Post on 29-May-2020
0
BIOLOGICAL CONTROL OF MAJOR COTTON PESTS
INCLUDING MEALY BUG IN PAKISTAN
(PC-I)
MINISTRY OF FOOD, AGRICULTURE AND LIVESTOCK
GOVERNMENT OF PAKISTAN
January, 2008 Revised as per comments made in Pre-CDWP meeting held on 22 April, 2008, subsequently
in CDWP held on 30 April 08 and Consultative Meeting on 17 May 08
1
Code Number for the Project______________
(To be filled in by Planning Commission)
1. Name of the Project: Biological Control of Major Cotton Pests including Mealy
Bug in Pakistan
2. Location: Punjab: (all cotton growing areas)
Sindh: (all cotton growing areas)
Balochistan: (all cotton growing areas)
NWFP: (all cotton growing areas)
Federal: (FCU, NARC, CCRI, NIAB)
International: (CABI South Asia)
3. Authority responsible for:
i. Sponsoring: Government of Pakistan
ii. Execution: Ministry of Food, Agriculture and Livestock, Islamabad:
Government of the Punjab (AARI, Faisalabad)
Government of Sindh (ARI, Tandojam)
Government of Balochistan (ARI, Quetta)
Government of NWFP (ARI, D. I. Khan)
Federal (NARC, Islamabad, CCRI, Multan, CRI, Sakrand,
NIAB, Faisalabad)
International Institute (CABI South Asia, Rawalpindi)
iii. Operation, maintenance and responsibilities
Organization Responsibility
MINFAL, Islamabad Coordination & Monitoring
CABI South Asia,
Rawalpindi
Biological control procedures and methodologies, exploration and introduction of exotic
natural enemies, mass production of endemic and exotic natural enemies of cotton pests at
natural enemy field reservoirs, laboratory, training of farmers, entomopathogens
interventions on model farms in collaboration with AARI, Faisalabad, NIAB and ARI
Tando Jam
Ayub Agri. Res Inst,
Faisalabad
Mass scale rearing of natural enemies for biological control in Punjab and training of
farmers. Establish insectary Establishment of a Model Farm of Biological control for
demonstration in collaboration with CABI
Central Cotton Res
Inst., Multan
Safe use of pesticides, field surveys and study of population development in farmers fields
and project managed farms for control of mealy bug in Punjab
Cotton Research
Institute, Sakrand
Safe use of pesticides, field surveys and study of population development in farmers fields
and project managed farms for control of mealy bug in Sindh.
Agri. Res Institute,
Tandojam
Mass scale rearing of natural enemies for biological control in Sindh and training of
farmers. Establishment of a model farm of Biological control for demonstration in
collaboration with CABI .
National Agri. Res
Center, Islamabad
Mealy bug control through bio-pesticides
Agriculture Res Inst.
D. I. Khan
Pests incidence in cotton and other plants, safe use of pesticides, biological control
interventions
Agriculture Res Inst
Quetta
Mass scale rearing of natural enemies for biological control in Balochistan and training of
farmers and safe use of pesticides for mealy bug control
NIAB, Faisalabad Study biology and ecology of cotton insects. Assist AARI on biological control
interventions at model farm for demonstration plot of biological control in collaboration
with CABI
2
iv. Concerned federal ministry: Ministry of Food, Agriculture and Livestock,
Islamabad
4. Plan Provision
i. If the Project is included in the
medium term/ five years Plan,
Specify actual allocation –
ii. If not included in the current
plan, what warrants its inclusion
and how it is now proposed to be
accommodated
It is continuation of the one year’s on-going
project (costing Rs 26.470 million). Presently
its operations are being financed through ASPL
but its three years phase will be funded out of
PSDP. Total block
provision
Amount
already
committed
Amount
proposed for
the project
Balance
available iii. If the project is proposed to be
financed out of block provision,
indicate: - - - -
5. Project objectives and its relationship with Sector’s objectives
The project objectives are in line with the Sector’s overall objectives. The management
strategy of major pests on cotton will be developed and the knowledge already available on
management of insect pests will be implemented on model farms of 500 acres in one union
council one each in province of Punjab and Sindh. In the first phase, cotton pests will be
addressed on priority as cotton crop is being badly damaged by mealy bug during last two
years (2005-06 & 2006-07). The Experience gained and knowledge generated by the project
will greatly help to enhance productivity of other crops as well by minimizing pest losses and
increase farmer’s income which will directly play effective role in poverty alleviation in rural
areas. The knowledge generated on management of mealy bug and other pests on cotton will
be disseminated through workshops, seminars, farmer gatherings, electronic media, Farmers’
Field Schools approach to create awareness among the researchers, extension workers and
the farmers. The specific objectives of the project are as under:
Specific objectives:
• The project aims at developing and implementing short term and long term biological
control based IPM techniques for controlling major pests on cotton including mealy
bug.
• Protection of natural resources and their utilization in short term and long term
management of mealy bug on cotton.
• Exploration and introduction of exotic natural enemies for control of mealy bug.
• Achieve sustainability in production of cotton crop.
• Establish model farms for others to follow the good agriculture practices in
minimizing insecticides use, capacity building of farmers’ community, extension
workers, researchers in ecological pest management.
3
• Identification of the cotton mealy bug parasitoid complex using molecular markers/
PCR primers.
• Develop and integrate options such as biopesticides and entomopathogenic nematodes with biological control for controlling pests on cotton crop.
6. Description, justification and technical parameters
A) Scope
Cotton plays a pivotal role in Pakistan’s economy. It accounts for about 60% of its export and
over 55% of domestic edible oil production, provides raw materials to about 461 textile mills,
1200 ginning factories (PCCC, 2007) and about 6000 small oil producers. Pakistan ranks fourth
in cotton production and third in cotton consumption.
