Post on 27-Jul-2020
Intimate Partner ViolenceIntimate Partner Violenceand the Childand the Child--bearing Cycle:bearing Cycle:
Issues in Prevention and InterventionIssues in Prevention and Intervention
Patricia Janssen, PhDUBC School of Population and Public Health
Director, MPH programCo-lead Maternal Child Health Theme
Child and Family Research InstituteWomen’s Health Research Institute
BC Injury Prevention Conference 2010
Intimate Partner Violence
Any act of violence that results in or is likely to result in physical, sexual or psychological harm or suffering, including threats of such acts, coercion or arbitrary deprivation of liberty, whether occurring in public or in private life.
United Nations 1993 Declaration on the Elimination of Violence
Janssen et al, 2003
Adjusted RRs
Lipskey et al, 2003
Adj Odds Ratio
Kady et al,2005
Adj Odds RatioAntepartum Hemorrhage 3.79 (1.38-10.4)
1.8 (1.4-2.5)
Preterm Delivery 1.35 (0.67-2.56)
1.27 (0.48-3.37) 2.4 (1.8-3.3)
< 32 weeks 2.83 (0.94-8.50) IUGR 3.06 (1.02-9.14) Low birth weight
3.51 (1.27-9.72) 1.7 (1.5-1.9)
Perinatal Death 8.06 (1.42-45.63)
8.0 (4.6-14.3)
Neonatal Death
7.28 (1.28-42.3)
Physical Abuse and Adverse Fetal/Neonatal OutcomesPhysical Abuse and Adverse Fetal/Neonatal Outcomes
Vancouver Sun, March 12
In 2006-07, three pregnant or newly mothering women in the Lower Mainland of BC, were murdered by their husbands and a fourth was shot and critically injured.
Prevalence Prevalence
Maternity Experiences Survey
• Population-based survey• 6,421 women• Canadian birth mothers >15 years of age• Eight months postpartum • Living with their babies
Maternity Experiences Survey
Questions on abuse adapted form the Canadian National Violence Against Women Survey (2003).
In the last two years has anyone ever….– Slapped, kicked, bit, hit, beaten, choked, used or
threatened a gun, knife, forced unwanted sexual activity ?
– Hit with anything, thrown anything, pushed, grabbed or shoved in a way that could have hurt you?
• Overall, 10.9% of the sample reported experiencing any one of these abuses by partners (5.7%), family (1.8%), friends (1.4%), or strangers/other (2.3%)
• Only 3.3% were exposed during pregnancy.
Maternity Experiences Survey
Children as Witness
The 2004 Canadian General Social Survey reports that 394,000 spousal violence victims reported that children saw or heard the violence. One third of all incidents of spousal violence involve children
Impact Impact
Physical Abuse During PregnancyStewart and Cecutti, CMAJ, 1993
•6.6% of 548 women abused during pregnancy
•Abuse associated with:•Unwanted/unplanned pregnancy•Increased parity•Loss of control over health of pregnancy/fetus•“Chance” played the most important role in the
outcome of pregnancy•Postpartum depression – 69%
The impact of domestic violence on the bonding process between mother and child
Zeitlin et al. 1999 Arch Women’s Mental Health
0
10
20
30
40
50
60
70
M-Fetal* M-Infant** PP Depression**
AbusedControl
* = p<.05 ** = p<.0001
Hig
her s
core
= n
egat
ive
bond
ing
Infant Development and Developmental Risk,Zeahnah et al, J Am Acad Child and Adolesc Psychiat, 1997
MaternalDepression
Insecure attachment
Social Competence
Language and Cognitive Problems
Depression in offspring
Children who Witness
• 20% meet criteria for PTSD ( Mertin et al, 2002)
• 60-75% are physically abused (Osofsky, review)
• Clinical behavioral problems more common in
26- 75% ( 8 studies)
Infants
• Disrupted sleeping and feeding routines with poor weight gain
• Excessive screaming
• Developmentally delayed
• Separation anxiety
Preschoolers
• Withdrawn, subdued or mute behaviour
• Exhibit anxiety and clinging behaviour
• Nightmares
• Regressive behaviour such as bed-wetting and thumb-sucking
• Attention deficit and hyperactivity disorders
School Age
• Poor school performance
• Aggressive behaviour
• Moodiness
• Vague somatic complaints
• Obsessive compulsive disorders
Adolescents
• School dropout or absenteeism
• Poor impulse control
• Use of substances
• Leaving home
• Feelings of guilt
Risk of Crime Victimization among Youth Exposed to Domestic Violence
Mitchell et al., J Interpers Viol 2001
0
2
4
6
8
10
12
14
DomesticViolence
Non-domesticViolence
No Crime
Any victimizationViolent victimization
Risk of victimization 115% higher for boys and 229% higher for girls
%
Longitudinal Effect of Intimate Partner Abuse on High-Risk Behavior Among Adolescents (11-22 yrs)
Roberts et al.Arch Pediatr Adolesc Med 2003
• IPV – 273/2236 males (12.2%)- 302/2206 females (13.7%)
• Abuse by an intimate partner precedes involvement in:– illicit substance use– antisocial behavior– violent behavior– suicidal behavior – depression
• Controlled for SES, # partners, baseline risk behavior, prior abuse.
