions were grown ON at 37°C in PIA medium. ON cultures were washed
once with one volume of IX M9 buffer and resuspended in equal volume of the same
buffer. Resuspended cultures were then diluted 200-fold into fresh LB or IX M9 buffer
with 0.4% (w/v) CI6 (palmitate) or 0.4% (w/v) CIS (oleate). Growth-curves were
performed for each media, and growth-phases were determined from these growth-curves
to control for differences in cell-densities. One ml cell cultures were frozen at various
time, and p-galactosidase assays were performed at log-phase from the same cultures
used for growth-curves. P-Galactosidase assays were performed in triplicate and
displayed as Miller Units (80).
2.11.2 Monitoring the Regu1ation ofjadB5 in lacZTranscriptional Fnsion Strains
P-Galactosidase activities were measured for the P. aeruginosa or E. coli
transcriptional fusion strains and mutant derivative strains grown in LB or LB + AP,
respectively. Cells harboring the fusions were grown ON at 37°C in LB medium. ON
45
cultures were used to inoculate (1 :200 dilution) into fresh LB medium (50 ml) Growth
curves were performed and growth-phases were determined from these growth-curves to
control for differences in cell-densities. One ml cell cultures were frozen at various times,
and ~-ga1actosidase assays were performed at various growth phases (early-log, mid-log,
late-log and early-stationary phases for P. aeruginosa strains; early-log, mid-log, and
early stationary phases for E. coli strains) from the same cultures used for growth-curves.
~-Galactosidase assays were performed in triplicate and displayed as Miller Units (80).
46
Chapter Three: Inverse Regulation of Fatty Acid Metabolism in P. aeruginosa?
3.1 Introduction
It bas been shown that fatty acid biosynthesis and degradation are regulated in a
coordinated manner in E. coli by a transcriptional regulator, FadR. In the absence of
exogenous long-chain fatty acids, FadR is bound to all of its cognate operators repressing
the transcription of/ad genes while concurrently activating the transcription of/ab genes
(Figure 3). When an exogenous source of long-chain fatty acid is available, the fatty acid
enters the cell and is converted to its acyl-CoA thioester. The acyl-CoA then binds to
FadR resulting in a conformational change that causes FadR to dissociate from all of its
operators resulting in the induction of/ad genes and the repression of/ab genes (18). This
observation implies that fatty acid biosynthesis processes are downregulated upon the
addition of long-chain fatty acids while fatty acid degradative processes are upregulated.
Similarly, in the absence oflong-chain fatty acids, fatty acid biosynthetic genes should be
upregulated while fatty acid degradative genes are downregulated. Demonstration of such
a regulatory mechanism in P. aeruginosa would suggest that a FadR homologue might
exist in P. aeruginosa. Analysis of previously collected microarray data (Tables 1 and 2)
reveal that the fatty acid degradative (feu!) genes in P. aeruginosa are upregulated and the
fatty acid biosynthetic (fab) genes are downregulated when growth on oleic acid (CIS) as
the sole carbon source is compared to growth in Luria-Bertani (LB). Conversely, the
inverse relationship is observed when growth on LB is compared to growth on oleic acid.
Verification of this relationship using transcriptional gene fusions in P. aeruginosa will
further support the hypothesis that fatty acid metabolism is coordinately regulated and
validate the search for a FadR-like protein in P. aeruginosa
47
TABLE 5. P. aeruginosafab-genes expressed two-fold or greater when grown to mid-log phase in LB versus palmitic acid (CI6:O) as identified using microarrays
Accession Number PA0730 PA1609* PA1610'" PA2552 PA2553 PA2964 PA2965* PA2967* PA2968*
PA2969
PA3643 PA3644 PA3645*
PA3639'"
Gene Fold 1. •
N Ch 1 P-Value Descnption
ame ange phaG 5.2 (7.5) 3.85E-05 hydroxyacyl-ACP:CoA transacylase PhaG fabB 2.1(2.6) 3.68E-02 p-ketoacyl-AGP synthase I fahA (2.9) NO P-hydroxydecanoyl ACP dehydrase fadB3 2.2(2.7) 1.66E-02 probable acyl-CoA dehydrogenase fadA3 2.8 3.63E-02 probable acyl-CoA thiolase pabC 3.5 1.8E-02 <4-amino-4-deoxychorismate lyase fabFl 2.5 6.6E-03 P-ketoacyl-[acyl-carrier-protein] synthase II fabG 7.3 (4.9) 1.35E-3 3-oxoacyl-[acyl-carrier-protein reductase fabD 5.7(3.7) 1.06E-2 malonyl-CoA-[acyl-carrier-protein]
transacylase plsX 6.7(2.1) 2.98E-2 fatty acid/phospholipid biosynthesis protein
PlsX lpxB 3.1 lpxA 2.7 fabZ 2.5
8.2E-4 5.1E-4 1.3E-2
lipid A-disaccharide synthase UDP-N-acetylglucosamine acyltransferase (3R)-hydroxymyristoyl-[ acyl-carrier-protein] dehydrase
accA 2.6 (2.0) 9.09E-3 acetyl-coenzyme A carboxylase carboxyl transferase (alpha subunit)
PA4847'" accB 5.4(4.3) 1.96E-3 biotin carboxyl carrier protein (BCCP) PA4848'" accC 5.6(4.1) 5.00E-05 biotin carboxylase 1 Fold change values were averaged over a minimum of three different GeneChips" for each condition (C,,~ and LB); in parentheses are average fold change for two pair-wise comparisons of oleate (CIS:I",) versus LB, and hence Pvalues were not determined (NO) 2 P-values (~ O.OS) were generated from a minimum of six out of nine possible pair-wise comparisons for LB versus elM
• Genes involve in fatty acid biosynthesis (Fab)
TABLE 6. P. aeruginosafad-genes expressed two-fold or greater when grown to mid-log phase in palmitic acid (CI6:0) versus LB as identified using microarrays
Accession Gene Fold P-Value1 Description
Number Name Change1
PA0506oI< fadE 7.3(4.6) 2.81E-05 probable acyl-CoA dehydrogenase PA0508oI< fadE 17.2(15.2) 4.8E-04 probable acyl-CoA dehydroger!ase PA1736'" fadAl 3.8 (3.3) 1.09E-03 probable acyl-CoA thiolase
PA1737* fadBl (2.1) NO probable 3-hydroxyacyl-CoA dehydrogenase
PA1748* fadB (2.5) NO probable enoyl-CoA hydratase/isomerase
PA2550* fadE (5.4) NO probable acyl-CoA dehydrogerla8e
48
Accession Number PA28IS*
PA2893*
PA30 13 *
PA3014*
PA3333**
PA3334*'" PA34S4*
PA3924*
PA392S* PA443S*
PA5188'"
Gene Name fadE
{adD3
{adE5
{adA5
{abH2
{adA
{adD4
{adA fadE
(adE
Fold Change! 3.2 (2.2)
(2.1)
S.7
6.4
11.S
31.4 4.0 (S.4)
(2.1)
P-Valuez Description
l.lE-03
ND
probable acyl-CoA dehydrogenase Probable very-long-chain acyl-CoA synthase
8.14E-OS fatty-acid oxidation complex betasubunit
3.13E-OS fatty-acid oxidation complex alpha-subunit
1.8IE-02 3-oxoacyl-acyl-carrier-protein condensing enzyme
1.7E-02 1.17E-02
ND
probable acyl carrier protein probable acyl-CoA thiolase probable medium-chain acyl-CoA ligase
2.8(3.1) I.SE-04 probable acyl-CoA thiolase 10.7 (12.8) S.98E-03 probable acyl-CoA dehydrogenase
9.0 9.59E-03 probable 3-hydroxyacyl-CoA dehydrogenase
1 Fold change values were averaged over a minimum of three differeut GeneChips® for each condition(C16~ and LB); in parentheses are average fold change for two pair-wise comparisons of oleate (ClS:l",) versus LB, and hence Pvalues were not determined (ND) 2 P-values (S 0.05) were generated from a minimum of six out of nine possible pair-wise comparisons for C 16,o versus LB • Genes involved in fatty acid degradation (Fed) " Genes involved in fatty acid biosynthesis (Fab)
3.2 Results
3.2.1 Construction of P fadBS-1acZ, PfadE"lacZ and P fabA-facZ Transcriptional
Fusions in P. aeruginosa
Three fatty acid metabolism gene/operons were used to investigate the inverse
regulation of fatty acid degradative and biosynthetic processes in P. aeruginosa. The
ORF PA281S encodes a probable acyl-CoA dehydrogenase and was included in this
study because of its significant homology to the E. coli fadE (67% similarity and SI %
identity). ThefadEA5 operon (pA3013/14) encodes the large (l subunit and the small P
subunit respectively, of the fatty acid oxidation multi-enzyme complex that is responsible
49
for catalyzing five key f3-0xidation reactions (5, 86, 91, 99). It has been previously shown
that a mutation in the fadBA5 operon results in a significant growth defect when grown
on minima! media plus fatty acid (oleic acid and palmitic acids) compared to wild-type.
Therefore, its relationship to fatty acid metabolism has been demonstrated. The fabAB
operon (PAl 6 1 0/09) is part of the fatty acid biosynthetic pathway and encodes ~
hydroxydecanoyl-ACP dehydrase and ~-ketoacyl-ACP synthase I, respectively. The
importance of the fabAB operon to fatty acid biosynthesis has been established in P.
aeruginosa and therefore was selected to be in this study. From previous promoter
mapping data acquired from our laboratory using primer extension, the transcript start
sites of the above gene/operons are known and the region encompassing the promoter
region was fused to lacZ reporter gene to create the transcriptional fusions used in this
study. The transcript start site for fadB5 was substantiated using a promoter prediction
program (http://mendel.cs.rhul.ac.uklmendel.php), which predicted the same transcript
start site as determined by primer extension with a reasonable score value (37). Briefly,
the various promoter regions were amplified by PCR and cloned into pTZ120, which
harbors the lacZ gene, to create the lacZ transcriptional fusion. The lacZ fusions were
then subcloned into the mini-CTX2 plasmid, which was then used to integrate the fusion
as a single copy in the chromosome of P. aeruginosa PAOI at the defined neutral CTX
phage attB site (Figure 5). To verify the successful integration of the lacZ transcriptional
fusions at the allB region, chromosomal DNA of the various integrants following Flp
mediated excision of plasmid sequences, were PCR-amplified using primers up- and
down-stream of the attB site. Although, these primers amplify a -270-bp fragment from
wild-type PAO 1, the size of the amplified PCR product from the integrants was - 4.5-kbp,
SO
_n c::
tRNA Ser
• altO -u .n~
FRT PfadBAfi-laaZ;;P /iiT
onT
int uti tet • •
PAOl Chromosome
mini-ClX2::PfadBA5-lacZ
! step 1 . int-mediated recombination
altO''P /8t . int 'T n r- n attP"B -00 ---+- on ---+- on 0 ~ • 0-
FRT FRT PradBAfi-laaZ I I
! step 2. Rp recombinase-mediated excision of unwanted plasmid sequences
altO''P attP"B -oon c:: • n 0-
FRT PfadBAfi-laaZ
Figure 5. Mini-CTX2-mediated integration of PjadBAS-1acZ at the attB of P. aeruginosa. The steps leading to the isolation of unmarked integrants are illustrated. Step 1 depicts the integrase-mediated integration of the mini-CTX2::PjadIW-1acZ plasmid at the attB site following transfer into a P. aeruginosa recipient strain. Step 2 shows the Flp-mediated excision of plasmid sequences leading to the removal of genes and associated promoter sequences that might interfere with expression of gene fusion. This figure was adapted from Figure 2 of reference (54).
51
confirming successful integration of the lacZ fusion. Additionally, integration of the
various fusions were also confinned using another set of primers, one primer that anneals
to the lacZ, region, primer 451, together with a primer that anneals to the promoter region
of the fadB5, fadE and fabA, primers 274, 287, and 384 respectively (Figure 6). The
results from these PCR -amplifications confinn the successful integration of the lacZ
fusions (PAOl-attB::P/adBs-1acZ, PAOl-attB::P/adE"'lacZ, and PAOl-attB::P/abA-IacZ) and
the various constructs were then used for subsequent studies.
3.2.2 Analysis offad andfab Regulation Using Transcriptional Fusions
To address the question of whether fatty acid degradation and biosynthesis are
inversely regulated in P. aeruginosa, the PAOl integrated transcriptional fusion strains
were grown in 3 conditions (LB, 0.4% (w/v) CI6 and (palmitate), and 0.4% (w/v) CIS
(oleate)) and p-galactosidase activity measured as described in Section 2.11.1. Since LB
media is relatively poor in fatty acid content compared to minimal media supplemented
with C16 0rC18. p-galactosidase activity ofthefahA promoter is expected to be high inLB
whereas fadE and fadB5 should be relatively low. On the other hand, when grown in the
presence of CI6 or CIS, the f3-galactosidase activity of the fadE and fadB5 promoters
should be high relative to thefahA promoter activity. The results from the experiment are
shown in Figure 7. In media that contains fatty acids, both fadB5 and fadE were
upregulated relative to the fabA operon. This relationship was observed regardless of
whether CI6 0rCIsfatty acids were used. In contrast, thefahAB operon is upregulated in
the absence of fatty acids while the fadBA5 operon and fadE gene are both
downregulated. The relationship between these fatty acid biosynthetic and degradative
52
4
3
2
1.5
1
0.5 -
1 2 3 4 5 6 7 8 9 10 11 12 13
1000
800
500
400
300
Figure 6. Verifying Pjad85-laeZ, PjabAB-laeZ, and PjadE-laeZ fusion integration in the P. aeruginosa PAO] chromosome by PCR. The laeZ fusions were integrated using the mini-CTX2 system and plasmid sequences removed by Flp-mediated site-specific recombination. Primers annealing to the respective promoter regions (primers 287, 274, and 384 for PladB5, PjabAB, and PjadE respectively) and the laeZ gene (primer 45 1) were used in PCR to verify the presence of the fusion in the chromosome. Three independent isolates were confirmed. Lanes I and 13, 100 bp ladders; lanes 2-4, Pladr1aeZ PCR product (- 360 bp); lanes 5 and 9, I kb DNA ladders; lanes 6-8, PjabAn-lacZ PCR product (- 425 bp); lanes 10-1 2, PjadB5-laeZ PCR product (- 220 bp).
53
(A) PJabA-lacZ (B) 600 PJadB5-lacZ
...... ~ ~ ~
.-1:1 500 ~ .. .. .. = ::!
6 .-6 300
f £ .j!; 200 .. t < < - - 100 " " C C
ai 0 cO.. 0 LB C 16:0 C 18:1&9 LB C16:0 C18:1&9
(e) PfadE-lacZ
~ .-1:1 ~ .. .. = .-6 f .. < -" C ai
LB C 16:0 C 18:1&9
Figure 7. Inverse regulation ofJabA,JadB5,JadE promoters in LB, palmitic acid (C16:0),
and oleic acid (C18:1&9). J3-Galactosidase activities (n=3) of P. aeruginosa PAOl carrying (A) PfabA-lacZ, (B) PfadBS-1acZ, and (C) PfadE"lacZ were measured at log phase.
S4
operon/genes is consistent with the microarray data previously collected in our laboratory
(Tables 5 and 6).
55
Chapter Four: Bioinformatic Approach
4.1 Introduction
FadR regulation seems likely for bacteria closely related to E. coli, certainly FadR
homologues have been discovered in Salmonella, Shigella and Erwinia (18) among
others but similarities in more divergent bacteria have also been found. Haemophilus
injluenzae encodes a FadR-like protein that is 47% identical to the E. coli FadR and
amino acids known to play important roles in the E. coli protein (103, 104) are conserved
in the H. injluenzae protein. Additionally, incomplete open reading frames (DRFs) have
been reported for Vibrio choierae and v: alginoiyticus, which closely match the E. coli
FadR sequence. Therefore, FadR regulation may be broadly distributed in Gram-negative
bacteria. A BLAST search for FadR homologues in the P. aeruginosa PADI genome
revealed several proteins with some similarities (pAI627, PA4769 and PA5356) albeit
with slightly low sequence identity (-25 %) to the E. coli FadR. Sequence analysis of
these potentialfadRs reveals they contain an N-termina1lITH-containing region of GntR
like bacterial transcription factors. GntR-like proteins can be divided into six different
sub-families, one of which is the FadR subfamily (106). Although there are only modest
similarities between these genes and the E. coli FadR, it may prove worthwhile to
investigate the regulatory roles of these proteins in P. aeruginosa.
Since fadB5 has been previously established to be important in fatty acid
degradation and the respective Pseudomonas transcriptional fusion has been
demonstrated to be functional (See Section 3.2.2), the PjodBs-lacZ fusion was specifically
selected to be used in this and subsequent studies. The objective of this study was to
construct isogenic mutations at the various loci (pAI627, PA4769, and PA5356) in a
56
P fadB5-1acZ transcriptional fusion background and characterize the mutants by ~
galactosidase assays. In addition, to investigating these potential FadRs in a P.
aeruginosa background, any interaction between the gene product of these loci and the
promoter region of fadE5 will be isolated by performing experiments in an E. coli
background. Similar as with P. aeruginosa, E. coli PJadBS-1acZ transcriptional fusion will
be constructed and the effect of the expression of the various potential FadRs will be
investigated via ~-ga1actosidase assays. Lastly, the lysate of the various E. coli
transcriptional fusions will be extracted and tested for its ability to interact directly with
thefadB5 promoter region by electrophoresis mobility shift assays (EMSA). Collectively,
the results from these experiments are expected to yield insights into the relationship
between these various loci identified by bioinformatics and the regulation offadB5.
4.2 Results
4.2.1 Construction ofPA01-attB::PJadBs-lIlcZl4fadR::Gm (pAI627, PA4769 and
P A53S6) by Gene Replacement
To assess the regulatory potential of the gene products ofPA1627, PA4769, and
PA5356 mutations were introduced at these loci in the PAOI-attB::PfadB5-1acZ fusion
strain using the gene replacement strategy illustrated in Figure 4. Briefly, the 'fadR'
regions amplified from PAOl chromosomal DNA and were cloned into the gene
replacement vectorpEXl8T. A region of the gene was then replaced with a GmR-cassette
derived from the vector pPS856. The plasmid-borne fadR::Gm deletions were then
transferred into the PAOI-attB::PJadBs-1acZ fusion strain by biparental mating as
described in Section 2.7.3. Insertion of the GmR -cassette into the respective 'fadR' genes
57
in the PAC 1 chromosome was verified by peR using primers up- and down-stream of the
respective genes (Figure 8). Amplification ofPA1627, PA4769 and PA5356 from wild
type PAOl gave peR products of sizes -708 bp, - 1433 bp, and - 1271 bp respectively,
while the corresponding mutants gave peR products of sizes - 1955 bp, - 2433 bp, and -
2271 bp. The shift in the peR product that observed after gene replacement is due to the
insertion of the -1 kb GmR -cassette.