In view of cotton importance, Government of Pakistan supports all efforts which improve cotton
yield, however, the yield of lint per hectare is much lower compared to other cotton producing
countries like Australia, China, Egypt, Turkey and Syria. Insects and diseases are the main
constraints in cotton production. In cotton alone, pest attack causes a loss of billions of rupees
annually (Ahmed, 1995). It is difficult to estimate correct and scientific data on the losses
caused by insect pests and diseases as many variables and complicated factors are involved. In
monitory terms the loss to crops in Pakistan is estimated around Rs 130 billion annually (Baloch,
1995).
Plant protection in the Pakistan is mostly based on pesticides. The pesticides consumption which
was 665 tons in 1980 has now increased many times more exceeding 45,000 tones annually.
Cotton is the recipient of more than 70% of pesticides used in all crops. The use of pesticides in
Pakistan is so common that it is the second largest consumer of pesticides in Asia. This colossal
increase in pesticide consumption has not led necessarily to increase the yield of crops (Poswal
& Williams, 1998; Ahmed & Poswal, 2000). The most concerning situation is experienced with
the present control strategy of repeated use of insecticides for mealy bug control on cotton that
has made the pest more devastating to fruits, vegetables, fodders, ornamental plants in addition
to cotton.
Contrary to chemical control, biological control based IPM increases the ecological and
economic sustainability of farming systems by reducing both the risk of crop losses and risk of
human health from insecticides use. This approach is not only friendly to human health and the
environment but it is also sustainable and self perpetuating. The benefit - cost ratios are
correspondingly high (Zeddies et al, 2001). Further more the use of insecticides in crops has
resulted in destruction of natural enemies of the pests and pest resurgence is common and more
insecticides have to be applied to save the crop (Abbas and El-Deeb, 1993).
The immediate application of current ecological knowledge and technology to pesticides
dilemma can reduce about 50% use of pesticides. The achievement of complete control by
natural enemies is ideal goal and generally the most practical single approach to pest
management. However, even though its use can be very greatly expanded, this must be based on
increased bio-ecological research. There are refractory pests not amenable to control by natural
enemies and these will require to be addressed with biological control based IPM technologies
where pesticides if used safely may find its place in effective management of pests within
tolerable limits.
4
It is not easy to shift the present chemical control based pest management to biological control
based IPM in agricultural crops in Pakistan especially in cotton which is heavily sprayed with
pesticides. The change to ecological pest management is a practical matter to the farmer and he
is not prepared to suffer any interim financial losses during the change over. Pest control strategy
dependent on heavy spraying and dusting of pesticides can not be merely stopped with the
assurance that biological control will take over. Therefore, there is need to display the biological
control based IPM of pests mainly on cotton the crop greatest recipient of the pesticides used in
the country.
To begin with an area of 500 acres of cotton in a Tehsil/Union in Punjab and Sindh is in view to
be taken as pesticide free area (practically an area where pesticides if at all become necessary
will be used safely on need basis only on a limited quantity for a limited time.) The experience
gained in this area will be transferred at the same time in adjoining areas and then spread country
wide in the second phase of the project. The plant protectionists and farmers need to be trained
on the concept of farmer field school making community aware of advantages of ecological pest
management in achieving sustainability in yields and improvement in quality of produce with
minimum input costs and better profit. The farmers of this area will have access to markets that
pay more for quality produce at the national and international level.
Pest management programs have to be designed for each area by a team of entomologists and
agronomists in consultation with subject specialists. Training for farmers and extensions on the
pattern of farmer field schools are to be arranged and whole community is to be involved in
ecological management of pests in cotton. The plants as alternate hosts of cotton pests are also to
be considered in management schemes.
The basic knowledge of the biology and ecology of insect pests and their natural enemies
associated with cotton in Pakistan is available with CABI SA, CCRI, AARI and other
organizations that can be best utilized in controlling these pests through biological control based
IPM approach. Already foundation on mass production of predators and their conservation have
been laid down for a notorious pest mealy bug by CABI SA and we can move forward for using
them effectively in controlling this pest on cotton and other crops. Classical biological control
has also to be attempted as well for exotic pests like mealy bug on cotton.
The government support to farmers in biological control of pests will help to enhance the
confidence of farming community to rely more on renewable natural resources in perpetual
control of pests than depending on pesticides for timely relief in lowering down pests’ numbers
in their crops.
It is essential that Pakistan build on biological control based IPM research traditions and promote
supervised control of pests than giving free hand to private sector on massive use of pesticides,
strengthen extension services at village level on farmer field school concept in close
collaboration with the research findings immediately transferable to farmers for IPM /organic
farming.
B) Background
i) Major cotton pests other than mealy bug
The spectrum of pests of cotton is broad and the list is long. They are divided in two major
groups. The first group is of sucking pests (white fly, thrips, jassids, aphids and mites) and
5
second group is of bollworms (spotted boll worm, pink bollworm, African bollworm, army worm
etc). So far, white fly, boll worms and army worm have the major pests of cotton crop. All
efforts were focused to control these pests with pesticides ignoring the basic fact that most of
these pests have good natural enemy complexes. Their role had been completely ignored while
deciding for chemical control based plant protection policy. The basic knowledge of the biology
and ecology of insect pests and their natural enemies associated with cotton in Pakistan is
available with CABI SA, CCRI, AARI, NIAB and other organizations and can be best utilized in
controlling these pests with holistic approach through biological control based IPM considering
the whole agro ecosystem.
ii) Mealy bug
Mealy bug is a new pest on cotton in Pakistan. CABI SA had conducted 15 year survey of scale
insects and mealy bugs in Pakistan but this complex of species of Phenacoccus was never
recorded before 2005. Recently, the mealy bug has gained a prime importance. This insect is
highly polyphagous. It has attacked not only cotton but it has engulfed almost whole agriculture
of Pakistan and needs to be addressed on top priority. Its infestation has been observed on about
160 plants by CCRI, Multan during last three years. It has caused a huge economic loss to cotton
crop during last three years. Therefore, this pest needs to be addressed on priority as it has
impacted on whole agricultural flora.