What causes violent behaviour?
• Learned by witnessing violence
• Cultural belief in a status that is central and deserving.
• Effective means of maintaining control
• Failure of the criminal justice system to make the perpetrator accountable by charging and prosecuting
• Genetics: Nr2e1, MaoA.
Genetics of Aggressive Behaviour: Monoamine System Analyses
James L. Kennedy MD FRCPCHead, Neurogenetics Section,
Centre for Addiction and Mental Health;I’Anson Professor of Psychiatry and Medical Science, University of Toronto
& J Beitchman, S Ehtesham, H Mik, D Bender, G Subramanian
Serotonin Transporter Gene Structure
5
VNTR
3AP1
SP1 AP1
SP1
AP2
TATA
Exon I XIV
44 bp
ins / del
aaaaaaagaataaaacatgcagcccccccagcatataaatgca
II
5HTTLPR
NB 5HTTLPR is functional: l/l assoc. with 2x ↑ expression than l/s or s/s
Level of Callous-Unemotional Traits in aggressive children vs 5HTT VNTR genotype
12/12 10/12 10/10
A.R. Hariri, V.S. Mattay, A. Tessitore, B. Kolachana, F. Fera, D. Goldman, M.F. Egan, D.R. Weinberger. Science, 297: 400-403 (2002).
Serotonin Transporter Genetic Variation and the Response of the Human Amygdala
Individuals carrying the s variant of the 5HTTLPR exhibit an increased amygdala response to fearful stimuli when compared to those carrying the lvariant.
Sheard M, et al. 1976
Effect of Lithium on Aggressionin Prison Inmates
DrugFree
DrugFree
Medication
Months
Mean
I nfra
c tio
n s P
e r M
o nth
1 2 3 4 50.0
0.1
0.2
0.3
0.4
0.5
0.6
Assessment Assessment
For patient's nurse to complete prior to discharge. Please ask to spend a few minutes alone with your patient. If you need a translator, please do not use a family member.
Please see reverse for Chinese translation, Punjabi and Vietnamese versions are in the domestic violence binders in the modules.
Introduction:As health care providers we know that family violence affects women’s health.
Because of the widespread problem of family violence, it is routine in this hospital to ask everyone these questions.
Question:Since you've been pregnant, have you been hit, slapped, kicked or otherwise
physically hurt by an intimate partner? Yes ____ No ____
Have you been afraid of a current or former intimate partner during your pregnancy?
Yes ____ No ____
Prior to your pregnancy, was your partner hurting you ?Yes ____ No ____ making you afraid?Yes ____ No ____
*************************************************************1. Provide safety planning if any answer is "yes". 2. Refer to a social worker if women would like one. (Guidelines for referral to
social workers are located in the Domestic Violence Binder in every module.)3. Offer her a community resources card. (in patient bathrooms, Chinese cards in
Domestic Violence Binders). 4. Document above interventions(1- 3) in progress notes.
Are people willing to be asked?Are people willing to be asked?
Bacchus, BJOG 2002• Yes, if safe, confidential, health professional is trained,
empathic, and non-judgmental. (Qualitative design)
Rodriguez, J Fam Pract 2001• Yes, if direct (qualitative)
Friedman, Arch Intern Med 1992• Routine inquiry favoured by 78% of primary care patients;
90% believed physician could help (Survey)
McNutt, L. JAMWA, 1999• 88% of shelter residents advocated routine screening
Will they act on offers of help?Will they act on offers of help?
Kresnoff, M. Injury Prevention, 2002• Among 528 women identified as intimate partner victims in emergency
departments, 84% agreed to see an advocate and 54% of those accepted case management. Among these, 50% remained free after 6weeks.