4.2.2 Characterizing PA01-attB::PfadBs-iacZl4{adR::Gm (pAI627, PA4769
and P A5356) by Jl-galactosidase assays
To investigate the effect of mutations in PA1627, PA4769, and PA5356, the
mutated fusion strains were grown in media in which the PfadB5 promoter has been shown
to be repressed (see Section 3.2.2). The rationale is that if one of these genes encodes a
repressor of the fadBA5 operon, an insertion mutation would prevent the gene product
from being expressed leading to an apparent de-repression (Figure 9). This de-repression
can be directly observed through 13-galactosidase assays. Briefly, the Pseudomonas
transcriptional fusion strain PAOl-attB::PfadB5-1acZ along with the mutated derivatives
(APAI627::Gm, APA4769::Gm, and APA5356::Gm) were grown in LB, media in which
the PfadB5 promoter was shown to be repressed and 13-galactosidase activities measured at
various growth phases and compared. The results from these experiments are shown in
Figures 10 and 11. Figure 10 shows the growth curve for the various Pseudomonas
transcriptional fusion strains together with the mutated derivatives and the time points at
which culture was collected for 13-galactosidase assays. 13-Galactosidase activities were
58
kb
to 8
6 5 4
1
'2
1', -
1 -
n .~ -
1 2 3 4 5 6 7
Figure 8. Verifying insertion of GmR-cassette fo llowing gene replacement at PA1627, PA4769, and PA5356 in P. aeruginosa transcriptional fus ion strain PAOl-attB ::PjadB5-laeZ. Primers up- and down-stream of the repective ORFs were used to verify the insertion of the GmR-cassette. Lane I, I kb DNA ladder, lane 2, PA1627 amplified from PAOI -atrB: :PjadB5-lacZ; lane 3, PAI627 amplified from mutant; lane 4, PA4769 amplified from PAOI -aIlB::PjadB5-lacZ; lane 5, PA4769 ampli fied from mutant; lane 6, PA5356 amplified from PA01-atrB::PjadB5-lacZ; lane 7, PA5356 amplified from mutant.
59
Under non-inducing conditions - absence 01' exogenous !'ally acids (ac;+coA)
WTcel/
RNApolymerllSe r 0 = FadR
~ CD: !'adR PlHdBA5-lacZ
Gene Rqplacement mutant
x I'adR.:6m PlHdBA5-1acZ
Figure 9. Principle of the gene replacement mutagenesis screen strategy used to find the FadR-like protein in P. aeruginosa. Upper panel depicts wild-type PAOl-attB::PjadBslacZ cell in the absence exogenous fatty acid. FadR is expressed from the JadR loci and binds to the promoter region of the JadBA5-lacZ fusion repressing transcription of lacZ. The absence of p-galactosidase results in low p-galactosidase activity. Bottom panel shows the disruption of the JadR loci by insertion of GmR-cassette under the same conditions. Inactivation of JadR relieves repression of JadBA5-lacZ, allowing for the expression of p-galactosidase, which leads to high (3-galactosidase activity.
60
6,-----------------------------------,
s
4
--c-- PA01-attB::PfadB5-IacZ
=0 3 <> 1627::Gm
~ §
····0··· 4769::Gm
>1 5356::Gm 2
O~-----,r_----_r------r-----~------, o w w ~ ~ ~
Time (h)
Figure 10. Growth curves of P. aeruginosa transcriptional fusion strains PAOl-attB:: PfadB5-1acZ and mutant derivatives grown in LB media. Mutants were constructed by insertion of a GmR-cassette by gene replacement at PA1627, PA4769 and PA5356. Indicated are the time points at which ~-galactosidase activities were measured, EL, early-log; ML 1, mid-log 1; ML2, mid-log 2; LL, late-log, and ES, early-stationary.
61
I
• • • • • •
I~ E E ':I E E E J E E E ':I E E E i E E E III C!! .!! C!! C!! C!! C!! C!! C!!
~ III III III III III III
~§ ~ I l ~ .. iii t.:i .. iii ;.:. ~ 3i t\i ii i N ... I ... N ... ~ Ie I;: ... I;: iii ... I;: iii ... ... I;: iii ...
~ ~
~ ~ ~ ...
~
~ ~ i ~ ~ ~ ~ ~ ~
~ c c c ~ : : :
Early log Mid log1 Mid log 2 Late log Early Stationary
Phase/Strain
Figure 11. Transcriptional regulation of p/adB5-lacZ fusion in the P. aeruginosa transcriptional fusion strain PAOI-attB::P/adBs-1acZ and insertion mutant derivatives (APAI627::Gm, APA4769::Gm and APA5356::Gm) grown in LB. ~-galactosidase activities were measured at five time points, EL, early-log; MLl, mid-log I; ML2, midlog 2; LL, late-log, and ES, early-stationary. The values represent the mean :!: the standard deviation (n = 3).
62
measured at early-log, two points during mid-log, late-log and early-stationary. It is
apparent from the growth curve that mutations at the various loci do not affect growth in
LB media Growth of all the mutants is quite comparable to that of the wild-type fusion
strain, both in terms of growth rate and fina1 cell density. The results also show that there
are no significant differences in the level of f3-galactosidase activities across all growth
phases (Figure 11). The activity the fadB5 promoter of the wild-type strain was low as
would be expected in media lacking fatty acids, and remained low through out growth.
Inactivation of the various fadR candidates did not relieve repression of the fadB5
promoter and similar to wild-type, f3-galactosidase activity also remained low over the
various growth phases. The results from these experiments revealed that mutations at
these loci did not significantly affect f3-galactosidase activities compared to the wild-type
fusion strain.
4.2.3 Construction of p/adBS-IacZ transcriptional fusion in E. coli
(HPSl-lattB::pCD13PSK-P/adBs-lacZ)
The objective of this study is to isolate any potential interaction between the
various FadR candidates and the fadB5 promoter by performing experiments in a
different host system. By conducting studies in E. coli, not only does this allow the
isolation of Pseudomonas DNA-binding protein and its cognate target but provides
potential insights into whether other transcription factors are required for DNA binding.
Briefly, PfadBs-lacZ fusion was obtained from the previously constructed vector
miniCTX2::PfadB5-lacZ and cloned into the E. coli integration vector pCD13PSK to create
pCD13PSK-PfadBs-lacZ as described in Section 2.7.2.2. The integration vector was then
63
introduced into the E. coli strain lIPSI by triparental mating, pCDl3PSK-P/adBS"
lacZJER2S66-mob, pPICKlER2S66-mob and the recipient lIPS 1 strain (100). Following
curing of the integration helper plasmid, successful integration of the P/adBS"lacZ fusion
was confirmed by PCR-amplification. Primers annealing to the fadB5 promoter region
(primer 287) and lacZ gene (primer 451) were used to amplify a -220 bp product from E.
coli chromosome to confirm the presence of the reporter fusion (Figure 12). Since the
expression of p-galactosidase should be constitutive since the fadB5 is not repressed.
Successful integration was also selected by the production of blue pigment on media
containing the chromogenic substrate for p-galactosidase, X-Gal, 5-bromo-4-chloro-3-
indoyl-P-D-galactoside. Together, these results verified the successful integration of the
fusion in the E. coli chromosome and the E. coli transcriptional fusion strain were then
used for subsequent studies.
4.2.4 Assessing the regulatory potential ofPA1627, PA4769, and PAS3S6 by
expressing the respeetive gene products in the E. coO PfadBS"lacZ
transcriptional fusion
The purpose of this study is to determine whether the gene product of PAl 627,
PA4769 or PA5356 is capable of interacting with thefadB5 promoter by expressing these
genes individually in the E. coli transcriptional fusion strain lIPSI-AattB::pCDl3PSK
PfadBS"lacZ. The rationale is that if the gene product ofPA1627, PA4769 or PA5356 binds
to the fadB5 promoter then the normally constitutive expression of J3-galactosidase in the
E. coli system should be repressed. Briefly, PA1627, PA4769 and PA5356 were
amplified from PAOl chromosomal DNA using primers with incorporated EcoRI and
64
900 -ROO -700 --600
500 -400 -300 -200 -
100 -
1 2 3
Figure 12. Verifying PjadB5-lacZ fusion integration in the E. coli HPS I chromosome by PCR. The lacZ fusions were integrated at the )..atlB using the integration vector pCD 13PSK-PjadB5-lacZ. Primers annealing to the promoter region of PjadB5 and the lacZ gene were used in PCR to veri fY the presence of the fusion in the chromosome. Two independent isolates were confinned. Lanes I, PjadB5-lacZ PCR amplified from HPS 1-wuB: :pCD 13PSK-PjadB5-lacZ (isolate I) ; lane 2, I kb DNA ladder; lane 3, PjadB5-1acZ PCR amplified from HPSI-)..attB::pCDI3PSK-PjadB5-lacZ (isolate 2).
65
HindIII restriction sites. The amplified products were then digested with EcoRI and
HindIII and directionally cloned into the cloning vector pUC 18/19 digested with the same
enzymes. Each of the amplification products included upstream regions of the respective
genes, thereby including promoter elements that drive the expression of the genes. In
addition, the inducible lac promoter supplied by the cloning vector also contributes to the
expression. The pUC18/l9 vectors and their derivatives (pUC18-PA1627, pUC19-
PA4769, and pUC18-PA5356) were than introduced into the E. coli transcriptional fusion
strain HPSl-1attB::pCD13PSK-PjadBs-lacZ by biparental mating (Section 2.7.1) The
reporter strains were then grown in LB + Ap to maintain the plasmid and induced with 1
mM IPTG after 1 h of growth. The growth curve of the E. coli fusion strains are shown in
Figure 13 and 14. All of the strains grew similar both in terms of growth rate, as well as
final cell density, regardless of the construct introduced. P-Galactosidase activities were
measured at three different time points during growth, at mid-log, early-stationary, and
late-stationary phases shown in Figure 13 for PA1627 and PA5356 and Figure 14 for
PA4769. During mid-log phase, the p-galactosidase activity of the control strain
containing the pUC18/l9 plasmid is fairly high as expected and is comparable to the
derivatives containing PA1627, PA5356, and PA4769 (Figures 15 for PA1627 and
PA5356 and Figure 16 for PA4769). At later stages of growth, during early and late
stationary phases, the p..galactosidase activities of all the strains increase but more slowly
in the derivatives strains expressing the various FadR candidates. Both PA1627 and
P A5356 cause the most significant decrease in p-galactosidase activities, with activities
approximately 70-80% of the control strain, the greatest difference being observed during
late stationary phase. PA4769 on the other hand did not significantly reduce the
66
3
ML
2 ~
0i-----~r------r------,_----~ o 10 20 30 40
Time (h)
---0--
····0····
pUC18
pUC18-PA1827
pUC18-PA5356
Figure 13. Growth curves of E. coli transcriptional fusion strains HPS 1-AattB::pCD13PSK-P.fadlIS"lacZ harboring pUCI8 or derivatives encoding PA1627 or PA5356, grown in LB + Ap media Cultures were induced with 1 mM IPTG at time = 1 h. Activities were measured at three time points during the course of growth, ML, mid-log; ES, early-stationary, and LS, late-stationary.
67
3
2 ---0-- pUC19
~ pUC19-PA4769
O~=--r--~----~--~---r--~ o 5 10 15 20 25 30
Time(h)
Figure 14. Growth curves of E. coli transcriptional fusion strains HPSlAattB::pCD13PSK-P/adBs-IacZ harboring pUCl9 or derivative encoding PA4769, grown in LB + Ap media. Cultures were induced with 1 mM IPTG at time = 1 h. Activities were measured at three time points during the course of growth, ML, mid-log; ES, earlystationary, and LS, late-stationary.
68
3000
T
2500 r:ID i T :::::::: " w ~ .....•.• .. 2000 - :::::::: T II """" ..
:i:i:i:i
:::::::
~ 11 :i:i:i:i
.•..... T
m :~:;:;: $
f 1500 - :::::::: ~I~~
I!!!!!!! it: ~~~~~~~~ :.:.:.:.
W: % :;:~:~:; .....•.• :::::::: ........ . :.:.:.: . ....... I~~~~ :!:!:!:!
@jlll Col
I~~~~ .......• ::::::: mr1 :~:~:~:~
........ -< :.:.:.:. :1:j:~:I - 1000
tm~ ~~I~ :::::::: :~:l:~:~
!!I!I!I " :.:.:.:. ;~mm :::::::: ........
~~mm ~~I~l :;:;:;:;
~
!IIIIII: l~~l~l~l
:.:.:.:.
:i:!:!:! a:!I.
!I!lil!
.:.:.:.:
:!:!:!:! 500 - ~~~~llll ~l~l~l~l ;~mm ~:~:m
:!:!:!:! :::::::: :~:~:l:~ ........
iiiii!i ~~I~~l~~ ........ :::::::
~~I~~ :;:;:;:; :::::::: :::::::: ::::::::
~~~l~~~ 1t :::::::: ••..•.•. :::::::: ::::;::: :m:l:l :.:.:.:.
0 :::;:;:: ::::;::: . • • . . • . .. ... a .. ... ... .. Iii a .. III .. III ID .. t.l t.l :: t.l :;) .. :;) .. :;) .. ...
~ ~ ... ~ f ... ~ ! .. cI. .. .. .. .. .. .. t.l t.l t.l t.l t.l t.l :;) i :;) :;) i i ... ... Go
Mid-log Early Late Stationary Stationary
Phase/Strain
Figure 15. Transcriptional regulation of PjadB5"lacZ fusion in the E. coli transcriptional fusion strain HPSI-l..attB::pCD13PSK-PjadBs-IacZ in the presence of pUCl8 encoding either PA1627, PA5356 or the empty vector, grown in LB + Ap media. Cultures were induced with I mM IPTG I h following inoculation. Activities were measured at three time points during the course of growth, mid-log, early-stationary, and late-stationary. The values represent the mean ± the standard deviation (n = 3).
69
'";j' ... . - 1500-
~ .. ~ 1000-..., ~ :~ ... .. -< 500--COl ~ A
... ... ... ... ... III ... CD ... CD ... U ~ U ~ CJ ~ ::l ::l ::l ... f ... f ... f • • • ... ... ... ... ... ...
CJ U U ::l ::l ::l ... ... ...
Mid-log 8uIy Late SIaIIonmy S\alionmy
PbastlStrain
Figure 16. Transcriptional regulation of PjadBs-[acZ fusion in the E. coli transcriptional fusion strain HPSI-AattB::pCD13PSK-PjadBs-[acZ in the presence of pUCl9 encoding PA4769 or the empty vector, grown in LB + Ap media. Cultures were induced with 1 mM lPTG 1 h following inoculation. Activities were measured at three time points during the course of growth, mid-log, early-stationary, and late-stationary. The values represent the mean ± the standard deviation (n = 3).
70
constitutive expression of the JadB5 promoter, remaining fairly similar to the control
strain throughout all phases of growth.
4.2.5 DNA Binding Studies
To establish more definitive evidence of interaction between the various FadR
candidates and the promoter region of JadB5, electrophoresis mobility shift assays
(EMSA) were performed. Crude cell extract from the E. coli transcriptional fusion strains
(HPSI-J..attB::pCD13PSK-P/adBS"lacZ) expressing the various FadR candidates from the
cloning vector pUCl8/19 (Section 4.2.4) were used in the gel shift experiments. Briefly,
the E. coli transcriptional fusion strains were grown in LB + Ap and induced with 1 mM
IPTG after reaching log phase (OD 600 - 1). The culture was then allowed to grow for
another 4 h to reach stationary phase at which point the cells were harvested for lysate
extraction. Prior to use in gel shift experiments, the lysate was dialyzed against 10 mM
Tris-HCI buffer and concentrated 100 fold. A 120 bp fragment encompassing the
promoter region ofJadB5 was PCR-amplified then labeled with biotin at the 3' end and
used as a probe in the gel shift experiments. The dialyzed and concentrated clarified
lysate were incubated with labeled P fadB5 and subjected to electrophoresis in a native 8%
acrylamide gel. The results from the gel shift experiments using lysate from pUCI8-
PA1627, pUC19-PA4769, and pUC18-5356 harboring cells are shown in Figures 17, 18
and 19 respectively. In Figure 17, lysate from pUC18 and pUC18-PA1627 harboring
cells were incubated with the labeled promoter region of JadB5. The banding pattern
observed when pUC18-PA1627 lysate was incubated with P/adB5 is comparable to when
the control pUC18 vector lysate is used and the P /adB5 fragment does not appear to shift.
71
DNA + -Extract - +
1 2
+ +
3
-+
4
+ +
5
Figure 17. Gel shift assay experiment performed with 120 bp PladB5 labeled with biotin at the 3' -end (see Section 2.10.5). Crude extract was obiained from E. coli transcriptional fusion (HPS I-AauB::pCDI3PSK-PladB5-lacZ) culnll'es harboring pUCI8 or pUCI8-PAI627 during stationary phase and incubated with labeled probes. Lane I, biotinlabeled P/adB5 alone; lane 2, pUC 18 extract alone; lane 3, biotin-labeled P/odB5 incubated with pUCl8 extract; lane 4, pUC18-PA1627 extract alone; lane 5, biotin-labeled P/adB5 incubated with pUC18-PA1627 extract.
72
DNA + - + - +
Extract - + + + +
1 2 3 4 5
Figure 18. Gel shift assay experiment performed with 120 bp Pjad8s Iabeled with biotin at the 3' -end (see Section 2.10.5). Crude extracts were obtained from E. coli transcriptional fusion (HPSI-},attB::pCDI3PSK-PjadBS-lacZ) cultures harboring pUCl9 or pUCI9-PA4769 during stationary phase and incubated with labeled probes. Lane I, biotinlabeled PjadBS alone; lane 2, pUCI9 extract alone; lane 3, biotin-labeled PjadB5 incubated with pUCl9 extract; lane 4, pUC19-PA4769 extract alone; lane 5, biotin-labeled PjadBS incubated with pUCI9-PA4769.
73
Figure 18 shows the results for the pUC19-PA4769 experiments. When lysate extracted
from pUC19-PA4769 harboring cells is incubated with promoter region ofJadB5, the
band corresponding to JadB5 is absent and appears higher up in the gel. Although this
would suggest that there is some interaction between the gene product of PA4769 and P
jadB5, the control experiment shows a similar banding pattern. Both pUCI9 and pUCI9-
PA4769 lysates were able to shift P jadB5 and the shifted band appeared at the same
position on the gel for both lysates. When lysate from cells harboring the pUC18-PA5356
vector was used a similar disappearance in the PjadB5 band was observed and the PjadB5
band does appear to shift Figure 19. Although a similar disappearance in the PjadBS band
was observed with the pUCI8 vector control lysate, the shifted band using the pUCI8-
PA5356 lysate was more discrete suggesting specific interactions.
To further investigate the potential interaction between the gene product of
PA5356 and PjadB5further, gel shift experiments were repeated using both the promoter
region of a fatty acid biosynthesis operon PjabA and an internal region of the glpD gene.