This was first detected damaging cotton and other plants at agriculture research farm Vehari in
2005. It has now been recorded by CCRI on vegetables (tomato, egg plant, okra etc), field crops
(chili, tobacco, wheat, fruits, etc), ornamental plants, weeds, fodders and is serious threat to
agriculture of Pakistan. According to the present study by FAST National University reveals that
this insect is responsible for ruining an estimated 3.1 million bale of cotton. Further more
farmers have to bear additional costs Rs 1500 per acre for its control with insecticides. In most of
cases the pesticides were in effective in controlling it on cotton. It has been noted that these
could suppress mealy bug incidence only to a specific level (DAWN News, 22 October, 2007).
The recent pest status of mealy bug on cotton and other crops demand appropriate control
strategy.
iii) Formulation of One Year Project A one year project titled “Control of Cotton Mealy Bug in Pakistan” was prepared on the
instructions of MINFAL to initiate interventions to combat mealy bug immediately with the view
that preparation and approval of main project on mealy bug may take 6 to 12 months. Any delay
in controlling this pest may cause huge losses to cotton. Therefore, a one year project was
prepared which was approved by DDWP of MINFAL at a cost of Rs 26.470 million and its
funding was give from ASPL project. At that time it was envisaged that the full project (of 3-4
years duration) will be prepared and approved during the implementation of the one year project.
Under this project country wide filed interventions were started according to a planned approach.
The followings are the major out come/achievements of the project:
a) Identification of mealy bug: Two pronged approach was used for the identification of
the insect. On one hand its samples were sent British Natural History Museum and they
tentatively identified as Phenacoccus solani Ferris.
On the other hand its molecular identification was done by NIBGE and CABI scientists.
In this study a set of primers (set1F and set1R) was designed in 18S ribosomal sequence
available in the database (Acc. No. AY426058) and were synthesized by a commercial
company (eoligoes USA). DNA from three individuals collected from Multan, Faisalabad
6
and Rawalpindi each was extracted by protenase K method. PCR was carried out using
primers set1F (GAATTAAGCCATGCATGTCTCAGTGCAA) and Set1R
(CCTGCCTAATTGATCCTCGTGTGACCAAG) in standard conditions and expected
size PCR product were obtained. PCR products were cloned in cloning vector
(pTZ57/RT) and confirmed by restricting with endonucleases EcoRI and PstI. Clones
were sequenced commercially by Macrogen (Korea). Sequences of all three individuals
were checked for identification with the Korean sequence. Blast search showed that all
three genes from local species were 97% identical to Phenacoccus solani. Similarly all
the three sequences of local mealybug genes were aligned and they showed 100%
similarity to one another, which shows that same species (Phenacoccus solani) is found
in those districts on cotton and Hibiscus. Phylogenetic analysis was performed using
thirty three corresponding closest matching sequences in the database (Genbank) which
were aligned using ClustaX. In evolutionary tree all the sequences clearly grouped
according to their genera. Keeping in view the results of sequences and phylogenetic
analysis we are able to suggest that the local species from Pakistan on cotton is same or a
close relative of P. solani and still more sequences from different areas of Pakistan are in
process.
b) Establishment of natural enemies (of mealy bug) field reservoirs: Three field
reservoirs one each of 5 acres at Multan, Tandojam and Lasbela have been established to
develop mass rearing techniques of mealy bug predators and their conservation. Over a
fortnight intervals a capacity was achieved of production of predators in thousands. This
capacity has to be enhanced to their production in millions. This still needs a lot of
improvement to make easier for farmers to adopt the technique at their farms. Studies for
conservation of predators are also going on at these filed reservoirs. Some of the
promising predators have been identified who are density dependent and their population
fluctuates along with the population of mealy bug. In future, with augmentation and their
conservation these predators can be utilized for controlling mealy bug. Such field
reservoirs will turn out into field insectaries for mass production of predators. From
where the predators could collected and released at farmers fields.
c) Biological studies of mealy bug: The biological studies indicate that mealy bug
breeding pattern changes with the season in a year. For example in winter, the mealy bug
started laying eggs with out forming pouch attached to the body, while in summer they
form pouches which are attached to their body. In laboratory it has been found that the
unmated females laid eggs with out any pouch where as the mated females laid eggs /
nymphs in a pouch attached with the body. The mealy bugs have been found breeding
almost through out the year in Sindh where as in Punjab, where winters are cold, its
breeding slowed down. Over wintering behaviors has also been studied. At Mutlan, its
over-wintering second and third instar nymphs were found in the roots of sunflower, and
crumpled leaves of sunflower and Anthorium sp. There may be more over wintering sites
which need to be studied and detected.
d) Identification of natural enemies associated with the mealy bug: Twelve species of
predators were recorded associated with the mealy bug in Pakistan. These include
Coccinellids {Brumus suturalis, Scymnus coccivora, Scymnus sp, Nephus sp, Menochilus
sexmaculatus, Coccinella septempunctata, Hyperaspis spp(2)}, Neuropteran
{Chrysoperla sp}, Ceccidomyid {an unidentified sp) and hemipteran {unidentified
spp(2)} by CCRI Multan, AARI Faisalabad, ARI Tandojam and CABI SA. Some of
these predators such as Brumus suturalis, Scymnus coccivora were promising as they
7
were density dependent and their population fluctuated along with the host mealy bug.