A Little Contact Makes A Big Difference
One night at a shelter significantly decreased abuse with or without 10-wk advocacy program.
Sullivan et al, 1999
Safety Planning
Help her make a plan for the next time:
•Who will she call?•Where can she go?•Emergency bag outside the house
• Cash, credit card, driver’s license, passports, birth certificate, immigration papers, care card, phone numbers, care keys and gas
• Copy of protective orders, custody papers
• Take the children•Stay between him and the door•Hide weapons
McFarlane et al. An Intervention to Increase Safety Behaviors of Abused Women Nurs Res 2002;51:347-345
DesignRCT
SettingTexas, n = 150, women seeking protection orders
ProtocolSix 10 min phone sessions on safety planning vs.usual care. Menu of 15 safety behaviors discussed
Safety Behavior Adoption Over 8-wks
10.4
11.5
12.6
13.2
13.6 13.713.9
10
11
12
13
14
INTAKE
48HR
1WK
2WK
3WK
5WK
8WK
SAFETY BEHAVIORS OVER 18-MONTHS
10.4
12.5
12 11.9 12
9.69.9
10.410.6 10.5
9
10
11
12
13
INTAKE
3-MOS
6-MOS
12-M
OS
18-M
OS
NU
MB
ER
OF
BE
HA
VIO
RS
RX
NORX
McFarlane et al. JAMA
DesignRCT
SettingTexas, N = 360, English and Spanish-speaking women attending primary care clinics
ProtocolNurse case manager: 20 minute session on safety behaviors, support, and listeningResource card
vs. Screening and resource card
Results at six months
Safety behaviors Sig. more safety behaviors for case management group, p =.03
Threats and assault Lower for both groups, p<.001(10 threats less, 12 assaults less)
Danger for lethal assault Lower for both groups p<.001
A successful assessment means you have
•Acknowledged the problem•Validated the victim’s experience•Stated that they are not to blame•Assessed safety needs•Asked about safety of children•Offered help•Documented
Prediction of Repeat Visits by Victims of Intimate Partner Violence to Emergency
Departments in Vancouver, BC
Patricia A Janssen, PhD1,3,4 Kathleen Mackay, MSW 2,5,6
School of Population and Public Health1 and Surgery2, Faculty of Medicine, School of Nursing3 University of British Columbia, B.C.,
Child and Family Research Institute 4, Vancouver Coastal Health,5Providence Health Care,6 Vancouver, B.C.,
Repeaters (VGH, n = 317)50 patients (5-10 visits each) 250 visits in total
Drug overdose 13 (26%)Alcohol intoxication 7 (14%)Psychological problems 6 (12%)Suicide attempt/ideation 5 (10%)Infections 16 (32%)Lacerations/contusions 20 (40%)Fractures 12 (24%)Pain 11 (22%)Burns 1 (2%)Trauma 4 (8%)
Repeaters (VGH)50 patients (11-20 visits each) 450 visits in total
Drug overdose 8 (17.7%)Alcohol intoxication 12 (26.6%)Psychological problems 12 (26.6%)Suicide attempt/ideation 4 (9%)Infections 20 (44.4%)Lacerations/contusions 25 (55.5%)Fractures 10 (22.2%)Pain 15 (33.3%)Burns 1 (2%)Trauma 4 (9%)
Repeaters (VGH)25 patients (>20 visits each) 500 visits in total
Disclosed violence on 1.5 visits
Drug overdose 16 (64%)Alcohol intoxication 12 (25%)Psychological problems 8 (32%)Suicide attempt/ideation 3 (12%)Infections 14 (56%)Lacerations/contusions 9 (36%)Fractures 4 (16%)Pain 5 (20%)Burns 1 (4%)
Treatment and InterventionTreatment and Intervention
Parent-Child Therapy
• Teaching attachment – warmth mutuality, empathy.
• Avoid role reversal, enmeshment, overprotectiveness, and attributing negative qualities of the spouse to the child.
Key Message Key Message
The problem belongs to the parents – it is not the child’s fault.
Absolution from blame.
The Worry Jar
The 4th R – Reading, “Riting,” “Rithmatic”and RelationshipsRelationships
• School-based program aimed at bullying, peer and dating violence.
• Emphasizes knowledge, positive relationship skills and decision-making.
• Use role play to develop solutions, trying responses, responding in the presence of others, responding in the face of resistance.
• Staff and teacher awareness education and involvement by peer-led groups
• Evaluated in a randomized controlled trial.- skill acquisition with actors and blinded raters.