FadR in E. coli has been demonstrated to be able to bind not only to the promoter regions
of fatty acid degradative genes but also to the JabAB operon (10). Therefore to test
whether the gene product of PA5356 has a similar ability, PjadA was included in this
experiment. As a control, a random internal DNA sequence within the glycerol
metabolism gene, glpD was selected. The interaction between a transcriptional regulator
and its binding site is fairly specific and a change in a single base pair can lead to
disruption of this interaction. Therefore although there are regions within glpD that are
homologous to that of PjadB5, the difference should be great enough to prevent any non
specific interaction while maintaining a high degree of stringency. The results from the
74
DNA + - + - + Extract - + + + +
1 2 3 4 5
Figure 19. Gel shift assay experiment performed with 120 bp PjadB5 1abeled with biotin at the 3' -end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (HPS I-AGUE: :pCD 13PSK-PjadB5-IacZ) cultures harboring pUC18 or pUC 18-PA5356 during stationary phase and incubated with labeled probes. Lane I, biotinlabeled Pjad85 alone; lane 2, pUC 18 extract alone; lane 3, biotin-labeled Pjad85 incubated with pUC 18 extract; lane 4, pUC 18-PA5356 extract alone; lane 5, biotin-labeled Pjad85 incubated with pUC18-PA5356 extract.
75
experiment with PfadB5 along with PlabAB and glpD are shown in Figure 20. It is evident
from the results that the gene product ofPA5356 is capable of binding to the promoter
region of PfadB5 and PfabA since incubation of the lysate with the respective DNA
fragments results in the different migration pattern and complete disappearance of the
DNA band. Althougb the DNA band does disappear, a discrete shifted band was not
observed. A similar result was observed when glpD was incubated with the lysate.
76
DNA - + + + + + + Extract + - + - + - +
1 2 3 4 5 6 7
Figure 20. Gel shift assay experiment performed with 120 bp PladD5, 320 bp PlabAD, or 400 bp glpD fragment labeled with biotin at the 3' -end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (HPS I-ADlIB::pCD 13PSK-P/adD5-lacZ) cultures harboring pUC 18-PA5356 during stationary phase and incubated with labeled probes. Lane I, pUC 18-PA5356 extract alone; lane 2, biotin-labeled P/ad85 alone; lane 3, biotin-labeled Plad85 incubated with pUC18-PA5356 extract; lane 4, biotin-labeled PlabAB alone; lane 5, biotin-labeled PlabAB incubated with pUC 18-PA5356 extract; lane 6, biotinlabeled glpD alone; lane 7, biotin-labeled glpD fragment incubated with pUC18-PA5356 extract.
77
Chapter Five: Protein purification and EMSA
5.1 Introduction
Transcriptional regulators control the expression of their cognate genes through
the interactions with the operator sites of these genes. FadR binds to specific sequences
found upstream of fabA and the fad genes and this has been readily demonstrated in E.
coli by gel shifts and protection assays (23, 24, 48, 49). Binding of a transcriptional
regulator to the operator site is generally facilitated by the recognition of a consensus
sequence in the operator region, which ensures that a regulatory protein is interacting
with its intended targets. The interaction between a regulatory protein and its consensus
sequence is generally strong and using consequence sequences in the purification scheme
has been successfully adapted to isolate a number of transcriptional regulators (34).
Analysis of a number of fatty acid degradative and biosynthetic genes in P. aeruginosa
has revealed the presence of a strong consensus-like sequence (fabAB,fadE andfadBA5)
(Figure 21). Alignment of these putative consensus sequences shows a significant degree
of conservation comparable to the consensus sequences used by FadR to regulate fatty
acid metabolism in E. coli. These observations in addition to the fact that DNA-binding
approaches have been successful in the isolation of transcriptional regulators, suggest that
it may be possible to exploit the strong interactions between the transcriptional regulator
and its operator site to isolate the FadR homologue(s) in P. aeruginosa. Purification of
proteins from raw P. aeruginosa lysate will support the involvement of binding
consensus sequences in fatty acid metabolism regulation. It is presumed that the isolated
protein will bind mutually to fatty acid degradative and biosynthetic genes since this is
the case in E. coli, making such an observation in P. aeruginosa would
78
(A) P. aeruginosa
+1 Gee G G A T""T""""G=T A GIGlT A G G A C T~'21 ~GCCGGAATGTGT~CGCACCCAM .GCCGGAATGATCTACGACAAIGl~ ftGCGGGAATGAAC~ATTACCT~~
GCCGGAATGNNNGNNNACCNG
(8) E. coli
~AG""T""",,G~G~T=-:C=AGACCTCCT
ATCTGGTACGACCAGAT AACTG~TCGGACTTGTT AGCTGGTATGATGAGTT GGCTGGTCCGCTGTTTC ~GCTGGTCCGACCTATA CACTGGTCTGATTTCTA ~ACTCATCGGATCAGT ANCTGATCNGACNNNTT
PfadE
PfadBA
PfabA
P1-fadD
P2-fadD
P1-fadL
P2-fadL
P- IclR
Consensus
P-fadE
P-fadBA 5
P1-fabAS (constitutive)
P2-fabAS
Consensus
Figure 21. Putative P. aeruginosa PAOl Fab-Fad consensus regulator binding-site (A) relative to the E. coli consensus for FadR binding-site (B). The E. coli sequences were compiled previously (10) where there are 12 conserved nucleotides out of 17. The P. aeruginosa sequence has 14 conserved nucleotides out of 21. The numbers in (A) correspond to position relative to the mapped transcriptional start sites. The presence of putative consensus sequences in both fab- and fad-genes reinforce the hypothesis that common regulator is involved in the regulation of fatty acid biosynthetic and degradative processes.
79
5.2 Results
5.2.1 Analysis of Promoter Regions ofPladBS. PlabAB and PladE
The fact that binding sites for repressors typically overlap or are downstream of
the transcriptional start site along with the fact that binding sites for activators are
generally upstream of the start site served as starting points for promoter analyses. Based
on this information it was hypothesized that a regulator if it exists in Pseudomonas
should bind upstream of the fabAB start sites and downstream or overlapping with the
fadB5 and fadE transcription start sites. Enmination of the available mapped promoter
regions revealed a possible consensus sequence. The promoter region of fabA, which
actually has two transcript start sites contained consensus sequences at expected locations,
both were found upstream of the transcript start sites. Similarly, for bothfodB5 andfadE,
the consensus sequence lie either downstream or overlap with the transcript start sites as
predicted (Figure 22). Alignment of the possible consensus sequences shows fairly
strong conservation, which is comparable to that observed in E. coli (Figure 21).
5.2.2 Protein Purification using Streptavidin Magnetic Particles
Since the interaction between a regulator and its consensus sequence is fairly
strong, it was hypothesized that it may be possible to isolate the FadR-like protein from P.
aeruginosa lysate using the fadB5 consensus sequence. Briefly, the strategy involved
concatamerizing the fadB5 consensus sequence by peR using biotinylated primers and
then attaching the conca tamers to streptavidin magnetic particles via biotin-streptavidin
interactions. In theory, incubation of these concatamer-bound-streptavidin magnetic
particles with P. aeruginosa lysate, should allow the separation of proteins that interact
80
PfadBA5 TC<XlGATGGCTGATTGACAATTa:cooc I I I IGCCGGAATGTGTGCGCACCCAAGTCAAAc=GTATGAATCGAGCGTTTGCCT
CGalCAGGCCTCGI\CAATAGAGACCCGGTTATCGCGTCGGCalGTGTGCCGAAGGGTTTGGGO.CTATGCTCG3CGG1 I GCCGI\<\. •• G
GGTCCCGACACGCI:GTCCGATGTGTAAGTTCMGCTTCCATAATAGCGTGGAGATCAGTTGATGATTTACCMGGTAAAGCQt\TCA
.MIYQGKAI
CGGfTAAGCCTCTTGAGGGCGGCATCGTCGAGrTGAATTTCGI\TCTCAAGGG::GAGTCCGTCAACAAGTTCMCCGTCTCA=rC
.T v K P LEG G I VEL N F 0 L K G E S V N K F N R L T L
AGTGAGTTGCGTa:GGCAGTCGATGCGATG.6AGGCCGATGCATCGGTCA
.SELRAAVDA I KADASV
PfadE ACCACCACCG:lGTGGrCACTATCCACGAAG::GGCCXlGATTGTAGGrAGGACTGCATGGCOOGCTo:;cGi'IXlGGCAATTTGrGCCAGT
CTAAACGGGAAGTTTTCGCCTAT AACGTGACAAAa;COOGCCAA~TGA=rGCXX'J;;cAAA(X'llCl'eCAAA=AAG:JI'
CGA~=CTTCATOOAGGATT~TGTTGTT~TCTOOTTAGrCGTACTGGTACTCOOTGT~ACCT=
.ML LLWLVVLVLGVAYLA
CATCOOCGTACCCCACCCGCr=DGGCATCA=ACCTGATCCTGATOOGCGTGTTCAGCCACXlCGCOCGGCTGG
.HRRTPPAPALGI SAAYLI LMGVFSHAPGW
CTGCTGCTGGrCTTCTGGCT
.LLLVFW
PfabAB GGGCGITCGOOAGAACTGCCTGCAOOCGGG>.ATGAACGATTACCTGGCCMGCCATTCAAACGGOCGGAATTGCAACGC'ATACTGC
AACGCfGGATCGGCTCGCA~CT=GACGTOOAACGAAAC<XlGACGI\GGOOAGCCXlGAATGATCTACGACAA=
GCAA~CXlCGGGAATAAAGTGAACATcrGTT=GG6.CACTGTGAcrTTCACCGC'AACGCAACAGrCTATGACTAGGCTOOC
GCTGCGACGa;GATACAATAACCCOOCGCGACGGa;GCTOOACGAACCGCCACAACCCT~GTTCAGGGO.TTTTTGAOOAGCTCG
CATGfJCG.6AlCAACACGCCTTCAca;GAGAAGAccrGCT=T~GTOGCGGCGAGCTGTT=AACGCGCAACTTC
.M T K Q H AFT RED L L R C 5 R GEL F G P G N A Q L
CCGCCX;CCAAC .p A P N
Figure 22. Promoter region of fadBA5, fadE, and fabAB. Indicated are the putatative consensus sequences (underlined) and transcript start sites (bold) upstream of the start codon. Consensus sequences are found either overlapping with (fadBA5) or downstream of (fadE) the transcript start site, while the consensus sequence is upstream of both transcript start site of fadAB. Transcript starts sites were previosly determined by primer extension in our laboratory, and the transcript start site of fadBA5 substantiated using a promoter mapping prediction program from http://mendel.cs.rhul.ac.ukImendel.php (37).
81
with the consensus sequence from those that do not. Unbound proteins can later be
separated from the bound protein with the use of a magnetic particle separator (Figure
23). Elution of the bound protein revealed some degree of purification (Figure 24). The
FadR protein in E. coli is approximately 27 kDa, a few major bands corresponding to that
approximate molecular weight was partially purified and may have the potential to
regulate the JadBA5 operon.
5.2.3 DNA-binding studies using consensus sequence-purified extract
To verify that the partially purified protein extract is able to bind to the JadB5
promoter region, as well as test its ability to bind to the JabA promoter, EMSA studies
were conducted. A -120 bp sequence encompassing the promoter region ofJadB5 was
incubated with the purified protein extract and resulted in a clear shift (Figure 25). To
determine if this protein-DNA interaction is limited to the JadB5 promoter region the
protein extract was also tested with the JabA promoter region. In the presence of the
partially purified protein extract, the amplified JabA promoter region, which contains two
consensus sequences, also resulted in a shift (Figures 22 and 25). In order to rule out any
sort of non-specific DNA-binding interactions, a competitor assay was also conducted
where increasing concentrations of unlabelled PlabA was added to the binding reactions to
compete with the biotin-labeled PlabA. In theory, by increasing the concentration of the
unlabeled PlabA, the DNA-binding protein is titrated away from the labeled PlabA, resulting
in the labeled P fabA migrating through the gel as it normally would in the absence of
DNA-binding proteins. The results of these experiments are shown in Figure 25. As the
concentration of unlabeled P labA is added to the reaction, the shifted band gradually
82
M"llJl'lIio P"IIicIe
! S treptov;din
d+ • III III II
t PCA ampIlied bictinyJated oligo
1 , ..... -~-"'" o
1'-~~'--I .. I III II
I III III '1 ~088~ DNA·binding protein I--a a a =ONA.binding
Figure 23. Principle of the purification of DNA-binding protein. Consensus sequence of fadBA5 promoter region is concatmerized using PCR with a biotinylated primer. Amplified PCR product is then incubated with streptavidin magnetic particles. When PAO I clarified extract is applied to the magnetic particles, the DNA-binding protein is captured by the oligo-particle complex due its affinity to the consensus sequence concatamers whereas non-specific proteins do not bind. Application of a magnetic particle separator and several washing steps is used to separate the bound protein from the supernatant. The specific DNA-binding protein is then eluted from the immobilized particles with a high salt buffer.
83
kDA
97.2 -
66.4
42.7
36.5
26.6
20.0
14.3
----
--
1 2
Figure 24. Streptavidin magnetic particle-purified extract. PAO 1 clarified extract was purified using concatamerized j ildB5 consensus sequence amplified using oligos 499 and 504 (biotinylated at 5' -end). Concatamerized sequence was attached to magnetic beads via biotin-streptavidin interactions. Lane 1, protein marker, and lane 2, purified extract.
84
DNA • • • • • •
~ ( unlabelled)
DNA + • + + + • + + + + (labeled)
EXTRACT • + + • + + + + + +
1 2 3 4 5 6 7 8 9 10
Figure 25. Gel shift assay experiment performed with 120 bp PjadB5 and 320 bp PjabA
fragments labeled with biotin at the 3' -end. Streptavidin magnetic particle-purified extracts were incubated with the DNA probes. Lane I, labeled Pjad8J alone; lane 2, purified extract; lane 3, labeled PjadBJ incubated with extract; lane 4, labeled PjabA alone; lane 5, labeled PjabA incubated with extract; lane 6, purified extract alone; lanes 7-1 0, labeled PjabA incubated with extract with increasing concentration of unlabeled PjabA.
85
decreases as the DNA-binding protein is titrated away from the labeled PpM sequence.
At the highest concentration of unlabeled P JabA, the labeled P JabA fragment migrates
similar to the DNA alone control lane.
5.2.4 Identification of DNA-binding Protein by LC-MS
To identify the proteins that were partially purified using the fadE5 consensus
sequence, liquid-chromatography mass spectroscopy (LC-MS) was applied. Initial
identification attempts were made using N-terminal sequencing by Edman degradation
but due to the small quantities of protein obtained and purity issues, this method did not
prove feasible. Rather, collaborative efforts were made to the protein through LC-MS
which basically involved running the partially purified protein extract through a 10%
SDS-PAGE gel and excising the band of interest. The excised band was then extracted
and treated with trypsin prior to the LC-MS run. The software used had limitations in that
a P. aeruginosa database was not available, and only protein sequences in E. coli were
generated. Attempts were made to BLAST those protein sequences to the P. aeruginosa
database to identify potential homologues in P. aeruginosa but no similarities were found.
Alternatively, peptide fragment sequences that were assigned high scores were used to
BLAST directly against the P. aeruginosa genome and a few transcriptional regulators
were identified. The highest scored protein that corresponded to a transcriptional
regulator was ORF PA5525.
5.2.5 DNA-binding studies using E. coli Lysate
86
Since the identity of the potential transcriptional regulator P A5525 was initially
determined by protein purification and DNA-binding assays, to verify this DNA-binding
interaction electrophoresis mobility shift assays were performed as described above.
Briefly, the PA5525 region was amplified from P. aeruginosa chromosomal DNA, to
include the upstream region and cloned into the cloning vector pUC18. The vector
pUC18-PA5525 was then introduced into the E. coli transcriptional fusion strain HPSl
I..attB::pCD13PSK-P/adBs-lacZ. The lysate from the E. coli transcriptional fusion strain
was used for EMSA studies (Section 2.10.1).
The lysate from pUC18-PA5525 as well as pUC18 harboring cultures were
incubated with labeled PfadB5 and the migration of the DNA bands was compared. The
results from the electrophoresis mobility shift assays are shown in Fignre 26. The
addition ofpUC18-PA5525 lysate caused a clear shift in the PfadB5 band as expected. The
pUC18 control vector did not exhibit a similar banding pattern as its PA5525 derivative
and the PfadB5 band is clearly not affected by the presence of the pUCl8 vector. As shown
in Figure 26, the position of the PfadB5 band does not shift and remained at the same
position as the DNA alone control.
To establish whether the shift in the PfadB5 fragment was due to specific or non
specific interactions, the DNA-binding studies were repeated with labeled PfabA and glpD
fragments. The results from the experiments are shown in Figure 27. As observed
previously the addition ofpUC18-PA5525 lysate caused the PfadB5 fragment to disappear
but a discrete shifted band was not observed. Likewise, the lysate appears to be able to
interact with both PfabA and glpD fragments since the addition of the pUC18-PA5525
87
DNA + • + • + Extract
• + + + +
1 2 3 4 5
Figure 26. Gel shift assay experiment performed with 120 bp PjadB5 labeled with biotin at the 3'-end (see Section 2.10.5). Cmde extract was obtained from E. coli transcriptional fusion (HPS l-},attB::pCD 13PSK-PjadB5-lacZ) cultures harboring pUC18 or pUC18-PA5525 during stationary phase and incubated with labeled probes. Lane I, biotinlabeled PjadB5 alone; lane 2, pUC 18 extTact alone; lane 3, biotin-labeled PjadB5 incubated with pUC 18 extract; lane 4, pUC18-PA5525 extract alone; lane 5, biotin-labeled PjadB5 incubated with pUC 18-PA5525 extract.
88
DNA - + + + + + +
Extract + - + - + - +
1 2 3 4 5 6 7
Figure 27. Gel shift assay experiment performed with 120 bp PladB5, 320 bp PlabAD. or 400 bp glpD fragment labeled with biotin at the 3' -end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (HPSI-AatlB::pCDI3PSK-PladD5-lacZ) cultures harboring pUC I 8-PA5525 during stationary phase and incubated with labeled probes. Lane I , pUC I 8-PA5525 extract alone; lane 2, biotin-labeled PladB5 alone; lane 3, biotin-labeled PladB5 incubated with pUC18-PA5525 extract; lane 4, biotin-labeled PlabAD
alone; lane 5, biotin-labeled PlabAD incubated with pUCI 8-PA5525 extract; lane 6, biotinlabeled glpD alone; lane 7, biotin-labeled glpD fragment incubated with pUC I 8-PA5525 extract.
89
lysate resulted in the disappearance of the respective bands, although nuclease activity
may have contributed to the results.