Chrysoperla sp was also recorded in large numbers associated with mealy bug on some
plants like cotton, sunflower and Abutilon. Besides predators, two species of parasitoids
were also reared occasionally from the mealy bug.
e) Introduction of exotic predators: Cryptoleamus montrouizeiri known as mealy bug
destroyer has been imported by CABI SA from California. This species which is of
Australian origin has been introduced in over 50 countries for controlling mealy bug. Its
colony has been well established in the laboratory at Multan. Its both larvae and adults
feed on all development stages of the mealy bug. It has high biotic potential and feeding
rate. Techniques are being developed for its mass production and release in the field for
studies on its role for controlling mealy bug in different climates of cotton growing areas
of Pakistan. Studies are required for identifying the requirements of the predator
necessary for its acclimatization and breeding in harsh summer and winter climates of
Pakistan. This has also been supplied to AARI Faisalabad, CCRI Multan, ARI Tando
Jam and NIAB Faislabad for mass production at their centers.
f) Safe use of pesticides: Several pesticides were regularly studied/tested by the AARI
Faisalabad, CCRI Multan, ARI Tando Jam. Following have been recommended to
farmers to control mealy bug: (i) Profenofos, (ii) Methidathion, (iii) Acetamitrid, (iv)
Methomyl, (v) Carbaryl, (vi) Imidachloprid and (vii) Chlorpyriphos.
g) Developing GMOs for the control of mealy bug: Studies are in progress at NIBGE
for developing genetically modified cotton which would be tolerant / resistant to mealy
bug. They have identified, Hvt gene which is having a gene product effective in killing
mealy bug. Further testing of gene product in cotton plant and its expression at
appropriate time is needed.
h) Formulation of strategy for the control of cotton pests: During the one year project,
mealy bug attack on cotton crop of 2007-08 remained a hot topic of Standing Committee
of National Assembly on Agriculture. This issue was addressed and discussed threadbare
in at least five such meetings. It got top priority of the parliamentarians, government
institutions and farming community in particular. All corners stressed unanimously for
developing a sustainable solution for controlling the menace of the mealy bug. The issue
was also discussed with P & D division in three meetings. During these meetings, P & D
Division suggested to prepare a three years project on biological control of major pests of
cotton with special emphasis on mealy bug. During the year, various strategies were
worked out for the control of the mealy bug and other major insects of cotton. The figure
given below summarizes the major pests and their control options.
8
A brief graphic representation of insect pests of cotton and their control options are given below:
C) Justification
C) Justification
Mealy bug
Whitefly
Jassids
Thrips
Aphid
Boll worms
Army worm
Boll worms Sucking Mass production,
conservation and
augmentation of
endemic predators at
parasitoids at NEFR
& Farmer fields
Integration of other
options such as
entomopathogenic
nematodes,
biopesticides, Hvt
gene product for
controlling mealy
bug.
Cotton (major pests)
Control options for
mealy bug
Classical
biological
control
Import of
parasitoids
from
California
Import of
Cryptolaemus
montrouzieri
Mass
production &
augmentation
Mass
production &
augmentation
Control options for sucking pests other than mealy
bugs on cotton Control options for Boll worms
American
boll
worm
Pink
boll
worm
Earias
spp. Army
worm
Augmentati
on of egg
parasitoids
+
Mass
collection of
larvae &
release back
of
parasitoids
+
Entomopath
ogenic
nematodes
+
Black light
traps
+
Mating
disrupting,
etc
Augmentati
on of Egg
parasitoids
+
Mass
collection of
larvae &
release back
of
parasitoids
+
Entomopat
hogenic
nematodes
Light traps
+
Mating
disrupting,
etc
Augmentat
ion of Egg
parasitoids
+
Mass
collection
of larvae
release
back of
parasitoids
+
Entomopat
hogenic nematodes
Light traps
+
Mating disrupting,
etc
Augmentati
on of Egg
parasitoids
+
Mass
collection of
larvae for
natural enemies &
release of
parasitoids
+
Entomopath
ogenic
nematodes
s
Black light
traps +
Biopesticide
s , etc
Whitefly Jassid
Thrips
Aphids
Conservatio
n of
predators &
parasitoids
+
Cultural
control
+
Other
options
(entomopat
hogenic
nematodes,
biopesticide
s + seed
treatments+
IGRS),
etc)
Conservatio
n of
predators &
parasitoids
+
Cultural
control
+
Other
options
(entomopat
hogenic
nematodes,
biopesticide
s + seed
treatments+
IGRS) ,
etc)
Conservatio
n of
predators
&
parasitoids
+
Cultural
control
+
Other
options
(entomopat
hogenic
nematodes,
biopesticide
s + seed
treatments+
IGRS), etc)
Conserva
tion of
predators
&
parasitoi
ds
+
Cultural
control
+
Other
options
(entomop
athogenic
nematode
s,
biopestici
des + seed
treatment
s+ IGRS),
etc
9
C) Justification
Plant protection in Pakistan is mostly based on pesticides. The failures of the chemical method
for controlling pests are mainly due to adverse effects on natural enemies compounded by
increasing development of resistance by pests to pesticides. Resultantly where farmers had to
spray once to control the pests now they have to spray a crop over 10 times especially on cotton
leaving it not much profitable specially the small farmers who now have started shifting their
priority from cotton to other crops.
Chemical based control program in crops has actually increased pest problems, disturbed the
agro-ecosystem and has affected the non-target and environment friendly organisms such as
parasitoids, predators and birds. Disturbance in an agro-ecosystem led the new pest problems
through resurgence and resistance processes in the naturally occurring pest populations.
Indiscriminate use of pesticides has destroyed the biocontrol agents in agro-ecosystems. The
populations of natural enemies in cotton growing areas have declined up to 90% (Hasnain,
1999). The plant protection policy in Pakistan needs revision and has to be based considering the
basic fact that pests are bio-ecological problems and not the chemical problems and they need to
be dealt with the principles of ecological pest management. World over the trends in crop
protection are shifting from chemical control to ecological pest management whereas Pakistan is
far behind in the correcting its farming systems and production procedures in line with the
international standards set under WTO. We have to comply with the international standards and
reverse all negative trends by 2015 otherwise will face sever set back in trade of farm produce at
national and international level. For achieving this target the present project will play the major
role in setting up a workable system of biological control based IPM which lead Pakistan to
comply with the international standards of Good Agriculture Practices (Euro-Gap & Global-
GAP).