Community Interventions:
• Can bring people together
• Make changes more quickly
• Measure the problem and evaluate change
• Address social norms• Build cultural identity• Share information• Target resources
Who can help with prevention ?The teacherThe veterinarianThe local newspaperThe dentistThe community centreThe churchThe neighbourThe taxi driverThe bus driverThe landlordThe social assistance worker
In addition to the nurse, doctor and police officer,,,,
The Way Forward
1. Public awareness and leadership2. Education (especially youth):
• Conflict resolution• Substance abuse• Identity• Skill training
3. Health care• Assessment • Safety Planning and Referral• Ongoing Surveillance
4. Municipal• Emergency/transition housing• Emergency transportation• Emergency funds
The Way Forward
• Develop methods for local surveillance
– Routine screening at well woman/maternity/pediatric care– Understand risk factors and assess risk– Maternal mortality review
• Study and evaluate interventions
– Information for new immigrants– Consistent interactive action-oriented training for adolescent– Emergency housing– Emergency rooms as public health agencies
Keep mothers safe, babies safe, children, safe
On release from ACCW, women are met at the bus stop and invited to learn about the study, and, if interested sign a consent form.
They then have a baseline interview with a community-based researcher, that is, a women trained in interviewing who herself has had experience with incarceration.
Methods
Women are asked about their health, education, job skills, family, support, housing and other issues in accordance with the nine health goals.
The community-based researcher will contact the participants for follow-up interviews at 3, 6, 9 and 12 months.
Evaluation of the Mobile Access Project (MAP)P Janssen,PhD, UBC Health Care & Epidemiology and Child and Family Research Institute,
P Spittal, UBC Health Care & Epidemiology and Centre of Excellence, HIV/AIDS
K. Gibson, WISH, R. Bowen, PACE
Safety
• 16% of women interviewed could recall a specific incident when the van had prevented them from being injured.
• 10% of women could remember a specific time when the van had prevented them from being sexually assaulted.
Low Threshold Interventions
• Add stuff from Surrey• Add stuff from coroner’s grant • Get report on severe morbidity and
mortality• Richmond – not during preg, pp• New prison findings
Health and Use of Health Services of Children Exposed to Violence in their Families
Onyskiw, J. 2002, Can J Public Health
0
5
10
15
20
25
30
GP Peds OtherMD
PHN Dentist Childwelfare
Px
WitnessNon-Witness%
Behaviors of Children exposed to IPV Before and1 Year After a Treatment Program for Their Mother –
McFarlane et al, 2005.
What is “treatment”? - Mother-centered
• Reinforcing consistent mothering to minimize aggression and oppositional behaviour
• Authoritative parenting – high levels of both warmth and structure
• Reinforcing perception of maternal efficacy – acts as a buffer against the development of poor self esteem.
What is “treatment”? - Child-centered
• Teaching child coping behaviours increases appraisals of self-efficacy – Need affirmations, not being told what not to do.
• Child safety planning – calling 911, having a safe hiding place, running to a trusted person for help
• Calming behavours (emotion-focused coping) can buffer children from conflict – listening to music, writing in a diary, spending time with friends.
Relationship violence
Dating violence
Emotional/ Psychological Violence
http://www.nwac-hg.org
Risk Risk Outcome Change process
Protective Outcome
Self blame, stigma, hopelessness
Depression Boundary maintenance, absolution from blame, Identification of family strengths
Affirmation of family
Emotional insecurity, perceived threat, maternal distress
Anxiety Maternal social support, maternal empowerment
Perceived ability of mother to cope, maternal efficacy, well-being
Unregulated distress, denial and numbing
PTSD Affect regulation skills, therapeutic re-exposure
Mastery of affect expression,emotional regulation
Maternal blame, spill over
Aggression, intergenerational transmission of violence
Positive appraisals of mother, positive maternal-child relations
Empathic mutuality,,boundary maintenance
Protective Processes Kerig, 2003
Incidence Rate in Non-
injured/1000
Incidence Rate for Prenatal
Assault/1000 Preterm Delivery 96.9 152 Low birth weight 57.9 133.5 Fetal Death 5.0 8.9 Neonatal Death 6.8 12.8 Infant Death 9.0 19.6
Physical Abuse and Rates of Adverse Physical Abuse and Rates of Adverse Fetal/Neonatal OutcomesFetal/Neonatal OutcomesKady et al.Kady et al.
Prevalence Prevalence