5.2.6 Assessing the regulatory potential of P A5525 by expressing the respective gene
products in the E. coli PfadBS-lacZ transcriptional fusion
To address the issue of nuclease activity and provide further insight into the
potential interaction between the PA5525 gene product and the promoter region offadB5,
the effect of expressing PA5525 on the fadB5 promoter in the E. coli transcriptional
fusion strain (HPSI-I..attB::pCD13PSK-PfadBS-lacZ) was studied. Using the same E. coli
transcriptional fusion strain from which lysate was obtained for gel shift experiments
(Section 5.2.5) 13-galactosidase assays were performed at various points throughout
growth (Figures 28 and 29). Comparison of the growth rate and final cell density of
strains harboring pUC18 and its PA5525 derivative show no significant differences
through out the growth phases (Figure 28). Measurements were taken during mid-log,
early stationary, and late stationary phases for pUC18 and pUC18-PA5525 harboring
strains. Comparisons of 13-galactosidase activity in pUC18 harboring strains to pUC18-
PA5525 harboring strains showed no significant differences. The promoter activity of
PfadBS increased slightly throughout the growth phase in the presence of the pUC18 vector
(Figure 29). A similar trend was observed with pUC18-PA5525, although an increase in
promoter activity was not detected during the transition from early- to late-stationary
phase. The results from this experiment show the expression ofPA5525 appears to affect
PfadBS during the later phases of growth in particular during the late-stationary phase.
90
3 LS
! M
2 l
O~------r-----~------~----~ o 10 20 30 40
Time (h)
---0-- pUC18
~ pUC18-PA5525
Figure 28. Growth curves of E. coli transcriptional fusion strains HPS 1-AattB::pCD13PSK-PjadB5-lacZ harboring pUC18 or derivative encoding PA5525, grown in LB + Ap media Cultures were induced with 1 roM IPTG at time = 1 h. Activities were measured at three time points during the course of growth, ML, mid-log; ES, earlystationary, and LS, late-stationary.
91
30 00
25 00 f:h
200 0
15 00
10 00
500
co :Q co
i ..
~ ... ... ... u
~ u u
;:) ;:) ;:) .,
a. D. a. a. f , , , co co co ... ... ... u u u ;:) ;:) ;:) a. a. a.
Mid-iog Early Late Stationary stationary
Phase/Strain
Figure 29. Transcriptional regulation of PfadBS -lacZ fusion in the E. coli transcriptional fusion strain HPSl-AattB::pCD13PSK-P.fadJIs-lacZ in the presence of pUC18 encoding PA5525 or the empty vector, grown in LB + Ap media. Cultures were induced with I mM IPTG 1 h following inoculation. Activities were measured at three time points during the course of growth, mid-log, early-stationary, and late-stationary. The values represent the mean ± the standard deviation (n = 3).
92
5.2.7 Ammonium sulfate precipitation
In an attempt to optimize the protein purification protocol, P. aeruginosa PAD 1
clarified lysate was subjected to ammonium sulfate precipitation. Using increasing
concentrations of ammonium sulfate, proteins in the crude extract were gradually
precipitated out and collected as fractions for DNA-binding studies. Ammonium sulfate
precipitation is a widely use protocol as an initial step in protein purification and rarely
affects protein activity. These attributes made this protein purification protocol an ideal
extension to the previous protein purification scheme. The rationale was to fractionate the
crude P. aeruginosa PAOllysate and test whether each fraction is capable of interacting
with the promoter region offadB5. This interaction would be determined by performing
gel shift assays using the various fractions collected. The intent was to further process
any fraction that was capable of causing the PjadBS fragment to shift by ion-exchange
chromatography followed by a final streptavidin magnetic particle separation step (as
described in Section 2.10.4). The results from the DNA-binding studies using ammonium
sulfate precipitate lysate are shown in Figure 30. Briefly the experiment involved adding
ammonium sulfate to 30% and then 5% increments thereafter to 60%, followed by a final
precipitation step at 80%. Precipitated proteins at each step was collected by
centrifugation then resuspended and dialyzed against 10 roM Tris-HCI prior to DNA
binding studies. Although the addition of lysate corresponding to 50% and 80%
precipitation cuts caused the disappearance of the PjadBS band, a discrete shifted band was
not observed in either case. This suggested non-specific interactions or nuclease activity
rather than isolation of a DNA-binding protein. Unexpectedly, the banding pattern of the
precipitated proteins remained relatively constant throughout the ammonium sulfate
93
precipitation steps. A difference was only observed after the addition of 80% ammonium
sulfate.
94
DNA - 1+ - 1+ - 1+ - 1+ % Ammonium Sulfate 35 40 45 50
123 4 5 6 7 8 9
D A - 1+ % Ammonium Sulfate 80+
1 2 3 4 5 6 7 8 9
Figure 30. Gel shift assay experiment performed with 120 bp PladB5 labeled with biotin at the 3' -end (see Section 2.10.5). Crude extract from P. aeruginosa P AO I was subjected to step-wise ammonium sulfate precipitation. Labeled PjadB5 was incubated with resolubilized and dialyzed protein precipitate. Lane I, labeled PjadB5; alone, lanes 2, 4, 6, 8; labeled Plad!]) incubated with extract (% refers to ammonium sulfate concentration used to precipitate protein); and lanes 3, 5, 7, 9; respective extract alone.
95
Chapter Six: Transposon mutagenesis
6.1 Introduction
Transposon-based mutagenesis approaches have been successfully used in the
identification of a variety of genes in a range of microorganisms. In P. aeruginosa,
regulators involved in adhesin expression have been recently identified using transposon
based mutagenesis (69). Several transposon mutagenesis tools are available and have
been demonstrated to be functional in P. aeruginosa including pBT20 (69) and pTnMod
O-Gm (20). The combination of transposon mutagenesis and fatty acid metabolism gene
fusions should allow for the development of a screen to identify possible fatty acid
metabolism regulators. In the absence of an exogenous source of long-chain fatty acids,
Jad genes in E. coli are repressed since FadR is bound to its cognate Jad operators.
Therefore, the disruption of the JadR gene should theoretically relieve repression of these
Jad genes. Based on the assumption that the FadR homologue acts as a repressor ofJad
genes in P. aeruginosa, subjecting aJad-reporter strain to transposon mutagenesis should
allow for the identification of FadR-like protein(s). The promoter region ofprobableJad
gene fused to the lacZ-reporter gene can be integrated in the chromosome of P.
aeruginosa and this strain subjected to transposon mutagenesis grown under repressive
conditions. Disruption of the JadR gene should relieve repression and result in an
apparent 'upregulation' oftheJad gene that would appear as more intensely blue colonies
on an appropriate indicator medium (Figure 31). The target of this transposon-based
mutagenesis strategy will be the P. aeruginosa transcriptional fusion strain PAOl
attB::P/adB5-1acZ. The basis of this approach is similar to the bioinformatic approach
discussed in Chapter 4, but rather than constructing
96
Under non-;nducing condmons - absence 171' exugenous l'alty adds ;acyI-CoA)
WTcell
RNA polymerase ,... 0 = FadR
~ Gr
Tmngposun mutant ,...8 x
I'adR.:"Tn Pl'ad&45-1aaZ"
Figure 31. Principle of the transposon mutagenesis screen used to find the FadR-like protein in P. aeruginosa. Upper panel depicts wild-type PAOI-attB::PjadBAs-lacZ cell in the absence exogenous fatty acid. FadR is expressed from the fadR loci and binds to the promoter region of the fadBA5-1acZ fusion repressing transcription of lacZ. The absence of ~-galactosidase leads to the formation of white colonies on media containing X-gal. Bottom panel shows the disruption of the fadR loci by transposon insertion under the same conditions. Inactivation of fadR relieves repression of fadBA5-1acZ, allowing for the expression of ~-galactosidase, which leads to the formation of blue colonies.
97
particular mutants of interests based on bioinformatics, a screen was used to identifY
other potential transcriptional regulators. The location of the transposon integration sites
will be determined by low-stringency PCR followed by sequencing and any probable
transcriptional regulators identified will be characterized using a variety of approaches.
These approaches, similar to experiments performed previously on other potential FadR
candidates include investigating the effect on fadB5 in P. aeruginosa and E. coli
transcriptional fusion strains and electrophoresis mobility shift assays with P fodBj.
6.2 Results
6.2.1 Transposon mutagenesis and insertion sites
Transposon mutants in strain PAOI-attB::PjadBs-1acZ were obtained using the
vector pBT20. Colonies that appeared more intensely blue on PIA + Om + X-Gal were
selected and the insertion sites detennined by low-stringency PCR as described in
Section 2.S. Table 7 lists the location of the insertion sites and the corresponding
functional class of the ORF disrupted. The apparent upregulation ofPjadBj resulted from
the inactivation of various types of genes including those involved in fatty acid
metabolism, two-component regulatory system and transport molecules. A significant
proportion of the transposon insertions occurred in genes involved in LPS biosynthesis
(Figure 32). Most importantly, among the inactivated genes were a few probable
transcriptional regulators PA2601, PA3006 and PA3508. The gene products ofPA2601,
PA3006, and PA3508 are classifed as LysR-, TetR-, and IclR-type regulators respectively.
Various studies were performed to assess the regulatory potential of these probable
transcriptional regulators.
98
Table 7. Transposon Insertion Sites
Accession F ..... oo .... on Number PA0005 probable acyltransferase PA0257 hypothetical protein PA0296 probable glutamine synthetase PA0413-0414 still frameshift probable component of chemotactic signal
transduction system PA0910 hypothetical protein PA0938 hypothetical protein PAI505 molybdopterin biosynthetic protein A2 PAI580 citrate synthase PAI833 probable oxidoreductase PA2601 probable transcriptional regulator P A2705 hypothetical protein P A3006 probable transcription regulator P A3141 nucleotide sugar epimerase/dehydratase WbpM PA3145 glycosyltransferase WbpL P A3146 probable NAD-dependent epimerase!dehyratase WbpK PA3147 probable glycosyl transferase WbpJ P A3 148-3 149 probable UDP-N-acetylglucosamine 2-epimerse WbpI PA3149 probable glycosyltransferase WbpH PA3155 probable aminotransferase WbpE PA3155-3156 probable aminotransferase WbpE P A3156 probable acetyltransferase WbpD P A3158 probable oxidoreductase WpbB P A3159 probable UDP-glucose/GDP-mannose dehydrogenase WbpA PA3219 hypothetical protein PA3238 hypothetical protein P A3414 nucleotide sugar epimerase!dehydratase WbpM P A3508 probable transcriptional regulator PA3577 hypothetical protein PA3716 hypothetical protein PA3798 probable aminotransferase PA3835-3836 hypothetical protein PA3865-3866 probable amino acid binding protein - pyocin protein PA3868 hypothetical protein PA4454-4455 hypothetical protein PA4455 probable permease of ABC transporter PA4696 acetolactate synthase ill large subunit
99
# of times inactivated
2 I I I
2 I I I I I I 3 2 2 2 I I 2 1 1 1 8 4 1 1 I 2 I I 1 1 1 I 1 1 1
Accession Fnnction
Number PA4852 hypothetical protein PA4999 hypothetical protein PA4999-5000 hypothetical protein-probable glycosyl transferase PASOOO probable glycosyl transferase PAS022 hypothetical protein PA5162-5163 dIDP-4-dehydrorhamnose reductase P A5163 glucose-I-phosphate thymidylyltransferase PA5448 glycosyltransferase WbpY PAS454 oxidoreductase Rmd PAS474 probable metalloprotease PA5529 probable sodium/proton antiporter PAS563 chromosome partitioning protein Soj
# of times inactivated
I I I I 1 1 1 1 1 1 1 1
6.2.2 Characterizing PA01-attB::PfadBs-lacZl/ifadR::Tn (pA2601, PA3006
and P A3508) by /I-galactosidase assays
To investigate the effect of transposon insertions in PA2601, PA3006, and
PA3508, the mutated fusion strains were grown in media in which the P/adBSpromoter has
been previously shown to be repressed (see Section 3.2.2). Similar to the rationale
described in Section 4.2.2, if one of these genes encodes a repressor of the fadBA5
operon, an insertion mutation would prevent the gene product from being expressed thus
relieving repression (see Figure 31). This de-repression can be directly observed through
~-galactosidase assays. Briefly, the Pseudomonas transcriptional fusion strain PAOI-
attB::P/adBs-1acZ along with the transposon mutated derivatives (M'A2601::Tn,
M'A3006::Tn, and M'A3508::Tn) were grown in LB, media in which the PfadBS promoter
was shown to be repressed and ~-galactosidase activities measured at various growth
phases and compared. The results from these experiments are shown in Figures 33 and
100
Related to phage, transposon,or
plasmid 1
Putative enzymes 5
Cell division
Transcriptional regulators
6
1 --------------
Hypothetical, unclassified, _------
unknown 14
Transport of small molecules
1
Translation, post· translational modification, degradation
1
Amino acid biosynthesis and
metabolism 1
Biosynthesis of cofactors,
::::~~_------Pro:.~~:groups '" and carriers
1
Membrane proteins 6
Cell wall
26
Fatty acid and phospholipid metaboliem
2
Energy metabolism 1
ChemotaxisfTwocomponent
regulatory systems 1
Figure 32. Transposon insertion sites grouped according to functional class, The transcriptional fusion strain PA01·attB::PjadBS-1acZ was subjected to transposon mutagenesis using the mini-transposon vector pBTIO and blue-white selection performed on PIA + Om + Xgal, Blue colonies were grown and the transposon insertion sites determined by low-stringency peR and sequencing. Shown are the number of transposon insertion mutants grouped according to different functional classes.
101
34. Figure 33 shows the growth curve of PAOl-attB::PjadBs-lacZ along with the
transposon mutated derivatives grown in LB media. The growth rate of all the transposon
mutants were comparable to that of the control strain PAOl-attB::PjadBs-1acZ with the
exception of M>A3508::Tn, which started to deviate slightly during late log phase. The
fina1 cell density of M>A3508::Tn was also different, reaching a density of approximately
65% of the control strain. To obtain an accurate assessment offadE5 promoter activity, p
galactosidase activities were measured at early-log, twice during mid-log, late-log, and
early-stationary phases. Since these ORFs represent potential repressors of the fadB5
operon, and increase in p-galactosidase activity was expected compared to the control
strain. The results from the f3-galactosidase experiments are shown in Figure 34. As
expected the P-galactosidase activity of the control strain PAO l-attB::PjadBs-lacZ was low
and remained low throughout all growth phases. Inactivation ofPA2601 and PA3006 by
transposon mutagenesis both caused a de-repression of the fadE5 promoter and a
significant increase in f3-galactosidase activity was observed. Activity of the fadE5
promoter in the M> A260 I ::Tn strain was approximately five-fold greater than observed in
the control strain and gradually decreased to approximately two-fold at early stationary
phase. The PjadBS promoter activity in the M>A3006::Tn strain was approximately three
fold greater during early-log phase and increased to approximately seven-fold and
remained relatively constant throughout the remainder of the growth phases. Surprisingly,
disruption of PA3508 did not appear to affect the promoter activity of fadB5 to a
significant extent, with f3-galactosidase activity measurements remaining close to that of
the control strain throughout all growth phases.
102
6~----____________________ ~
4
---0-- PA01-attB::PradBl>lacZ
= = ~ 2601::Tn 'CI Q 0 --0-- 3006::Tn
to 3508::Tn 2
o~~ __ ~ __ ~ ____ ~ ____ ~ __ ~
o 10 20 30 40 50
Time (h)
Figure 33. Growth curves of P. aeruginosa transcriptional fusion strains PAOIattB::PfodBS-1acZ and transposon mutant derivatives (M'A2601::Tn, M'A3006::Tn and M'A3508::Tn) grown in LB media. Indicated are the time points at which ~-ga1actosidase activities were measured, EL, early-log; MLl, mid-log I; ML2, mid-log 2; LL, late-log, and ES, early-stationary.
103
800
r
T
n ~] m ,
i f. E E ! E E f. i r: E c ! f. E E j E {:. c J;: J;:
"" I • i .;;
• i :li .;; "" • • i z .;; ~
.. !i! ~ !i! I ~ .. ! ~ OJ l i , i i , ~ ~ ~ ~ p
0 0 0 ~
0 f f f f
Early log Mid log Mid log Late log Early
Phase/Strain Stationary
Figure 34. Transcriptional regulation of P/adBs-lacZ fusion in the P. aeruginosa transcriptional fusion strain PAOl-attB::P/adBs-1acZ and transposon mutant derivatives (M'A2601::Tn, M'A3006::Tn and M'A3S08::Tn) grown in LB. /3-galactosidase activities were measured at five time points, EL, early-log; MLI, mid-log I; ML2, mid-log 2; LL, late-log, and ES, early-stationary. The values represent the mean ± the standard deviation (n = 3).
104
6.2.3 Assessing the regulatory potential of P A2601, P AJ006 and P AJ508 by
expressing the respective gene products in the E. coli p/adBS-lacZ
transcriptional fusion strain
To elucidate the potential interactions between the PA2601, PA3006, and PA350S
gene products and thefadB5 promoter region, the respective ORFs were cloned into the
cloning vector pUC18 and transformed into the E. coli P/adBj-lacZ transcriptional fusion
strain HPSl-AattB::pCD13PSK-P/adBs-lacZ. Similar to the experiments described in
Seetions 4.2.4 and 5.2.6, the E. coli transcriptional fusion strains harboring pUC1S and
the derivatives were grown in LB + Ap and li-galactosidase assays performed during
mid-log, early-stationary and late-stationary phases following induction with 1 mM
lPTG. If the gene products of any of these genes bind to the promoter region of fadB5
then expression of these genes in the transcriptional fusion strain should repress the
fadB5 promoter causing a decrease in p-galactosidase activity compared to the control
strain (harboring pUC1S). The results from these experiments are shown in Figures 35
and 36. The growth curve of the various transcriptional fusion strains are shown in
Figure 35. Comparison of the growth rate and final cell densities show no significant
differences between the control strain harboring pUC1S and its derivatives. The results
from the P-galactosidase assays are shown in Figure 36. The activity observed in the
pUC18 strain was relatively high and increased slightly throughout the growth phases.
Both PA3006 and PA350S derivatives showed consistent reduction in activities of
approximately 35% compared to the control strain throughout growth whereas a decrease
in activity in the P A260 1 derivative was not observed until late-stationary phase. The
results from these experiments show that the gene product ofPA3006 and PA350S affect
105
3
ML -----fr-- pUC18
2 ~ --<>-- pUC18-PA2601
~ pUC18-PA3006
= = :6 pUC18-PA3508 \C> = 0
O~~----r-----~-------r----~ o 10 20 30 40
Time (h)
Figure 35. Growth curves of E. coli transcriptional fusion strains HPS 1-AattB::pCD13PSK-PfadBs-1acZ harboring pUC18 or derivatives encoding PA2601, PA3006 or PA3508, grown in LB + Ap media Cultures were induced with 1 mM IPTG at time = 1 h. Activities were measured at three time points during the course of growth, ML, mid-log; ES, early-stationary, and LS, late-stationary.
106
3000,-____________________________________ ~
T
2500.