The Project
D. Technical Parameters & Technology Transfer
(i) Project Components S # Components Responsible Institutes
i. Biological control of cotton pests with emphasis on
mealy bug using insect parasitoids and predators
CABI, ARI (TJ,DIK,QT),
CCRI, Multan, AARI (FD) &
CRI, Sakrand
ii. Establish Model farms to demonstrate the biological
control IPM of cotton pests using all techniques and
approaches including Entomopathogenic nematodes
CABI, ARI (TJ), AARI (FD)
& NIAB
iii. Bio-pesticides development, their introduction &
promotion at farm level
NARC
(ii) Institutes involved in implementation of the project
i. MINFAL, Islamabad
ii. CABI South Asia, Rawalpindi
iii. Ayub Agriculture Research Institute, Faisalabad (AARI, FD)
iv. Central Cotton Research Institute, Multan (CCRI)
v. Cotton Research Institute, Sakrand
10
vi. Agriculture Research Institute, Tando Jam (ARI, TJ)
vii. National Agriculture Research Center, Islamabad (NARC)
viii. Agriculture Research Institute, D. I. Khan (ARI, DIK)
ix. Agriculture Research Institute, Quetta (ARI, QT)
x. NIAB, Faisalabad
(iii) Distribution of work and responsibilities for Mealy Bug control
CABI SA, Rawalpindi
a) This center will operate at Rawalpindi, Multan, Las Bela & Tando Jam.
b) Development of IPM of mealy bugs for control on cotton and other economic plants.
c) Identification of the mealy bug complex and their natural enemies associated with cotton
and other plants.
d) Train staff of coordinating units in methodology of sampling, rearing of mealy bugs and
their natural enemies data keeping.
e) Basic research on impact of conservation and augmentation of predators and parasitoids
on controlling the mealy bugs on cotton, weeds and ornamentals at the natural enemies
field reservoirs and farmers fields.
f) Importation of exotic parasitoids and predators.
g) Screening, mass multiplication; release of endemic and exotic natural enemies and asses
their impact on mealy bug populations in collaboration with coordinating units.
h) Maintenance of field reservoir of natural enemies for their mass production and
development of technology for their conservation. For this purpose, five acre plots will be
hired in three cotton growing area (i.e., one each at Multan, Tando Jam & Las Bela )
where preferred host plants of the mealy bug including cotton will be grown over the year
and natural enemies of the mealy bug parasitoids and predators will be continuously
released and conserved. These plots will be left unsprayed. On build up of high
populations of natural enemies they will disperse to adjoining fields and this plot will
serve as a reservoir of the natural enemies of the mealy bug. The population of the mealy
bug and natural enemies will be followed and compared with the farmers managed fields
by coordinating units. This field will also serve as a source of parasitoids for other cotton
pests. The researchers working on cotton pests other than mealy bug can also benefit for
studies and will be a source of obtaining natural enemies for studies and management of
cotton pests. This farm will be sort organic farm. Preferred host plants of mealy bug (egg
plant, rose of China, okra, tomato, cotton, Abutilon, itsit, Amaranthus, din ka raja, wheat,
etc will be grown on farm for studies and technology development of conservation of
natural enemies).
i) Facilitate in holding national and international workshops to share the knowledge gained
in controlling mealy bug on cotton and other plants in different ecological areas of
Pakistan.
j) Collaboration with foreign institutes for collection, screening and supply of natural
enemies in Pakistan.
k) Visit abroad for search of natural enemies of Phenacoccus spp and on site observations of
association of natural enemies with fauna and flora, screening and selection of natural
enemies for introduction in Pakistan.
11
l) Transfer of IPM technology to farmers in collaboration with coordinating extension units
through FFS approach.
m) Molecular studies for confirmation of species identification of Phenacoccus complex .
AARI, Faisalabad
a) This center will operate at Faisalabad, Vehari, Khanewal and other cotton growing areas of
Punjab). b) Study population development of the mealy bugs and their natural enemies on vegetables,
crops and cotton in different seasons of the year.
c) Conduct surveys for endemic natural enemies of the mealy bugs on vegetables, major
crops, weeds, forest and ornamental plants.
d) The knowledge gathered above will be shared with CABI at natural enemy field
reservoirs.
e) Establish insectary at Fiasalabad and supply natural enemies stocks to supporting units at
Vehari, Bahawalpur and Khanewal for mass production and field releases.
f) Asses the impact of biological control based IPM technology for controlling mealy bug
on cotton and other plants.
g) Study safe use of pesticides.
h) Train farmers and extension workers on application of biological control techniques for
controlling mealy bugs on cotton and other plants and promotion of this product on large
scale.
CCRI, Multan
a) This center will operate at Multan, D.G.Khan, Muzaffar Garh and Rajanpur.
b) Study population development of the mealy bug and their natural enemies on malvaceous
plants in different seasons of the year at Multan.
c) Conduct surveys for endemic natural enemies on weeds, malvaceous plants including
cotton.
d) Study phenology and identify weaknesses in the life cycle of the pest and its and natural
enemies at farmers managed farms.
e) The knowledge gathered above will be shared with CABI at natural enemy field
reservoirs.
f) Develop mass rearing techniques and maintain stocks of parasitoids and predators of the
mealy bug at the insectary in collaboration with CABI.
g) Asses the impact of biological control based IPM technology for controlling pest on
weeds and malvaceous plants with special emphasis on cotton.
h) Field and laboratory studies on suitability and preferences of the mealy bug and its
natural enemies for different cotton varieties.
i) Train farmers and extension workers on application of biological control techniques for
controlling mealy bugs on cotton and other plants and promotion of this product on large
scale.
CRI, Sakrand:
a) CRI Sakrand will operate at Nawab Shah, Noshero Feroz, Dadu,, Khair Pur, Sukkur and
Ghotki.
b) To study the pest population dynamics of Mealy bug and their natural enemies on
Malvacious and other plants in different seasons at CCRI Sakrand and other places.