500
o· • • CO ~ co co co ~ ... co CO ~ CD co ~ co co 51 ~ co .. co ~ CO co
~ U CD co U CD co .. U
~ ~ ~ ~ .. f ~ ~ ::> ~
::> ::>
'" '" '" , , CD CD CD co CD co
~ ~ ~ ~ ~ ~ ~ ~ ~ u u u u u u u u u ::> ::> ::> ::> ::> ::> ::> ::> ::> '" '" '" '" '" '" '" '" '" Mid-log Early Late
Stationary Stationary
Phase/Strain
Figure 36. Transcriptional regulation of p/adBS-1acZ fusion in the E. coli transcriptional fusion strain HPSl-AattB::pCD13PSK-P/adBs-1acZ in the presence of pUC 1 8 encoding either PA2601, PA3006, PA3508 or the empty vector, grown in LB + Ap media. Cultures were induced with 1 mM lPTG 1 h following inoculation. Activities were measured at three time points during the course of growth, mid-log, early-stationary, and latestationary. The values represent the mean ± the standard deviation (n = 3).
107
the promoter region of PfadBsthroughout all growth phases whereas the effect ofPA260l
was delayed and was only observed during later phase of growth.
6.2.4 DNA-binding studies using E. coU Lysate (pUC18 and PA2601, PA3006, and
PA3508 derivatives)
To obtain more insight into the potential interactions between the gene products
of PA260l, PA3006, and P3508 and the fadE5 promoter, DNA binding studies were
included. Using lysate from the E. coli transcriptional fusion strains used in the p..
galactosidase assays experiments described above in Section 6.2.3, DNA-binding studies
were performed on PfadBS. The results from these DNA-binding studies are shown in
Figures 37 and 38. Figure 37 shows the results from the experiments with PA3006 and
PA3508. Although the PfadE5 band disappears upon addition of the PA3006 lysate the
banding pattern observed is comparable to that seen with the pUC18 control lysate. On
the other hand, the addition ofPA3508lysate caused a clear shift in the PfadB5 band, and
a discrete shifted band was observed producing a banding pattern quite distinct from the
control. As shown in Figure 38, PA2601 did not appear to interact with PfadBS as the
PfadBS band remained unshifted and the banding pattern ofPA260l and the control were
relatively similar. The results from these experiments show that when the DNA and
protein elements are isolated from a system, PA3508 appears to be the only protein
capable of interacting with PfadBs.
6.2.5 A closer look at P A3508
Although inactivation ofPA3508 by transposon mutagenesis in the P. aeruginosa
108
D A + • + • + • +
Extract • + + + + + +
1 2 3 4 5 6 7
Figure 37. Gel shift assay experiment performed with 120 bp PladB5 labeled with biotin at the 3'-end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (HPS 1-J.aIlB :: pCDl3PSK-PladBylacZ) cultures harboring pUC IS, pUCIS-PA3006 or pUCIS-PA350S during stationary phase and incubated with labeled probes. Lane I , biotin-labeled PladB5 alone; lane 2, pUC 18 extract alone; lane 3, biotin-labeled PladB5 incubated with pUCIS extract; lane 4, pUCIS-PA3006 extract alone; lane 5, biotinlabeled PladB5 incubated with p CIS-PA3006 extract; lane 6, pUC18-PA3508 extract alone; lane 7, biotin-labeled PladB5 incubated with pUCIS-PA350S extract.
109
DNA + - + - +
Extract - + + + +
1 2 3 4 5
Figure 38. Gel shift assay experiment perfonned with 120 bp PlodBs labeled with biotin at the 3' -end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (HPS l -AnIlB: :pCD 13PSK-P/adBS-lacZ) cultures harboring pUC18 or pUC 18-PA2601 during stationary phase and incubated with labeled probes. Lane I, biotinlabeled P/odBS fadB5 alone; lane 2, pUC 18 extract alone; lane 3, biotin-labeled PlodBS incubated with pUCl8 extract; lane 4, pUC18-PA2601 extract alone; lane 5, biotinlabeled PlodBS incubated with pUC 18-PA260 1 extract.
110
transcriptional fusion strain did not produce an increase in f3-galactosidase activity as
expected, the gene product does appear to interact with the promoter region of fadB5.
Evidence of this is based on data obtained from the E. coli transcriptional fusion studies
and in particular the DNA-binding experiments. A closer examination of genes
surrounding PA3508 also strengthens the case that PA3508 may be involved in regulating
fatty acid metabolism. In P. aeruginosa, transcriptional regulators are usually clustered
around genes that they control and analysis of regions up and downstream of P A3508
reveals a number of probable fatty acid metabolism related-genes (Figure 39).
Collectively, the results from the experiments performed suggest that PA3508 is an ideal
candidate for further studies.
To address the issue of non-specific interaction several approaches were taken.
Since it is assumed that the gene product of P A3508 is responsible for the shift in PjadBj
that was observed, decreasing the concentration of PA3508 should cause the PjadBS band
to migrate norma1ly. Therefore to test this hypothesis the gel shift were repeated across a
gradient ofPA3508 lysate concentrations. The results from the experiments are shown in
Figure 40. It is apparent from the figure that at higher concentrations, the PjadBS fragment
is shifted whereas a gradual decrease in P A3508 results in the disappearance of the
shifted band and the re-appearance of the PjadBS at its normal position. Thus it would
appear that the gene product of PA3508 is responsible for the PjadBs shift. Since FadR in
E. coli is capable of interacting with both fad genes and the fabAB operon it would be
interesting to determine whether PA3508 has the same ability. Consequently, to test
whether the gene product of PA3508 is capable of binding to the promoter region of
fabA, the gel shift experiment was repeated across a gradient of P A3508 lysate
111
G ~
s § IJ ~ '$ .c1SiJ
1. ~ ..§>
I ~ 'i -8 '5 .~
.~ ~ ·fi .S; .~ ..... I .g ~
<t1 .e-Ii ~ ~ ~ -e 9 ?} ~ ~ ';'Q, tJ ~ -g
<t1 -& ~ ,g ~ ~ .s: ..:::t ;& ..,'!:.> ..... -2 ..,'!:.> ~ ~ .Jj -c) <i' .1 <i' -h I ~ ~ '8 '8 0
.$ ~ ~ G. ~ ~ Q,
PA3505 PA3506 PA3507 PA3508 PA3509 PA3510 PA3511
< < < < < < < I
Figure 39. Organization of genes surrounding the PA3508 locus. PA3508 encodes a probable transcriptional regulator that belongs to the IclR-type family of regulators. Found adjacent to the PA3508 ORF are probable short-chain dehydrogenases, genes that are potentially involved in fatty acid metabolism.
112
DNA + - + + + + + + +
Extract - +
1 2 3 4 5 6 7 8 9
Figure 40. Gel shift assay experiment performed with 120 bp PjadBs labeled with biotin at the 3' -end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (BPS 1-2atlB::pCD13PSK-PjadBs-lacZ) cultures harboring pUC18-PA3508 during stationary phase and incubated with labeled probes. Lane I, biotin-labeled PjadBS alone; lane 2, pUC18-PA3508 extract alone; lane 3-9, biotin-labeled PladB5 incubated with gradual decreasing concentrations of pUC18-PA3508 extract.
113
concentrations using the promoter region of JabA as the probe. The results from the
experiments are shown in Figure 41. It is evident from the results that the product of
PA3S08 is capable of causing a definite shift in the PfabA fragment. The pUC18 extract
also appeared to cause a shift in the P fabA fragment; however, the shift was not as distinct
as the band observed with the PA3S08 extract suggesting non-specfic rather than specific
interactions. Figure 41 also shows that as the PA3S0S concentration is reduced the
shifted band appears at lower position in the gel and finally at the lowest concentration
re-appears as a faint band at its normal position. This observation may give insight into
the structural nature of the PA3S0S gene product when it binds to its target DNA
sequences. Based on these observations there is strong evidence that P A3S08 does indeed
interact with the promoter regions of both JadB5 and JabA. strengthening the hypothesis
that fatty acid degradation and biosynthesis are coordinately regulated in P. aeruginosa.
As a final examination, the PA3S08 gene product was expressed and isolated as a His
tagged protein, and the next objective was to subject the purified protein extract to gel
shift assays to demonstrate a shift in bothJadB5 andJabA fragments.
Briefly, the P A350S ORF was cloned in-frame into the expression vector pET2Sa
and expressed in the E. coli strain ER2566. Figure 42 shows the clarified lysate of the
expression strain prior to and after induction with I mM IPTG. The induced protein is
approximately 30 kDa agreeing with the predicted molecular weight of PA350S. The
induced lysate preparation was then purified on a Ni+-NTA column and eluted with high
salt buffer (as described in Section 2.10.2). The PA350S gene product was purified to
near homogeneity shown in Figure 43 and was then used in subsequent DNA-binding
114
DNA + • + • + + + + + +
Extract • + + [
1 2 3 4 5 6 7 8 9 10
Figure 41. Gel shift assay experiment performed with 320 bp PlabAH labeled with biotin at the 3'-end (see Section 2.10.5). Crude extract was obtained from E. coli transcriptional fusion (HPS 1-}.attB::pCD13PSK-PladH5-lacZ) cultures harboring pUC 18 or pUCI8-PA3508 during stationary phase and incubated with labeled probes. Lane I, biotinlabeled PlabAH alone; lane 2, pUCI8 extract alone; lane 3, biotin-labeled PlabAH incubated with pUC 18 extract; lane 4, pUC18-PA3508 extract alone; lane 5-10, biotin-labeled PlabAH incubated with gradual decreasing concentration of pUC 18-PA3508 extract.
liS
kDA
97.2 -66.4 -55.6 -42.7 -36.5 -26.6 -
20.0 -
14.3 -
1 2 3
Figure 42. 10% SOS-PAGE electrophoresis gel showing the overexpression of PA3508-His6 in E. coli ER2566. Lane 1, protein marker; lane 2, total protein of uninduced cultures with pET28a-PA3508, and lane 3, total protein of IPTG-induced cultures with pET28a-PA3508.
116
- 97.2
66.4 -- 55.6
- 42.7
- 36.5
- 26.6
- 20.0
- 14.3
1 2 3 4 5 6
Figure 43. 10% SOS-PAGE electrophoresis gel showing PA3508-His6 purified from E. coli ER2566 using Ni+-NTA column. Lane 1, column loading filtrate ; lane 2, column washing filtrate; lanes 3, 4, and 5, are respectively, 0.5 fLg, 1.0 fLg and 1.5 fLg of PA3508-His6, and lane 6, protein marker. Protein concentrations were detennined by Bradford assays using BSA as the standard (8).
117
studies. Incubation of the purified PA3S08 preparation with the promoter regions of
JadB5 and JahA resulted in a shift of both fragments, although unlike the transcriptional
fusion extract, a defined band was not clearly observed as shown in Figure 44. The fact
that a defined shifted band was not observed raised some concern as to the nature of the
interaction between PA3S08 gene product and the promoter regions ofJahA andJadB5
since the absence of defined band is often indicative of non-specific interactions. To
address these concerns the gel shift experiment was modified to include an internal
region of the glpD gene as a probe. As mentioned earlier, glpD is a glycerol metabolism
gene and although the amplified peR product has some sequence similarity to the PfadB5
sequence there is enough differences to allow the two sequences to be differentiated
while maintaining a degree of stringency. Incubation of purified PA3S08 gene product
with PfabA which serve as a control and glpD caused a shift in both fragments (Figure 45).
In both experiments, the DNA band intensity at its normal position is reduced, and
appears at a higher position in the gel. The cumulative results suggest that the gene
product ofPA3S08 is capable of binding to PfadB5, PfabA and glpD.
118
DNA - + + + + + + + +
Protein + - -
J 2 3 4 5 6 7 8 9
Figure 44. Gel shift assay experiment performed with 120 bp PjadB5 and 320 bp PjabA
labeled with biotin at the 3' -end (see Section 2.10.5). PA3508-His6 was overexpressed in E. coli strain ER2566 as described in Section 2.10.2. The labeled DNA fragments were incubated with the purified protein and the mobility assayed. Lane I, purified PA3508-His6 alone; lane 2, biotin-labeled Pjad85 alone; lanes 3-5 , biotin-labeled PjadB5 incubated with decreasing concentration of purified PA3508-His6, lane 6, biotin-labeled PjabA alone; lanes 7-9, biotin-labeled PjabA incubated with decreasing concentration of purified PA3508-His6.
119
DNA + + + +
Protein • + • +
t 2 3 4
Figure 45. Gel shift assay experiment performed with 320 bp PjabAB and 400 bp glpD fragment labeled with biotin at the 3' -end (see Section 2.10.5). PA3S08-His6 was overexpressed in E. coli strain ER2566 as described in Section 2.10.2. The labeled DNA fragments were incubated with the purified protein and the mobi lity assayed. Lane I , biotin-labeled PjabAB alone; lane 2, biotin-labeled PjabAB incubated with purified PA3S08-His6; lane 3, biotin-labeled glpD alone; lane 2, biotin-labeled glpD incubated with purified PA3508-His6.
120
Chapter Seven: Discussion
The purpose of this study was to investigate the regulation of fatty acid
metabolism in P. aeruginosa. Understanding the regulation of fatty acid metabolism is
important because a) fatty acid biosynthesis is involved in virulence expression and b)
fatty acid degradation has been shown in our laboratory to be involved in the degradation
of lung surfactant phosphatidylcholine. Since the regulation of fatty acid metabolism is
fairly well established in E. coli, this served as a basis for this study. Through a series of
studies, a central regulator, FadR was shown to be involved in the regulation of fatty acid
biosynthetic and degradative processes in E. coli. FadR served to balance the two
processes by activating the biosynthetic pathway in the absence of exogenous fatty acids
while concurrently repressing the degradative pathway. In contrast, the presence of an
exogenous source of fatty acid results in the de-repression of the fatty acid degradative
pathway and the repression of the fatty acid biosynthetic pathway. This mechanism of
regulation makes logical sense as fatty acid biosynthetic process should be activated in
the absence of fatty acids to synthesize fatty acid and fatty acid degradative processes
repressed to prevent the degradation of newly synthesized fatty acids and vice versa. The
first step in this study was to establish whether this form of regulation is likely to exist in
P. aeruginosa.
To investigate the regulation of fatty acid metabolism in P. aeruginosa
transcriptional fusions were constructed using the promoter regions of previously mapped
fatty acid metabolism genes. The promoter regions offadB5,fadE andfabA were fused to
the lacZ gene and the transcriptional fusion integrated into the chromosome of P.
aeruginosa PAOl. The assumption was that the transcriptional fusion should reveal when
121
and if these promoter regions are responsive to exogenous sources of fatty acids. From a
clinical perspective oleic and palmitic acids were chosen in this study because there are
most representative of the fatty acid content of lung surfactant phosphatidylcholine, and
also because they have been previously demonstrated in our lab to support the growth of
P. aeruginosa. Measuring and comparing the induction of the promoters of these genes
via ~-galactosidase assays should reveal insights into the mechanism of fatty acid
metabolism regulation in P. aeruginosa. Comparison of the ~-galactosidase activity of
the fatty acid degradation-related genes, fadB5 and fadE to the fatty acid biosynthetic
gene,fabA suggested an inverse relationship between the representative genes. When the
transcriptional fusions were grown in media that lack fatty acids, one would expect that
the fatty acid biosynthetic genes would be more active to synthesize required fatty acids
while the fatty acid degradative genes are repressed to prevent the degradation of the
newly synthesized fatty acids. ~ revealed from the ~-galactosidase assays, this
relationship was observed between the PjabA-lacZ fusion compared to PjadB5-1acZ and
PjadE"lacZ. The fabA promoter activity was significantly higher compared to both the
fadB5 and fadE promoters. In contrast when the strains were grown in media that
contained fatty acids the opposite relationship was observed. Both the fadB5 and fadE
promoters were significantly upregulated compared to the fabA promoter. Again this
result was anticipated since fatty acid degradative genes would be expected to be active
in the presence of exogenous fatty acid source to degrade it into carbon and energy
sources. To strengthen these results, two different fatty acid sources, oleic and palmitic
acids were used in this study and the same observations were made regardless of which
was used. The transcriptional fusion studies corroborate earlier microarray experiments
122
performed in our lab; strengthening the hypothesis that fatty acid metabolism is inversely
regulated in P. aeruginosa. Equally important was the fact that these experiments
demonstrated the utility of the transcriptional fusions, which can be exploited to further
investigate the regulation of fatty acid metabolism. Since fadB5 has been the most
characterized and studied of the fatty acid genes, and has been demonstrated to be
involved in fatty acid metabolism in our laboratory, subsequent experiments relied on the
fadB5 region.
Several approaches were used to investigate the regulation of fatty acid
metabolism, in particular degradation in P. aeruginosa. The first approach used was
based on the relative conservation of regulatory mechanisms of fatty acid metabolism in
Gram-negative bacteria The regulation of fatty acid degradation is a fairly well
understood process in E. coli and served a basis for this study. Although differences were
expected, the fundamental regulatory mechanism was assumed to be similar, especially in
light of the data described above and considered an appropriate starting point of this
investigation. FadR homologues have been discovered in many bacteria closely related to
E. coli, including Salmonella enterica, Vibrio cholerae, Pasteurella multocida, and
Haemophilus injluenzae. The E. coli and S. enterica FadR proteins differ in only 7 of239
residues while other FadR homologue sequences are markedly different from E. coli and
from one another. For instance, P. multocida and H injluenzae, which despite both being
Pasteureliaceae, have FadRs that are only 54% identical, while H injluenzae FadR is
only 47% identical to E. coli FadR (58). In V. cholerae, the FadR protein unusually
contains 40 residues that are inserted into the center of the protein relative to the E. coli
protein. Despite these differences alignment of the residues critical for DNA binding by
123
E. coli FadR are conserved in all known FadR proteins (58) suggesting that
bioinformatics may be useful in searching for the FadR homologue(s) in other bacteria
With the availability of the P. aeruginosa genome sequence, the application of
bioinformatics offered an appealing approach to search for a FadR-like protein.
Bioinformatics has been proven a useful tool in the discovery of a number of proteins
related to fatty acid metabolism. The application of bioinformatics has not only led to the
discovery of novel enzymes and synthetic mechanisms in Gram-positive pathogens but
also to the identification of new components of the FASII system in E. coli (133). Using
the FadR protein sequence of E. coli, a BLAST search was performed against the P.
aeruginosa PAOI genome. Several proteins with modest similarities to the E. coli FadR
were identified which included the ORFs PA1627, PA4769 and PA5356. All three
proteins have been assigned to the GntR-type family of transcriptional regulators, which
is the family to which the E. coli FadR belongs. The fact that these probable
transcriptional regulators displayed some similarities to the E. coli FadR along with the
fact that they belonged to the same family of transcriptional regulators made them
attractive candidates for further study. To assess their potential regulatory roles in fatty
acid degradation, three studies were performed. The first was to construct isogenic
mutations at the respective loci in a PjadBj-lacZ fusion background in P. aeruginosa using
the gene replacement system shown in Figure 4. Since the fadB5 promoter regions is
repressed in media that lacks fatty acid according to previous experiments, disruption of
the repressor in this background should result in an increase in PjadBj-lacZ activity that
can be observed via ~-galactosidase assays. Secondly, to isolate the fadE5 promoter
region and candidate transcriptional regulators to study any potential interaction between
124
the two, an E. coli PfadB5-1acZtranscriptional fusion was constructed. ThefadB5 promoter
region was integrated into the chromosome of the E. coli strain HPSI as described in
Section 2.7.2.2. The resulting transcriptional fusion displayed functional (3-ga1actosidase
activity, which would allow the interaction between the probable transcriptional regulator
and the fadB5 region to be studied. Briefly, the reasoning was that if the probable
transcriptional regulator were expressed in the E. coli P fadBs-lacZ fusion strain and the
transcriptional regulator did indeed repressed the fadBA5 operon then a reduction in ~
galactosidase activity should be observed. The third approach involved determining
whether the probable transcriptional regulators directly interacted with promoter region
offadB5 using electrophoresis mobility shift assays (EMSA). Here, the labeled promoter
region of fadB5 was incubated with lysate obtained from the E. coli transcriptional
fusions expressing the candidate transcriptional regulators. Interaction between PfadB5 and
the different candidates can then be assessed by determining whether the migration of
PfadB5 through an acrylamide gel is affected by the presence the respective candidate
transcriptional regulators.
Although there were some similarities between the probable transcriptional
regulators PA1627, PA4769, and PA5356 and the E. coli FadR, along with the fact they
are all a part of the same family of regulators, it appears from these studies that these
candidates are not involved in regulating the fadB5 promoter region. Studies from the P.
aeruginosa transcriptional fusions demonstrated that disruption of these candidate
regulators by isogenic mutations did not cause an increase in ~-galactosidase activity as
expected. These observations were consistent for all measurements made during growth,
which included measurements at early-log, mid-log, late-log and early-stationary phases.
125
Expression of these candidate regulators in the E. coli transcriptional fusion did result in
a repression of ~-galactosidase activity; however, the repression was fairly modest and
was only observed during early and late stationary phases for PA1627 and PA5356. Gel
shift experiments provided additional evidence that PA4769, and PA5356 are not
involved in regulating fadB5. Incubation of the candidate regulators with labeled PfadB5
either did not cause a shift or did not significantly differ from control experiments.
Although the gene product ofPA5356 appeared to cause a shift in PfodB5. the interaction
was determined non-specific since the same lysate was capable of binding to and shifting
a random DNA sequence. Although the prospect that the mechanism of fatty acid
regulation is conserved across Gram-negative bacteria seemed appealing, data from these
experiments suggest that the regulatory mechanisms are much more complex and diverse
than initially assumed. Although, S. enterica and E. coli are closely related, and the f3-
oxidation systems of these two bacteria have long been thought to be essentially identical,
differences are emerging and it appears that the two systems are not functionally
equivalent (59). Differences in the ~-oxidations systems may translate into differences in
regulatory mechanisms in Gram-negative bacteria and may help explain why a simple
bioinformatic approach was useful in identifYing fatty acid regulatory proteins in P.
aeruginosa. Comparison of the E. coli and P. aeruginosa genomes allude to the potential
complexity of fatty acid metabolism in P. aeruginosa. For a number of genes involved in
f3-0xidation, there are many more fold genes involved in P. aeruginosa than in E. coli.
For instance, there are five potentialfadBAs in P. aeruginosa compared to one in E. coli,
and there are 4 potentialfadDs compared to one in E. coli. The fact that P. aeruginosa is
126
such a nutritional versatile organism also suggest that a more complex regulatory network
is involved.
Despite the strength of bioinformatics, there are a number of instances when
identification of novel proteins is limited using a straightforward bioinformatic approach,
as exemplified above. The second approach utilized various protein purification schemes
and EMSA studies to attempt to identify a fatty acid metabolism regulator protein. Since
the interaction between a transcriptional regulator and its cognate operator site is
relatively strong it is reasonable to assume that the interaction can be exploited to isolate
and purify a transcriptional regulator using its cognate operator site sequence. Initial
alignment and analysis of the promoter regions of fadE5, fadE and fabA revealed a
probable consensus sequence that had comparable conservation to the FadR DNA
binding elements found in E. coli. Briefly, concatamers of the putative consensus
sequence were generated by peR using biotinylated primers, which allowed for
subsequent attachment to streptavidin magnetic particles. Incubation of P. aeruginosa
clarified lysate with the streptavidin magnetic particles allowed for proteins that interact
with the consensus sequence to be separated from the bulk extract. The results suggest
that this technique can be potentially used as a means of DNA-binding protein
purification. Although 100% homogeneity was not attained the clarified extract was
purified to some degree. The major bands that were observed were approximately 36
kDa, slighltly larger than the E. coli FadR (26.6 kDa). Some minor protein bands of
lower molecular weights were also observed but the likelihood that these bands
correspond to transcriptional regulators is low since they are too small to contain
essential DNA-binding elements that exist in transcriptional regulators. Initia1ly, an
127
galactosidase activity of fusion strain expressing P A5525 from the expression vector
pUC18 was not significantly different from the control strain containing the empty
pUC18 cloning vector. There was however, a slight difference in late stationary phase. If
the gene product of PA5525 does interact with the fadB5 promoter region, one would
expect a repression of ~-galactosidase activity throughout the phases. Since this was not
observed it appears that PA5525 does not regulate thefadBA5 operon. To conclusively
eliminate PA5525 as a potential regulator of the fadBA5 operon, EMSA studies were
performed as above. Lysate from the fusion strain expressing PA5525 was incubated with
labeled PfadB5 and a shift in the Pf adB5 fragment was observed as shown in Figure 26. This
result is not entirely surprising since the identity of P A5525 was determined by protein
purification experiments using the PfadB5 consensus sequence to isolate proteins that
recognize and bind to PfadB5. Therefore the gene product of PA5525 was expected to
interact to some extent with the fadB5 promoter region. The results from the EMSA
studies agree with the results acquired from the ~-galactosidase activity experiments by
demonstrating direct interaction between the PA5525 gene product and PfadB5. To
determine whether the interaction between PA5525 and PfadB5 is specific, PA5525 lysate
was tested against the fabA promoter region as well as a random DNA sequence
corresponding to an internal region of glpD, a gene involved in glycerol metabolism (see
Figure 27). From the results it appears that the interaction between the gene product of
PA5525 and thefadB5 promoter region is not specific since PA5525 was able to cause a
shift in both the fabAB promoter region and glpD fragments. Based on these findings it
appears that PA5525 is not involved in regulating thefadB5 operon. It does appear to
interact with the promoter region, though non-specifically.
129
attempt was made to identifY the proteins present in the band by N-terminal sequencing
via Edman degradation but since the concentration of the protein was very low and there
were issues with purity, a useful sequence was not obtained. As an alternative, a
collaborative effort was made to identifY the proteins present in the bands by liquid
chromatography mass spectroscopy (LC-MS). Since a P. aeruginosa database was not
available, the software used was only able to identifY peptides that corresponded to
proteins found in the E. coli database. Attempts were made to BLAST those protein
sequences to the P. aeruginosa database to identifY potential homologues in P.
aeruginosa but no similarities were found. Rather than performing a BLAST search
against the P. aeruginosa database using the entire E. coli protein sequence, another
approach was taken. Peptide fragment sequences that were assigned high scores were
used to BLAST directly against the P. aeruginosa genome and a few transcriptional
regulators were identified. The highest scored protein that corresponded to a
transcriptional regulator was ORF PA5525, which coincidentally belonged to the GntR
type family of transcriptional regulators. The molecular weight ofPA5525 is predicted to
be approximately 28 kDa, which is slightly smaller than the protein band that was
observed from purification. Despite this discrepancy in molecular weight, PA5525 cannot
be definitively ruled out since variations in salt concentration among other factors may
have affected its migration through the gel, therefore the potential regulatory role of
P A5525 was evaluated. Similar approaches were taken as above to assess the regulatory
role ofPA5525. The ORF PA5525 was expressed on a cloning vector in the E. coli lacZ
fusion strain HPSI-AattB::pCD13PSK-PjadB5-1acZ and (:I-galactosidase activity measured
throughout growth (Figures 28 and 29). Throughout log and early stationary phase the (:1-
128
The success of the protein purification approach relied on the assumptions that i)
the binding interaction between the regulator and PjadB5 is strong and specific and ii) the
consensus sequence utilized in the purification scheme is used by the transcriptional
regulator to recognize and bind to PjadB5. Although a partially purified protein extract was
obtained from this experiment, 100% purification was not achieved. There appears to be
a significant amount of non-specific interaction between the putative P jadB5 consensus
sequence and cytoplasmic proteins in P. aeruginosa, and many types of interactions may
have contributed to this non-specificity including hydrophobic and electrostatic
interactions. To address these issues and improve the overall purification scheme, future
experiments could incorporate additional purification steps. Potential improvements to
the current purification scheme may include incorporation of ion-exchange
chromatography and 2D-gel analysis as part of the overall scheme. Including ion
exchange chromatography as part of the purification scheme should eliminate some of the
non-specific binding proteins from the sample and improve the overall purification
efficiency. Another issue that was encountered during the course of these experiments
was the difficulty with identifying the protein following purification. Since purification
was not 100% the other proteins in the partially purified sample made it difficult to
identify the protein of interest using N-terminal sequencing. By running the partially
purified protein sample on a 2D gel, the resolution could be improved, addressing the
difficulties encountered with N-tenninal sequencing.
It was not immediately apparent but analysis of the promoter region of fadB5
around the putative consensus sequence revealed a dyad symmetry element that may be
involved in regulation. The presence of this dyad symmetry element, which spans 18 bp,
130
is relatively strong and is an indication that a transcriptional regulator binds to this region
(Figure 48). The inability to purify a transcriptional regulator using the concatamerized
consensus sequence may be explained by the exclusion of this dyad symmetry element in
the concatamerized sequence. Future work that employs this method to isolate the
transcriptional regulator should include this regulatory element Additionally,
sequentially deleting regions of the promoter region of fadB5 in a lacZ reporter strain or
vector and monitoring the response to exogenous fatty acids can delineate the essential
regulatory elements. By narrowing the fatty acid responsive element, a more specific
binding sequence can be determined which would improve the specificity of the protein
purification scheme.
The last approach relied on mutagenizing the P. aeruginosa transcriptional fusion
strain PAOl-attB::P/adBs-1acZ by transposon mutagenesis. This approach is similar in
principle to the bioinformatic approach mentioned above. However, rather than selecting
potential transcriptional regulators based on sequence homology, a screen was developed
which would allow genes that affected the promoter activity of fadB5 to be identified.
Briefly, a mariner transposon was introduced into the fusion strain PAOl-attB::P/adBJ
lacZ on the vector pBT20 and selected on media on which the fadB5 promoter region is
known to be repressed. The use of the chromogenic substrate X-gal (S-bromo-4-chloro-3-
indoyl-~-D-galactoside), which was incorporated into the growth media allowed for the
promoter activity ofthefadB5 regions to be visualized and quickly gauged. Mutants that
appeared blue are indicative derepression of the fadB5 promoter region corresponds to
potential transcriptional regulators of the fadB5 region. These mutants were selected and
the transposon inactivation sites determined by low-stringency peR and sequencing.
131
PfadBA5 TCCXD'.TGXTGATTGACAATTa::ctn:111 IOCCOOAATGTGTOCG::ACCO\AGT~ATGAlWCGAtl:G1 IIGCCT
.. ill =CD:CTCGlCAATAGAGPCCCOOTTATCGCGTCGClOO:lG1 GTOCCGI\A=nTOOG>.CTATG:ITCli£I:lGII OCCG>A .. G
GGfCCCG\CACGG:GTCCGATGTGTAAGTTCAAGCTTCCATMTAOCGTcn<'G".TCAGTTGATGATTTACCMGGT'AAAOOCATCA
~MIYQGKAI
CXDTAAGCCTCTTGA,4,,4 'lI3CATCGTCGAGrTGAATTTCGlTCTCAAC!JJIX,(lAGTCCGTO&.ACAAGTTCAACCGTCTCAcx:CTC
~T V K P LEG G I VEL N F D L K G E S V N K F N R L T L
AGTGAGTTOCGTa:GC3CAGTCGATa:GATCAi'GClCCG'\TGCATCGGrCA
~SELRAAVDAI KADASV
Figure 46. Promoter region of PfadBA5 showing dyad symmetry element. Shown are the putative consensus sequenced (underlined), the transcript start site previously determined by primer extension and verified by promoter mapping program Cbolded and underlined), and the start codon of fadBA5 operon. Opposed arrows indicate an 18 bp inverted repeats.
132
Surprisingly, a significant portion of the inactivations occurred within genes
involved in lipopolysaccharide (LPS) biosynthesis. Fatty acid biosynthesis is directly
involved in LPS biosynthesis and fatty acid degradation is related to fatty acid
biosynthesis through metabolism. Is it possible that there is some association between
fatty acid degradation and LPS biosynthesis?
Lipopolysaccharides (LPS) of Gram-negative bacteria are major components of
the cell wall. The hydrophobic lipid A component of LPS secures these molecules in the
outer membrane, while the core oligosaccharide links the lipid A region to the 0 antigen
or 0 polysaccharide (107). The lipid A region of LPS is thought to be responsible for the
toxicity of LPS and is composed of a phoshorylated diglucosamine moiety substituted
with fatty acids (115). When LPS is shed by bacteria into host tissues, it is usually bound
by LPS binding protein, which is transferred to the CD 14 receptor on macrophages,
thereby inducing the secretion of cytokines including tumor necrosis factor alpha (1NF
a), interleukin-l (lL-l), IL-6, IL-8, and IL-IO (76). The fatty acid distribution, their
length, and the site of attachment strongly influence the toxicity properties of this
molecule (115). Previous studies have demonstrated that growth temperatures effect the
fatty acid composition of LPS. Cells grown at 1ST relative to those grown at 4S"C
contained increased levels of the fatty acid hexadecenoate and octadecenoate and reduced
levels of the corresponding saturated fatty acids. On the otherhand, lipid A fatty acids
showed decreases in dodecanoic and hexadecanoic acids and increases in the level of 3-
hydroxydecanoate and 2-hydroxydodecanoate when temperatures were decreased (68).
Modification of the fatty acid moiety of LPS also appears to have a role in pathogenicity.
P. aeruginosa in CF patients synthesize LPS with a variety of penta- and hexa-acylated
133
lipid A structures under different environmental conditions. LPS with specific lipid A
structures are synthesized indicating unique recognition of the CF airway environment.
CF-specific lipid A molecules contajnjng palmitate and aminoarabinose were associated
with resistance to cationic antimicrobial peptides and increased inflammatory responses,
indicating that they are likely to be involved in airway disease (30). DiRusso and
Nystrom have hypothesized that FadR in E. coli interacts with other regulatory activities
to co-ordinate lipid biosynthesis with lipid turnover; it may be possible that these
regulatory activities involve LPS biosynthesis (25). It is evident from the above
observations that fatty acid plays an important role in LPS in response to the
environment. Modification in the fatty acid component of LPS appears to be related to
toxicity, temperature, and pathology. Whether these modifications are directly
coordinated by a regulatory such as FadR in P. aeruginosa or the result of some
secondary effect remains to be determined. The involvement of E. coli FadR in other
regulatory activities, however, suggests that this hypothesis is fairly reasonable. It is
tempting to suggest that there is a definitive relationship between LPS biosynthesis and
fatty acid degradation in P. aeruginosa, but clearly more experiments are needed and at
the moment any association is purely speculative.
A number of transcriptional regulators were identified by the transposon
mutagenesis approach. These included the ORFs PA2601, PAJ006 and PAJ508. The
three probable transcriptional regulators PA2601, PAJ006 and PAJ508 belong to
different classes of regulators, LysR, TetR, and IclR respectively. To evaluate the
potential relationship between these probable transcriptional regulators and the fadE5
promoter region similar experiments were performed as above. Initial assessment of these
134
regulators involved comparing p-galactosidase activity of HPSI-A.attB::pCD13PSK
P fodBS-1acZ harboring the various probable regulators. Derepression of p-galactosidase
activity was observed throughout the growth phase for both PA3006 and PA3508 while
derepression was only observed during the later stages of growth for P A2601 (Figure 35).
The fact that derepression was observed throughout the growth phase for PA3006 and
PA3508 showed promise and further experiments were performed to evaluate these ORFs.
In order to determine whether the gene product of these ORFs interact with the JadB5
promoter region, EMSA studies were performed as described above. Comparison of the
gel shifts revealed that PA3508 caused a distinct shift in the PfadB5 fragment whereas
PA3006 banding pattern appeared similar to the vector only control. For confirmation,
gel shift experiments were also carried out on P A2601 and as expected the lysate was
unable to cause a shift in PfadB5 fragment The fact that PA3508 was able to shift the PfadB5
promoter fragment along with the fact that a discrete shift band was observed was
encouraging therefore additional studies was performed on this transcriptional regulator
candidate.
Along with the experimental data, which supported PA3508 as potential regulator
oftheJadB5 operon, was the observation that PA3508lies in close proximity to genes are
related to fatty acid metabolism. The organization of PA3508 and adjacent genes are
shown in Figure 39. Since FadR in E. coli has the ability to regulate both fatty acid
degradative and biosynthetic genes, it would be interesting to see ifPA3508 was capable
of interacting with the PfaM promoter region. To determine whether this was the case, gel
shifts were performed across a gradient ofPA3508lysate concentration on both PfadB5 and
PfahA fragments (Figures 40 and 41). The results from the gradient gel shift experiments
135
revealed that the gene product of P A3508 was capable of interacting with the promoter
region ofbothfadB5 andfabAB. At higher concentrations the lysate was able to shift the
P JodJJj and P fabA fragments while reducing the concentration caused the shifted band to
disappear and migrate normally. Thus the results from these experiments suggest that
P A3508 is a common regulator of the fad and fab pathways in P. aeruginosa behaving
similarly to the FadR protein in E. coli. In order to definitively conclude that PA3508 is
the transcriptional regulator of the fadBA5 operon, a HiS6-tagged purified PA3508 was
expressed and tested for its ability to shift the promoter regions of fadB5 and fabAB.
Similar to the results obtained with the E. coli lysate, the HiS6-tagged purified PA3508
was able to cause a shift in bothfadB5 andfabAB promoter regions (Figure 44). This is
strong evidence that PA3508 encodes a transcriptional regulator that interacts with PJadB5
and PJabA. To test the specificity of this interaction, the His6-tagged purified PA3508
incubated with a random sequence that corresponds to the internal region of the glpD
gene. The results (see Figure 45) reveal that the gene product of P A3508 is capable of
interacting with the glpD fragment as well and it appears that PA3508 does not
specifically interact with PJadB5 or PJabA.