12
c) Survey of weeds, cotton of other similar family plants to record natural enemies of the
pest.
d) To study the phenology and identify the weaknesses in the life cycle of the Mealy bug
and its natural enemies at farmers field.
e) Assess the impact of Biological control based on IPM approach and technology for
controlling pest especially on cotton and other alternate host plants
f) Study safe use of pesticides and role of Biological agents.
g) What so ever have been gathered during the studies will be shared with CABI.
h) Train the farmers, Agriculture extension and NGO’s in biological control techniques for
the control of Mealy bug.
ARI, Tandojam
a) This center will operate at Hyderabad (Tandojam), Tando Mohammad Khan, Badin, Mirpur
Khas and Sanghar of Sindh.
b) Study population development of the mealy bug and their natural enemies on cotton and
other malvaceous plants.
c) Conduct surveys for endemic natural enemies, seasonal abundance on weeds, vegetables,
ornamentals, forests and crops.
d) Study phenology and identify weaknesses in the life cycle of the pest and its natural
enemies.
e) The knowledge gathered above will be shared with CABI at natural enemy field
reservoirs.
f) Asses the impact of biological control based IPM technology for controlling pest on
different crops with special emphasis on cotton.
g) Establish insectary at Tando Jam and supply natural enemies stocks to supporting units at
Sanghar, Sakrand etc, for mass production and field releases.
h) Train farmers and extension workers on application of biological control techniques for
controlling mealy bugs on cotton and other plants and promotion of this product on large
scale.
i) Study safe use of pesticides.
ARI, Quetta
a) This center will operate at Las Bela, Khuzdar and Dera Murad Jamali.
b) Study biology and ecology of the mealy bugs and their natural enemies.
c) Conduct surveys for endemic natural enemies, seasonal abundance on different plants.
d) Study phenology and identify weaknesses in the life cycle of the pest and its natural
enemies.
e) The knowledge gathered above will be shared with CABI at natural enemy field
reservoirs.
f) Establish insectary at Khusdar and supply natural enemies stocks to supporting units for
mass production and field releases.
13
g) Asses the impact of biological based IPM technology for controlling pest on different
crops with special emphasis on cotton.
h) Train farmers and extension workers on application of biological control techniques for
controlling mealy bugs on cotton and other plants and promotion of this product on large
scale.
i) Study safe use of pesticides.
IPM NARC, Islamabad
a) This center will operate through its office at Multan for this project.
b) Conduct studies on repellency of biopesticides to mealy bug and their natural enemies on
cotton and other preferred host plants.
c) Role of use of biopesticides in IPM of the mealy bug sharing knowledge with CABI.
d) Train farmers and extension workers on application of biopesticides for controlling mealy
bugs on cotton and other plants and promotion of this product on large scale.
ARI, D. I. Khan
a) This center will operate at D I Khan and other cotton growing areas of NWFP.
b) Study biology and ecology of the mealy bug and their natural enemies.
c) Conduct surveys for endemic natural enemies, seasonal abundance on different plants.
d) Study phenology and identify weaknesses in the life cycle of the pest and its natural
enemies.
e) Establish insectary at D. I. Khan and supply natural enemies stocks to supporting units
for mass production and field releases.
f) The knowledge gathered above will be shared with CABI at natural enemy field
reservoirs.
g) Asses the impact of biological control based IPM technology for controlling pest on
different crops.
h) Train farmers and extension workers on application of biological control techniques for
controlling mealy bugs on cotton and other plants and promotion of this product on large
scale.
i) Study safe use of pesticides.
NIAB, Faisalabad
a) This centre will operate at Faisalabad cotton growing areas and Model Farm in Punjab.
b) Basic research on the biology and ecology of mealy bug and their natural enemies and
identification of weaknesses in the life cycle of the pest and its natural enemies.
c) Conduct surveys for search of endemic natural enemies of mealy bug on different plants.
d) Incorporation of new parasitoids and predators in already functional laboratories with the
help of CABI SA.
e) Increase in the production of natural enemies at NIAB and their release in the Model
Farm in Punjab in coordination with CABI SA and AARI.
f) Development of new mass rearing techniques and maintenance of stocks of parasitoids
and predators at NIAB in collaboration with CABI SA.
g) Training of staff of cooperating units in methodologies of rearing of beneficial insects
and their releases.
h) Development of IPM practices for control of mealy bug on cotton at NIAB.
i) Find out the soft insecticides for the major parasitoids and predators of agricultural pests.
14
j) Study cross resistance spectra of pesticides for pests and their natural enemies.
k) Devise conservation based IPM strategy.
(iv) Distribution of work and responsibilities for establishing Model Farms for
controlling all major cotton pests
CABI SA, AARI, ARI and NIAB will work together in a model farm of 500 acres area which
will be established for the demonstration of biological control based IPM of major cotton
pests in one union council each of Punjab and Sindh. A MOU will be signed between CABI
SA and AARI and ARI Tando Jam to maintain collaborative activities at these Model Farms.
The space for conduction of scientific and administrative activities for CABI SA staff will be
provided by the coordinating units in Sindh and in Punjab. MINFAL will ensure the
provision of these facilities extended to CABI SA by the coordinating units in Punjab and
Sindh
CABI SA, Rawalpindi (Insect Parasitiods & Predators Section)
a) This center will coordinate with AARI, Faisalabad, NIAB, Faisalabad and ARI, Tando
Jam for management of cotton pests at Model farms.
b) Work out management strategies in consultation with coordinating units and specialists
on different insects, diseases composting and other agronomic practices.
c) Maintain field reservoir of natural enemies, studies and development of conservation
technology of natural enemies for controlling cotton pests.
d) Work with AARI, NIAB and ARI for documentation of crop yields per acre and
population levels of pests and natural enemies at Model Farms.
e) Train and assist in mass production of natural enemies (Trichogramma, Chrysopa,
predatory coccinellids and parasitoids of major cotton pests.
f) Conduct farmer participatory training of researchers, extension, farmers to involve whole
community at model farms for management of major cotton pests.