Based on these results it appears that PA1627, PA4769, PA5356, PA5525,
PA2601, PA3006 and PA3508 are not involved in regulatingfadB5. Although the gene
products of some of these ORFs were capable of interacting with the promoter region of
fadB5, the interaction was non-specific. The gene products ofPA1627, PA4769, PA5356,
and PA5525, which represent the GntR-type regulators that are most similar to the E. coli
FadR did not appear to regulate the fadBA5 operon. These observations suggest that the
regulator offadBA5 operon is most likely not a part of this family and may use a slightly
136
different mechanism of regulation. The results from the transposon mutagenesis
experiments did identify some potential regulators of the fadBA5 operon including
PA2601, PA3006, and PA3508. It was determined from the transcriptional regulation
studies that PA3006 behaved in a manner most expected of afadBA5 operon regulator.
Transposon mutagenesis of this gene caused an upregulation of PfadBs-lacZ in P.
aeruginosa while expression in an E. coli reporter system led to repression of the P fadBS
lacZ fusion. However, direct DNA-binding assays, revealed that the gene product was
unable to bind to the PfadBs. The ORF PA3006 has recently been designated a PsrA
regulator, which is associated with rpoS and may be a part of the global regulatory
network. If this is the case, this may explain the observation that the gene product was
unable to directly bind to PfadBS in the EMSA studies and unable to cause a complete
repression in the E. coli reporter system since it may need a cofactor to function
optimally. Although inactivation of PA3508 did not cause an upregulation infadBA5 as
expected, expression of the gene product in the E. coli reporter system did cause
repression and the gene product was capable of interacting with PfadB5 as demonstrated in
the EMSA studies. The inability to cause a de-repression of the fadBA5 operon in the P.
aeruginosa transcriptional fusion strain was puzzling but based on the results from the
other experiment, PA3508 seemed like the most promising candidate and therefore
investigated further. However, additional DNA-binding studies using purified PA3508
revealed that the gene product does not interact specifically with PfadB5.
Although the experiments performed in this thesis did not identify the regulator of
the fadBA5 operon, it gave insights into the regulation mechanism of fatty acid
degradation in P. aeruginosa. It is hoped that future studies may build upon the collective
137
data gathered in these experiments and elucidate the regulation of fatty acid metabolism.
Some potentially promising approaches include expression of a PAOI chromosomal
library in the E. coli PjadBS'lacZ transcriptional fusion developed in this thesis, refining
the regulatory element in PjadBJ by mutations or deletion analysis and potentially using
the refined sequence to extract the regulator as described in this thesis. Identification of
additional genes that are a part of the fad-regulon will allow a more accurale consensus
sequence to be developed and potentially generate other avenues to identifY the regulator.
Until then the regulation of fatty acid degradation in P. aeruginosa will remain a mystery.
138
Appendix I
Introduction
During the course of experiments carried out as part of this thesis, genetic tools
that facilitated the study of the regulation of fatty acid metabolism in P. aeruginosa were
developed. One such tool was the development of simple method for the construction of
targeted transcriptional fusion to lacZ using Flp-mediated site-specific recombination
adapted from a previous method applied in Salmonella typhimurium (28). Briefly,
suicidal vectors containing promoterless lacZ genes and the Flp recognition target (FR1)
site in both orientatious were constructed to create transcriptional fusions. These vectors
can be transformed into strains containing a single FRT site created downstream of the
promoter of interest by Flp-mediated site-specific recombination. The Flp protein
supplied by a conditionally replicating plasmid promotes site-specific recombination
between the FRT sites, creating an integrated lacZ fusion to the gene of interest (Figure
47). Although this project was not the main focus of this thesis, it has direct application in
the study of regulation of fatty acid metabolism as well as other processes and may be
applied in future studies.
Methods
Construction of FRT-lacZ integration vectors involved the following steps.
Plasmid pTZ120, which supplies the lacZ gene, was digested with SapI and NarI, then
blunt-ended using T4 DNA polymerase. The digestion product was self-ligated, then
transformed into E. coli strain DH5a and selected on LB + Ap media Positive clones
were digested with BamHI and ligated to the Om-cassette obtained from pPS856
139
Gm"
c
pXR6KAJlspHI-BspMI-FRT-lacZ
tHiROK
FRT /acZ --x
III •• " '11111' --FRT
+ Ap (pCD13-onT-Ap)
1 __ ,lac.?:>- ..Q. , tHiROK " .A Gm ~~::)I-----IIID'~'~IIQ~ -FRT FRT
Figure 47. Schematic representation of FRT-lacZ integration. The vector pXR6KMspID-BspMI-FRT-lacZvector is introduced along with pCD13-oriT-Flp into a host containing an FRT-site inserted within the gene of interest. Flp-mediated recombination integrates the vector at the FRT-site creating the lacZ-transcriptional fusion. Corresponding FRT orientations lead to functional fusions.
140
digested with the same enzyme. The ligation mixture was then transformed into DH5a
and selected on LB + Gm. Due to non-directional cloning, the Gm-cassette was inserted
in one of two different orientations. Clones corresponding to the different Gm-cassette
orientations were designated pDTNI00Gm-FRTl and pDTNI00Gm-FRT2. The different
constructs were then transformed into DH5a-.wttB::pCD13SK-Flp to remove the Gm
cassette via Flp-mediated excision and selected on LB + Ap. Colonies were then patched
onto LB + Ap and LB + Gm media and ApRGms clones were designated as pDTNIOO
FRTJ and pDTNI 00-FRT2. To replace the bla-colEl region, the FRT -lacZ fragment was
sub-cloned into the pXR6K vector, which carries GmR-oriR6K. This involved the
following steps: The pXR6K vector was digested with BspHl and BspMI, blunt-ended
with T4 DNA polymerase then self-ligated and transformed into DH5a-pir 116.
Transformants were selected on LB + Gm. The resulting construct was then digested with
XmnI and PvuIl, which allowed for the subsequent sub-cloning of FRTl-lacZ and FRT2-
lacZfragments from pDTNI00-FRTl and pDTNI00-FRT2 respectively. The FRT-lacZ
fragments were digested with AjlII and XhoI then blunt-ended and ligated to
pXR6KABspHl-BspMIMmnI-PvuIl. Ligation mixture was transformed into DH5a
pirl16 and selected on LB + Gm + X-Gal. Blue colonies were verified by digestion and
designated as pXR6KABspHl-BspMI-FRTl-lacZ or pXR6K11BspHl-BspMI-FRT2-lacZ.
The constructs were then transformed into the mobilizable E. coli strain ER2566mob-
pir 116 and selected on LB + Gm. Construction of the FRT-IacZ integrated fusion
involves conjugation by triparental mating. Essentially 500 jJl of each: the recipient,
which contains a previously inserted FRT site, the FRT-lacZ integration vector donor
strain (pXR6K11BspHl-BspMI-FRT-lacZl ER2566mob-pir 116) and the helper plasmid
141
strain (pCD 13-oriT-Flp/ ER2566mob-pir 116) are combined and selected on PIA + Om
media (Figure 47). Successful integration in the correct orientation can then confirmed
by PCR using primers that anneal to the lacZ gene or Gm-cassette in combination with a
primer that anneals to the gene of interest.
142
References
I. Baltch, A.L. 1994. Pseudomonas aeruginosa Bacteremia, p. 73-127. In A.L.
Baltch and R.P. Smith (ed.), Pseudomonas aeruginosa: infections and treatment.
Marcel Dekker, NY.
2. Bejarano, P.A., J.P. Langeveld, B.G. Hudson, and M.E. 1989. Degradation of
basement membranes by Pseudomonas aeruginosa elastase. Infect. Immun.
57:3783-3787.
3. Berka, R.M., and M.L. Vasil. 1982. Phospholipase C (heat-labile hemolysin) of
Pseudomonas aeruginosa: purification and preliminary characterization. J.
Bacteriol. 152:239-245.
4. Bernhard, W., J.Y. Wang, T. Tschernig, B. Tummler, H.J. Hedrich, and H. von
der Hardt.1997. Lung surfactant in a cystic fibrosis animal model: increased
alveolar phospholipid pool size without altered composition and surface tension
function in cfir"'IHGUlmlHGU mice. Thorax. 52:723-730.
5. Binstock, J.F., A. Pramanik, and H. Schultz. 1977. Isolation of multienzyme
complex of fatty acid oxidation from Escherichia coli. Proc. Nat!. Acad. Sci.
USA 74:492-495
6. Black, PN., C.C. DiRusso, AX. Metzger, and T.L. Heimert. 1992. Cloning,
sequencing and expression of the fadD gene of Escherichia coli encoding acyl
coenzyme A synthase. J. BioI. Chem. 267:25513-25520.
7. Boyd, R.F. 1984. Genera! Microbiology. Times MirrorlMosby College
Publishing, St. Louis.
143
8. Bradford, M.M. 1976. A rapid and sensitive method for the quantification of
microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem. 72:248-254.
9. Burrows, W. 1973. Textbook of Microbiology. W.B. Saunders Company,
Philadelphia, P A.
lD. Campbell, J.W., and J.E. Cronan. 2001. Escherichia coli FadR positively
regulates transcription of the fabB fatty acid biosynthetic gene. J. Bacteriol.
183(2): 5982-5990.
11. Campbell, J.W., and J.E. Cronan. 2002. The enigmatic Escherichia coli fadE
gene isyajH. J. Bacteriol. 184(13):3759-3764.
12. Clark, D. P., and J. E. Cronan Jr. 1996. Two-carbon compounds and fatty acids
as carbon sources., p. 343-358. In F. C. Neidhardt, R. Curtiss ill, J. 1. Ingraham,
E. C. C. Lin, K. Brooks Low, B. Magasanik, W. S. Reznikoff, M. Riley, M.
Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella.
American Society for Microbiology, Washington, D.C.
13. Clarke, P.H., and L.N. Ornston. 1975. Metabolic pathways and regulation-Part I
and II, p. 191-341. In P.H. Clarke and M.H. Richmond (ed.), Genetics and
Biochemistry of Pseudomonas. John Wiley and Sons Ltd., New York.
14. Comolli, J.C., 1.1. Waite, K.E. Mostov, and J.N. Engel. 1999. Pili binding to
asialo-GM 1 on epithelial cells can mediate cytotoxicity or bacterial
internalization by Pseudomonas aeruginosa. Infect. Immun. 67:3207-14.
144
15. Costerton, J.W., and H. Anwar. 1994. Pseudomonas aeruginosa: the microbe
and pathogen, p. 1-20. In A.L. Baltch and R.P. Smith (ed.), Pseudomonas
aeruginosa: infections and treatment. Marcel Dekker, NY.
16. Costerton, J.W., P.S. Stewart, and E.P. Greenberg. 1999. Bacterial biofilrns: a
common cause of persistent infections. Science. 284: 1318-1322.
17. Croft, L., S.A. Beaton, C.B. Whitchurch, B. Huang, R.L. Blakeley, and J.S.
Mattick. 2000. An interactive web-based Pseudomonas aeruginosa genome
database: discovery of new genes, pathways and structures. Microbiol. 146(Pt.
10):2351-2364.
18. Cronan Jr., J.E., and S. Subrahmanyam. 1998. FadR, transcriptional co
ordination of metabolic expediency. Mol. Microbiology 29(4):937-943.
19. Cruickshank, R., J.P. Duguid, B.P. Marmion, and R.H.A. Awain. 1975. Medical
Microbiology, 12 ed, vol. 2. Churchill Livingstone, NY.
20. Dennis, J.J., and G.J. Zylstra. 1998. Plasposons: Modular Self-Cloning
Mintransposon Derivatives for Rapid Genetic Analysis of Gram-Negative
Bacterial Genomes. Appl. Environ. Micrbiol. 64(7):2710-2715.
21. DiMarco, A.A., B. Averhoff. and L.N. Omston. 1993. Identification of the
transcriptional activator pobR and characterization of its role in the expression
of pobA, the structural gene for p-hydroxybenzoate hydroxylase in
Acinetobacter calcoaceticus. J. Bacteriol. 175:4499-4506.
22. DiMarco, A.A., and L.N. Ornston. 1994. Regulation of p-hydroxybenzoate
hydroxylase synthesis by PobR bound to an operator in Acinetobacter
calcoaceticus. J. Bacteriol. 176:4277-4284.
145
23. DiRusso, C.C., T.L. Heimert, and A.K. Metzger. 1992. Characterization of
FadR, a global transcription regulator of fatty acid metabolism in Escherichia
coli. J. BioI. Chern. 267(12):8685-8691.
24. DiRusso, C.C., A.K. Metzger, and T.L. Heimert. 1993. Regulation of
transcription of genes required for fatty acid transport and unsaturated fatty acid
biosynthesis in Escherichia coli by FadR. Mol. Microbiol. 7:311-322.
25. DiRusso, C.C., T. Nystrom. 1998. The fats of Escherichia col during infancy
and old age: regulation by global regulators, alarrnones and lipid intermediates.
Mol. Microbiol. 29: 1-8
26. Doggett, R.G. 1979. Pseudomonas aeruginosa: Clinical Manifestations of
infection and Current Therapy. Academic Press Inc., NY.
27. Dosanjh, A., W. Lencer, D. Brown, D.A. Ausiello, and J. L. Stow. 1994.
Heterologous expression of delta F508 CFTR results in decreased sialylation of
mernbrane glycoconjugates. Am. J. Physiol. 266:C360-C366.
28. Ellerrneier, C.D., A. Janakiraman, and J.M. Siauch. 2001. Construction of
targeted single copy lac fusions using l Red and FLP-mediated site-specific
recombination in bacteria Gene. 290:153-161.
29. Enhorning, G., and B. A. Holm. 1993. Disruption of pulmonary surfactant's
ability to maintain openness of a narrow tube. J. Appl. Physiol. 74:2922-2927.
30. Ernst, R.K., E.C. Yi, L. Guo, K.B. Kim, J.L. Burns, M. Hackett, and S.l. Miller,
1999. Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas
aerugionosa. Science. 286(5444):1561-5.
146
31. Ferrandez, A., J.L. Garcia, and E. Diaz. 2000. Transcriptional regulation of the
divergent paa catabolic operons for phenylacetic acid in Escherichia coli. J. BioI.
Chern. 275:12214-12222.
32. Fick. R.B. 1989. Pathogenesis of the Pseudomonas lung lesion in cystic fibrosis.
Chest. 96:156-164.
33. Fitzsimmons, S.C. 1993. The changing epidemiology of cystic fibrosis. J.
Pediatr. 122: 1-9.
34. Gabrielsen, O.S., E. Homes, L. Korsnes, A. Ruet, and T.B. 0yen. 1989.
Magnetic DNA affinity purification of yeast transcription factor 1" - a new
purification principle for the ultrarapid isolation of near homogeneous factor.
Nuc1. Acids Res. 17(15):6253-6267.
35. Goldberg, J.B., and G.B. Pier. 1996. Pseudomonas aeruginosa
lipopolysaccharide and pathogenesis. Trends Micrbiol. 4(12):490-494.
36. Goldberg, J.B. 2000. Pseudomonas, global bacteria Trends Microbiol. 8:55-57.
37. Gordon, L, A.Y. Chervonenkis, A.J. Gammerman, I.A. Shahmuradov, and V.
Solovyev. 2003. Sequence alignment Kernel for recognition of promoter
regions. Bioinfonnatics. 19:1964-1971.
38. Gray, G.L., D.H. Smith, J.S. Baldridge, R.N. Harkins, M.L. Vasil, E.Y. Chen,
and H.L. Heyneker. 1984. Cloning, nucleotide sequence, and expression in
Escherichia coli of the exotoxin A structural gene of Pseudomonas aeruginosa.
Proc. Nat!. Acad. Sci. 81:2645-49.
147
39. Gray, K., L. Passador, B. Iglewski, and E. Greenberg. 1994. Interchangeability
and specificity of components from the quorum-sensing regulatory systems of
Vibrioflsheri and Pseudomonas aeruginosa. J. Bacteriol. 176:3076-3080.
40. Gui, L., A. Sunnarborg, and D.C. LaPorte. 1996. Regulated expression of a
repressor protein: FadR activates iclR. J. Bacteriol. 178:4704-4709.
41. Guo, Z., and J.E. Houghton. 1999. PeaR-mediated activation and repression of
pea genes from Pseudomonas pulido are propagated by its binding to both the -
35 and -10 promoter elements. Mol. Microbiol. 32:253-263.
42. Gupta, S.K., R.S. Berk, S. Masinick, and L.D. Hazlett. 1994. Pili and
lipopolysaccharide of Pseudomonas aeruginosa bind to the glycolipid GM1.
Infect. Immun. 62:4572-9.
43. Hancock, R.E.W., and D.P.Speert. 1996. Antibiotics for Pseudomonas and
related infections, p. 245-266. In J.A. Dodge, DJ.H. Brock, and J.H.
Widdicombe (ed.), Cystic fibrosis: current topics. John Wiley & Son Inc., New
York, N.Y.
44. Hancock. R.E.W. 1997. The bacterial outer membrane as a drug barrier. Trends
Microbiol. 5:37-42.
45. Hancock, R.E.W. 1998. Resistance mechanisms in Pseudomonas aeruginosa
and other nonfermenetative gram-negative bacteria. Clin. Infect. Dis. I:S93-S99.
4.6. Haydon, D.J., and J.R. Guest. 1991. A new family of bacterial regulatory
proteins. FEMS Microbiol. Lett. 63:291-295.
47. Henikoff, S., G.W. Haughn, J.M. Calvo, and J.C. Wallace. 1988. A large family
of bacterial activator proteins. Proc. Nat!. Acad. Sci. USA 85:6602-6606.
148
48. Henry, M.F., and Cronan, Jr, J.E. 1991. Escherichia coli transcription factor that
both activates fatty acid synthesis and represses fatty acid degradation. J. Mol.
BioI. 222:843-849.
49. Henry, M.F., and Cronan, Jr, J.E. 1992. A new mechanism of transcriptional
regulation: release of an activator triggered by small molecule binding. Cell
70:671-679.
50. Hindle, Z., and C.P. Smith. 1994. Substrate induction and catabolite repression
of the Streptomyces coelicolor glycerol operon are mediated throught the GylR
protein. Mol. Microbiol. 12:737-745.
51. Hite, R.D. 2002. Surfactant deficiency in adults. Clin. Pulm. Med. 9(1):39-45.
52. Hoang, T. T., and H. P. Schweizer. 1997. Fatty acid biosynthesis in
Pseudomonas aeruginosa: Cloning and characterization of the fabAB operon
encoding P-hydroxyacyl-acyl carrier protein dehydratase ([ahA) and P-ketoacyl
acyl carrier protein synthase I ([abB). J. Bacteriol. 179:5326-5332.
53. Hoang, T.T, R.R. Karkhoff-Schweizer, AJ. Kutchma, and H.P. Schweizer.
1998. A broad-host-range Flp-FRT recombination system for site-specific
excision of chromosomally-located DNA sequences: application for isolation of
unmarked Pseudomonas aeruginosa mutants. Gene. 212:77-86.
54. Hoang, T.T., and A.J. Kutchma, A. Becher, and H.P. Schweizer. 2000.
Integration-Proficient Plasmids for Pseudomonas aeruginosa: Site-Specific
Integration and Use for Engineering of Reponer and Expression Strains.
Plasmid. 43:59-72.