CABI SA, Rawalpindi (Gene and Pathogens Section) a) Cloning of genes for identification of mealy bugs on cotton and other horticultural crops
b) Checking of possible transmission role of cotton mealy bug for some crop pathogens
(bacteria, viruses or fungi) in cotton crop.
c) Molecular identification of variability/races/subspecies in cotton pests, insect parasitoids
and predators.
d) Identification of insect pathogens (viruses, bacteria and fungi) associated with cotton
pests.
e) Maintain pure cultures of Trichogramma and other local and newly introduced bio-
control agents and strains associated with cotton pests and supply for large production to
coordinating teams at model farms.
15
CABI SA, Rawalpindi (Entomopathogenic Nematodes Section) a) Identification of entomopathogenic nematodes (EPNs) associated with cotton pests in
Pakistan.
b) Pathogenecity of EPNs against different cotton pests.
c) Role of EPNs in controlling cotton pests (mealy bug and others).
d) Develop technology for mass production of EPNs for cotton pests.
e) Conduct field assays on efficacy of EPNs attacking cotton pests.
f) Import exotic useful nematodes strains for trials against cotton pests.
AARI, Faisalabad a) Work together with CABI at Model Farm (Bahawal Pur) and will have a proactive
interactive role with farmers through FFS for management of cotton pests.
b) Mass production of Trichogramma, Chrysopa, predatory coccinellids and parasitoids of
mealy bug and other pests for augmentation studies at Model farm.
c) Engage staff and hire labor on daily wages for mechanical control of some of the pests
and other management practices.
d) Arrange extension staff for training and running of FFS at the model farm.
e) Work with CABI for documentation of crop yields and population levels of pests and
natural enemies.
ARI, Tandojam
a) Work together with CABI at Model Farm (in Sindh) and will have a proactive interactive
role with farmers through FFS for management of cotton pests.
b) Mass production of Trichogramma, Chrysopa, predatory coccinellids and parasitoids of
mealy bug and other pests for studies at model farm.
c) Engage staff and hire labor on daily wages for mechanical control of some of the pests
and other management practices.
d) Arrange extension staff for training and running of FFS at the model farm.
e) Work with CABI for documentation of crop yields and population levels of pests and
natural enemies.
E. Technical inputs i) Biological control based IPM Model farms one each in Punjab and Sindh will be established where only safe use of pesticides
will be considered and all IPM options which maximize biological control of pests will be
16
implemented. At these model farms major pests of cotton will be controlled with
implementation of biological control based IPM technologies. Technologies for mass production
of natural enemies, their augmentation and conservation of major cotton pests will be developed.
Classical biological control for exotic pests will also be attempted. Concept of Farmers field
schools will be introduced at model arms for community involvement to control the pests on
cotton.
ii) Molecular Studies for genetic variabilities in biocontrol agents and pests Mealy bugs infect more than 100 host plants including vegetables, fruits, flowering plants and
forests all over the country. They not only feed on plants but also act as vectors in transmission
of many serious pathogens including viruses, bacteria and fungi. Ground breaking work with in
the last fifteen years identified several species of mealy bugs (Hemiptera: Pseudococcidae) as
vector of viruses (Gugerli 2003). Sixteen species of mealy bugs have also been reported to be
involved in transmission of Cocoa swollen shoot disease (CSSVD). Mealy bug wilt of pine apple
(MWP) is associated with a complex of closteroviruses (Rebolledo Martinez et al., 2005). Pine
apple mealy bug wilt associated virus is transmitted by two mealy bug species (Dysmicoccus
spp.) A previously undescribed badnavirus was found to be a causal agent of a disease of black
pepper (Piper nigrum) in Malaysia, Philippines, Sri Lanka and Thailand transmitted by citrus
mealy bug. The mealy bugs recorded on cotton probably transmit some pathogen or toxin that
result in death of the plant. As there is scanty of data about the Phenacoccus solani as vector for
plant pathogens, there is a need for detailed investigation in this regard.
Egg parasitoids have efficient role in controlling Lepidoptrous pests (African boll
worm(Helicoverpa armigera), army worm (Spodoptra litura), boll worm (Earis insulana,
Pectinophora gossypiella)) on cotton. Trichogramma chilonis and Trichogramma brasiliensis
have been described as potential parastoids for described major pests of cotton crop but
apparently a complex has been is found in field conditions. In Pakistan though Trichogramma
attack these pests but failed to produce any results in controlling these pests though elsewhere
they have been successfully used in controlling cotton pests. This failure is primarily the result of
inaccurate identification of strain/race of Trichogramma chilonis associated with pest on cotton.
Using male genitalic characteristics, around 200 species have been described (Pinto 1998).
Determinations of Trichogramma species based on morphological characters are confusing. A
species identified on the basis of morphology obtained from different hosts have different
biological characters, therefore, there may exist a complex of strains and races. So there is a need
for accurate identification and application of those potential strains of Trichogramma chilonis
and other species of Trichogramma by molecular methods to increase the efficiency of bio-
control program.
Maintain pure cultures of Trichogramma and other local and newly introduced bio-control agents
and strains associated with cotton pests and supply for large production to coordinating teams at
model farms.
iii) Entomopathogenic Nematodes in Biological Control System Besides microbial pathogens and arthropod biocontrol agents of insect pests, Entomopathogenic
Nematodes (EPNs) of the families Steinernematidae and Heterorhabditidae have been
successfully used in agricultural systems. Like parasitoids or predators, EPNs have
chemoreceptors and are motile. Like pathogens, they are highly virulent, killing their hosts
quickly and they can be cultured easily in vivo or in vitro (Ehlers, 2001).
These entomopathogenic nematodes in bio control systems are little explored in Pakistan.
Entomopathogenic nematodes are one of the best biocontrol strategies against cotton pests.