149
55. Hoang, T. T., S. A. Sullivan, K. C. Cusick, and P. H. Schweizer. 2002. ~
Ketoacyl carrier protein reductase (FabG) activity of the fatty acid biosynthetic
pathway is a detennining factor of 3-oxo-homoserine lactone acyl chain lengths.
Microbiology. 148:3849-3856.
56. Hoiby, N., 1993. Antibiotic therapy for chronic infection of Pseudomonas in the
lung. Annu. Rev. Med. 44:1-10.
57. Iglewski, B.H., R.P. Burns, and I.K. Gipson. 1977. Pathogenesis of corneal
damage from Pseudomonas exotoxin A. Invest. Ophtha1mol. Vis. Sci. 16:73-6.
58. !ram, S.H., and J.E. Cronon. 2005. Unexpected functional diversity among FadR
fatty acid transcriptional regulatory proteins. J. BioI. Chem. 280:32148-32156.
59. !ram, S.H., and J.E. Cronan. 2006. The p-Oxidation Systems of Escherichia coli
and Salmonella enterica Are Not Functionally Equivalent. J. Bacteriol.
188(2):599-608.
60. Kakuta, Y., H. Sasaki, and T. Takishima. 1991. Effect of artificial surfactant on
ciliary beat frequency in lipases. FEMS Microbiol. Rev. 15:29-63.
61. Kharazmi, A., and H. Nielsen. 1991. Inhibitory of human monocyte chemotaxis
and chemiluminescence by Pseudomonas aeruginosa elastase. Apmis 99:93-5.
62. Khubchandani, K.R., and J.M. Snyder. 2001. Surfactant protein A (SP-A): the
alveolus and beyond. The FASEB Jouma1. 15:59-69.
63. Klein, K., R. Steinberg, B. Fiethen, and P. Overath. 1971. Fatty acid degradation
in Escherichia coli. An inducible system for the uptake of fatty acids and further
characterization of old mutants. Eur. J. Biochem. 19:442-450.
150
64. Koch, C., and N. Heiby. 1993. Pathogenesis of cystic fibrosis. Lancet.
341:1065-1069.
65. Kohler, T., M. Michea-Hamzehpour, U. Henze, N. Gotoh, L.K. Curty, and J.-C.
Pechere. 1997. Characterization of MexE-MexF-OprN, a positively regulated
multi drug efflux system of Pseudomonas aeruginosa. Mol. Microbiol. 23:345-
354.
66. Kok, R.G., D.A. D' Argenio, and L.N. Omston. 1998. Mutation analysis ofPobR
and PcaU, closely related transcriptional activators in Acinetobacter. J.
Bacteriol. 180:5058:5069.
67. Knirel, Y.A., E.V. Vinogradov, N.A. Kocharova, N.A. Paramonov, N.K.
Kochetkov, E.S. Stanislavsky, and G.M. Mashilova 1982. Somatic antigens of
Pseudomonas aeruginosa. The structure of O-specific polysaccharide chains of
P. aeruginosa O:3a,b and O:3a,d lipopolysaccharides. Eur. J. Biochem. 128:81-
90.
68. Kropinski, A.M., V. Lewis and D. Berry. 1987. Effect of growth temperature on
the lipids, outer membrane proteins, and lipopolysaccharides of Pseudomonas
aeruginosa PAO. J. Bacteriol. 165(5):1960-1966.
69. Kulasekara, H.D., I. Ventre, B.R. Kulasekara, A. Lazdunski, A. Filloux, and S.
Lory. 2005. A novel two-component system controls the expression of
Pseudomonas aeruginosa fimbrial cup genes. Mol. Microbiol. 55(2):368-380.
70. Laibson, P.R. 1972. Cornea and Sclera Arch. Ophthalmol. 88:553-574.
71. Latifi, A., M. Foglino, K. Tanaka. P. Williams, and A. Lazdunski. 1996. A
hierarchial quorum-sensing cascade in Pseudomonas aeruginosa links the
151
transcriptional activators LasR and RhlR (VsmR) to expression of the
stationary-phase sigma factor RpoS. Mol. Microbiol. 21: 1137-1146.
72. Lema, G., D. Dryja, 1. Vargas, and G. Enhorning. 2000. Pseudmonas aeruginosa
from patients with cystic fibrosis affects function of pulmonary surfactant
Pediatric Res. 47(1):121-127.
73. Levano-Garcia, J., S. Verjovski-Almeida, and A.C.R. da Silva. 2005. Mapping
transposon insertion sites by touchdown PCR and hybrid degenerate primers.
Biotechniques.38(2):225-229.
74. Li, X.-Z., H. Nikaido, and K. Poole. 1995. Role of MexA-MexB-OprM in
antibiotic efflux in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.
39:1948-1953.
75. Lyczak, J.B., C.L. Cannon, and G.B. Pier. 2000. Establishment of Pseudomonas
aeruginosa infection: lessons from a versatile opportunist Microbes and
Infection. 2: 1 051-1 060.
76. Lynn, W.A., and D.T. Golenbock. 1992. Lipopolysaccharide antagonists.
Immuno!. Today. 13:271-276.
77. Mah, T-F.C. and G.A. O'Toole. 2001. Mechanisms of biofilm resistance to
antimicrobial agents. Trends Micrbio!. 9(1 ):34-39.
78. Matalon, S., B.A. Holm, RR Baker, K. Whitfield, and B.A. Freeman. 1990.
Characterization of antioxidant activities of pulmonary surfactant mixtures.
Biochim Biophys Acta. 1035(2):121-7.
79. McCormack, F.X., and J.A. Whitsett. 2002. The pulmonary collectins, SP-A and
SP-D, orchestrate innate immunity in the lung. J. Clin. Invest. 109:707-712.
152
80. Miller, J.H. 1972. "Experiments in Molecular Genetics." Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
81. Miller, V.L., and J.J. Mekalanos. 1988. A novel sucide vector and its use in
construction of insertion mutations: osmoregulation of outer membrane proteins
and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol.
170(6):2575-2583.
82. Morgenroth, K., and J. Bolz. 1985. Morphological features of interactions
between mucus and surfactant on bronchial mucosa. Respiration. 47:225-231.
83. Mozola, M.A., R.B. Wilson, E.M. Jordan, R.K. Draper, and R.C. Clowes. 1984.
Cloning and expression of a gene segment encoding the enzymatic moiety of
Pseudomonas aeruginosa exotoxin A. J. Bacteriol. 159:683-7.
84. Neidhardt, F.C. 1999. Escherichia coli and Salmonella - Cellular and Molecular
Biology. American Society for Microbiology.
85. Neuhauser, M.M., R.A. Weinstein, R. Rydman, L.H. Danziger, G. Haram, and
J.P. Quinn. 2003. Antiobiotic resistance among Gram-negative bacilli in US
intensive care units: implications for fluoroquinolone use. JAMA. 289:885-888.
86. O'Brien, W.J., and F.E. Frerman. 1977. Evidence for a complex of three ~
oxidation enzymes in Escherichia coli: induction and localization. J. Bacteriol.
132:532-540.
87. Obritsch, M.D., D.N. Fish, R. MacLaren, and R. Jung. 2005. Nosocomial
infections due to multi-drug resistant Pseudomonas aeruginosa: epidemiology
and treatment options. Pharmacotheraphy. 10: 1353-64.
153
88. Ohtsubo, Y., M. Delawary, K. Kimbara, M. Takagi, A. Ohta, and Y. Nagata.
2001. BphS, a key transcriptional regulator of bph genes involved in poly
chlorinated biphenyl/biphenyl degradation in PseudomoTUlS sp. KKS 1 02. J.
BioI.Chem.276:36146-36154.
89. Overath, P., G. Pauli, and H.U. Schairer. 1969. Fatty Acid Degration in
&herichia coli: An Inducible Acyl-CoA Synthetase, the Mapping of old
Mutations, and the Isolation of Regulatory Mutants. Eur. J. Biochem. 7:559-574.
90. Passador, 1., J.M. Cook, MJ. Gambello, 1. Rust, and B.H. Iglewski. 1993.
Expression of PseudomoTUlS aeruginosa virulence genes requires cell-to-cell
communication. Science. 260:1127-1130.
91. Pawar, S., and H. Schulz. 1981. The structure of the multienzyme complex of
fatty acid oxidation from Escherichia coli. J. BioI. Chern. 256:3894-3899.
92. Pavlovski, OR, and B. Wretlind. 1979.Assessment of protease (elastase) as a
PseudomoTUlS aeruginosa virulence factoring experimental mouse burn infection.
Infect. Immun. 24:181-187.
93. Pearson, J., K. Gray, 1. Passador, K. Tucker, A. Eberhard, B. Iglewski, and E.
Greenberg. 1994. Structure of the autoinducer required for expression of
PseudomoTUlS aeruginosa virulence genes. Proc. Nat!. Acad. Sci. USA 91:197-
201.
94. Pier, G.B., M. Grout, T.S. Zaidi, and J.B. Goldberg. 1996. How mutant CFTR
may contribute to PseudomoTUlS aeruginosa infection in cystic fibrosis. Am. J.
Respir. Crit Care Med. 154:S 175-S 182.
154
95. Pier, G.B., M. Grout, T.S. Zaidi, J.C. Olsen, L.G. Johnson, J.R. Yankaskas, and
J.B. Goldberg. 1996. Role of mutant CFTR in hypersusceptibility of cystic
fibrosis patients to lung infections. Science. 271:64-67.
96. Poole, K., K. Krebes, C. McNally, and S. neshat. 1993. Multiple antibiotic
resistance in Pseudomonas aeruginosa: evidence for involvement of an emux
operon. J. Bacteriol. 175:7363-7372.
97. Poole, K., N. Gotoh, H. Tsujimoto, Q. Zaho, A. Walia, T. Yamasaki, S. Neshat,
J. Yamagishi, and T. Nishino. 1996. Overexpression of the mexC-mexD-oprJ
operon in nftB-type multidrug-resistant strains of Pseudomonas aeruginosa.
Mol. Microbiol. 21:713-724.
98. Postle, A.D., A. Mander, K.B.M. Reid, J.Y. Wang, S.M. Wright, M. Moustaki,
and J.O. Warner. 1999. Deficient hydrophilic lung surfactant protein A and D
with normal surfactant phospholipid molecular species in cystic fibrosis. Am. 1.
Respir. Cell Mol. BioI. 20:90-98.
99. Pramanik, A., S. Pawar, E. Antonian, and H. Schulz. 1979. Five differenct
enzymatic activities are associated with the multienzyme complex of fatty acid
oxidation from Escherichia coli. J. Bacteriol. 137:469-473.
100. Pratt, R, C. Drescher, SoY. Park, and G.J. Phillips. 2000. Genetic System for
Reversible Integration of DNA Constructs and lacZ Gene Fusions into the
Escherichia coli Chromosome. Plasmid. 43:12-23.
101. Prosser, B.L., D. Taylor, B.A. Dix, and R. Cleeland. 1987. Method of evaluating
effects of antibiotics on bacterial biofilm. Antimicrob. Agents Chemother.
31:1502-1506.
155
102. Rahme, L.G., E.1. Stevens, S.D. Wolfort, 1. Shao, R.G. Tompkins, and F.M.
Ausubel. 1995. Common virulence factors for bacterial pathogenicity in plants
and animals. Science. 268:1899-1902.
103. Raman, N., and C.C. DiRusso. 1995. Analysis of acyl coenzyme A binding to
the transcription factor FadR and identification of amino acid residues in the
carboxyl terminus required for ligand binding. J. BioI. Chem. 270:1092-1097.
104. Raman, N., P.N. Black and C.C. DiRusso. 1997. Characterization of the fatty
acid-responsive transcription factor FadR. Biochemical and genetic analyses of
the native conformation and functional domains. J. BioI. Chem. 272:30645-
30650.
105. Ramos, J.L., M. Martinez-Bueno, A.J. Molina-Henares, W. Teran, K. Watanabe,
X. Zhang, M.T. Gallegos, R. Brennan, and R. Tobes. 2005. The TetR Family of
Transcriptional Repressors. Microbiol. Mol. BioI. Rev. 69(2):326-356.
106. Rigali, S., A. Derouaux, F. Giannotta, and J. Dusart. 2002. Subdivision of the
helix-tum-helix GntR family of bacterial regulators in the FadR, HutC, MacR,
and YtrA subfamilies. J. BioI. Chem. 277:12507-12515.
107. Rocchetta, H.L., L.L. Burrows, and J.S. Lam. 1999. Genetics of O-Antigen
Biosynthesis in Pseudomonas aeruginosa. Microbiol. Mol. BioI. Rev.
63(3):523-553.
108. Rumbaugh, K.P., J.A. Griswold, and A.N. Hamood. 1999. Contribution of the
regulatory gene lasR to the pathogenesis of Pseudomonas aeruginosa infection
of burned mice. J. Burn. Care. Rehabil. 20:42-49.
156
109. Sambrook, J. Fritsch, E.F. and Maniatis T. (2001). In 3rd 00. Molecular Cloning.
A laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
110. Sato, H., K. Okinaga, H. Saito. 1988. Role of pili in the pathogenesis of P.
aeruginosa burn infection. Microbiol. Immunol. 32:131-139.
Ill. Sawa, T., M. Ohara, K. Kurahashi, S.S. Twining, D.W. Frank, D.B. Doroques, T.
Long, M.A. Gropper, and J.P. Wiener-Kronish. 1998. In vitro cellular toxicity
predicts Pseudomonas aeruginosa virulence in lung infections. Infect. Immun.
66:3242-3249.
112. Schell, M.A., 1985. Transcriptional control of the nah and sal hydrocarbon
degradation operons by the nahR gene product. Gene. 36:301-309.
113. Schell, M.A. 1993. Molecular biology of the LysR family of transcriptional
regulators. Annu. Rev. Microbiol. 47:597-626.
114. Schweizer, H.P., and R. Chuanshuen. 2001. A small broad-host-range lacZ
vector fusion vector with low background activity. BioTechniques. 31:1258-
1262.
115. Silipo, A., R. Lanzetta, A. Amoresano, M. Parrilli and A. Molinaro. 2002.
Ammonium hydroxide hydrolysis: a valuable support in the MALDI-TOF mass
spectroscopy analysis of Lipid A fatty acid distribution. Journal of Lipid
Research. 43:2188-2195.
116. Simon, R, U. Priefer, and A. Puehler. 1983. A broad-host range mobilization
system for in vivo genetic engineering: transposon mutagenesis in Gram
negative bacteria. BioTechnology 1:784-791.
157
117. Sriramulu, D.D., M. Nimitz, and U. Romling. 2005. Proteome analysis reveals
adaptation of Pseudomonas aeruginosa to the cystic fibrosis lung environment.
Proteomics.5(14):3712-3721.
118. Stover, C.K., X.Q. Pham, A.L. Erwin, S.D. Mizoguchi, P. Warrener, M.J.
Hickey, F.S.L. Brinkman, W.O. Hufuagle, D.J. Kowalik, M. Lagrou, R.L.
Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L.L. Brody,
S.N. Coulter, K.R. Folger, A.Kas, K.S. wbig, R. Lim, K. Smith, D. Spencer,
G.K. Wong, Z.Wu, LT. Paulsen, J. Reizer, M.H. Saier, R.E.W. Hancock, S.
Lory, and M.V. Olson, N.r. 2000. Complete genome sequence of Pseudomonas
aeruginosa PAOI, an opportunistic pathogen. Nature. 406:959-964.
119. Studier, F.W., A.H. Rosenberg, J.J.Dunn, and J.W. Dubendorff. 1990. Use ofT7
RNA polymerase to direct expression of cloned genes. Methods Enzymol.
185:60-89.
120. Trautwein, G., and U. Gerischer. 2001. Effects exerted by transcriptional
regulator PcaU from Aclnetobacter sp. Strain ADPI. J. Bacteriol. 183:873-881.
121. Tropel, D., and J.R. van der Meer. 2004. Bacterial Transcriptional Regulators
for Degradation Pathways of Aromatic Compounds. Microbiol. Mol. BioI. Rev.
68(3):474-500.
122. van Aaiten, D.M., C.C. DiRusso, and J. Knudsen. 2001. The structura1 basis of
acyl coenzyme A-dependent regulation of the transcription factor FadR. EMBO
J.20:2041-2050.
123. van Delden, C., and B.H. Iglewski. 1998. Cell-to-cell signaling and
Pseudomonas aeruginosa infections. Emerg. Infect. Dis. 4:551-560.
158
124. Vasil, M.L. 1986. Pseudomonas aeruginosa: biology, mechanisms of virulence,
epidemiology. J. Pediatr. 108(5 Pt 2):800-5.
125. Watanabe, T., R. Inoue, N. Kimura, and K. Furukawa. 2000. Versatile
transcription of biphenyl catabolic bph operon in Pseudomonas
pseudoalca/igenes K.F707. J. BioI. Chem. 275:31016-31023.
126. Wildennan, P.J., A.I. Vasil, Z. Johnson, and M.L. Vasil. 2001. Genetics and
biochemical analyses of a eukaryotic-like phospholipase D of Pseudomonas
aeruginosa suggest horizontal acquisition and a role for persistence in a chronic
pulmonary infection mode. Mol. Microbiol. 39(2):291-303.
127. Wu, W., and S. Jin. 2005. PtrB of Pseudomonas aeruginosa Suppresses the
Type 111 Secretion System under the Stress of DNA Damage. J. Bacteriol.
187(17):6058-6068.
128. Xu, Y., R.J. Heath, Z. Li, C.O. Rock, and S.W. White. 2001. The FadR-DNA
complex. Transcriptional control of fatty acid metabolism in Escherichia coli. J.
BioI. Chem. 276:17373-17379.
129. Yahr, T.L., L.M. Mende-Mueller, M.B. Friese, and D.W. 1997. Identification of
type III secreted products of the Pseudomonas aeruginosa exoenzyme S regulon.
J. Bacteriol. 179:7165-68.
130. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 cloning
vectors and host strains: nucleotide sequences ofM13mpl8 and pUC19 vectors.
Gene. 33:103-119.
131. Yen, K.M., and I.C. Gunsalus. 1985. Regulation of naphthalene catabolic genes
of plasmid NAH7. J. Bacteriol. 162:1008-1013.
159
132. Yoon, S.S., R.F. Hennigan, G.M. Hilliard, V.A, Ochsner, K. Parvatiyar, M.C.
Kamani, H.L. Allen, T.R. DeKievit, P.R. Gardner, V. Schwab, J.J. Rowe, B.H.
Iglewski, T.R. McDennott, R.P. Mason, D.J. Wozniak, R.E. Hancock, M.R.
Parsek, T.L. Noah, R.C. Boucher, and D.J. Hassett. 2002. Pseudomonas
aeruginosa anaerobic respiration in biofi1ms: relationships to cystic fibrosis
pathogenesis. Dev. Cell. 3(4):593-603.
133. Zhang, Y.M., H. Marrakchi, S.W. White, and C.O. Rock. 2003. The application
of computational methods to explore the diversity and structure of bacterial fatty
acid synthase. J. Lipid Res. 44:1-10.
160