17
As far as chewing insects in cotton are concerned, excellent control through entomopathogenic
nematodes have been achieved in the world. These insects usually live or spend a part of their
life in soil. For example cutworms and a complex of bollworms mostly pupate and hibernate in
soil in winter. Soil is a natural reservoir of entomopathogenic nematodes (Akhurst, 1986;
Gaugler, 1988) offering excellent conditions for nematode survival and activity against soil
inhabiting insects. Field experiments have also shown EPNs as an effective biocontrol agent
against different foliage pests in cotton. For example, cutworms feeding on cotton seedlings and
armyworms have been found highly susceptible to EPNs of the families Steinernema sp., a well
known nematode of root grubs (Hussaini et al., 2000). EPNs of the families Steinernema and
Heterorhabditae, as water suspension have successfully been used against cotton bollworms and
cutworms.
Their application through furrow irrigation can give up to 90% mortality of Pink bollworm
Pactinophora gossypiella (Forlow Jech and Henneberry, 1997). Nematodes caused complete
mortality after 48 hours of application. Heterorhabditis bacteriophora gave 100% mortality of
the Spodoptera littoralis larvae in cotton (Abdel Razek, 2006). Nematode applied in a mixture
of anti desiccant Folicote gave 76 and 46% mortality of Spodoptera litura and Earias insulana
respectively(Glazer et al., 1992). Use of EPNs calcium alginate gel formulation can give 100%
mortality against 2nd and 3rd stage larvae of S. litura and Helocovera armigera (Navon et al.,
2002). Similarly, Heterorhabditis sp. has been found highly virulent against Helicoverpa
armigera, one of the serious pests in cotton.
Occurrence and ease in formulation of entomopathogenic nematodes have made it possible to
use them against different sucking insects in cotton. Different soft bodied insects like mealy
bugs, aphids, thirps and jassids have been reported highly susceptible to EPNs. Heterorhabditis
indica, also known from Pakistan, has successfully been used against 2nd
stage nymphs of mealy
bugs in India. Nymphs are usually found sticking to the stem and the nematodes applied through
simple water suspension gave 92% mortality within 48 hours after application (Sharad et al.,
2004). This is a polyphagous strain and has been used against insects (ten Lepidoptera, five
Coleoptera and one each of Orthoptera and Homoptera) in India (Banu and Rajendran, 2002).
Nematodes of both families Steinernematidae and Heterorhabditidae have been found effective
against soil dwelling stages of flower thrips through foliar application (Ebssa, et al., 2004).
F. Project Outputs
• The insect pests and their natural enemies on cotton in Pakistan will be properly
identified.
• Basic data on pest distribution, hosts and host plants seasonal abundance, and phenology
of the mealy bug complex and other cotton pests. IPM model for dealing with cotton
major pests will also become available. It will provide foundation for developing such
models for other crops pests.
• A mass scale insect rearing infrastructure will be established in shape of five insectaries
at AARI, Faisalabad, ARI, Tandojam, Khuzdar under ARI, Quetta, mini-insectary and
lab at ARI, D. I. Khan and NIAB, Faisalabad.
• Three field reservoirs of natural enemies will become available for mealy bug control and
two for all cotton pests .in Punjab, Sindh and Balochistan.
18
• Technology on conservation of natural enemies adaptable to farmers’ fields in different
ecological areas of Pakistan will become available.
• Package to manage the pests on cotton will become available.
• Trained scientific staff and a large number farmers and extensions in ecological pest
management will become available at national level for implementation of biocontrol of
insect pests at commercial scale country wide
F. Civil Work, Equipment, Machinery and Physical Facilities
A sizeable civil work will be undertaken in the project. Office equipment and vehicles
will be purchased for running office affairs and providing mobility to the project staff. The
summary the civil works, office equipment and vehicles is provided below:
i) Number of vehicles of the project
Component Motorcylces Vehicles
Federal Monitoring & Coordination Unit, Islamabad
1 1
CABI South Asia, Rawalpindi 4 0 Ayub Agriculture Research Institute, Faisalabad 4 2
Agriculture Research Institute, Tandojam 4 1
Agriculture Research Institute, D.I.Khan 2 1
Agriculture Research Institute, Quetta 4 1
National Agriculture Research Center, Islamabad 0 0 Central Cotton Research Institute, Multan 0 1
CRI, Sakrand 0 1
NIAB, Faisalabad 1 Total: 19 9
ii) Details of civil works of the project
Component Number
Ayub Agriculture Research Institute, Faisalabad (16,476 sq ft)
Laboratory and Insectary for mass production of friendly/useful insects
Agriculture Research Institute, Tandojam (16,476 sq ft)
Laboratory and Insectary for mass production of friendly/useful insects
Agriculture Research Institute, D. I. Khan (1,100 sq ft)
Laboratory cum mini Insectary for rearing of friendly/useful insects
Agriculture Research Institute, Quetta (8500 sq ft)
Laboratory and Insectary for mass production of friendly/useful insects
NIAB, Faisalabad (2,000 sq ft)
Laboratory and mini Insectary for rearing of friendly/useful insects
G. Financial Discipline
Attempt will be made to provide funds to provincial agricultural departments through the sub-
offices of AGPR at provincial headquarters. For the purpose, NIS for itemized expenditure for
each institution will be prepared by the Project Director and reflected in the budget book each
19
year. In case that was not possible, the budget will be provided through transfer grant. In that
case, the provincial Agricultural Departments will open bank accounts to operate the budget.
Alternately, the provinces may use any other system for the purpose, duly approved by the
Provincial Governments to handle the provincial accounts. Approved cost of Rs 11.615 million
for NARC component of this PC-I as depicted in Annex IX, Tables 1-4, will be born by PARC
out of RADP.
The PCCC and CABI autonomous organizations and do not operate through AGPR system. It
will not be possible to reflect their itemized cost through NIS against AGPR, Islamabad. The
funds for them will be reflected in the budget of Federal Coordination Unit of MINFAL under
the head transfer grants. These grants will be released to PCCC and CABI through AGPR,
Islamabad. To operate these funds, these organizations will open Bank account or use their
existing system to channelise the funds.
- The funds will be provided as a Federal grant to the participating institutions outlined
in the PC-I. On termination of the project, the assets will stand transferred to the
participating institutions. The MINFAL will not entertain any irregular/unauthorized
expenditure; MINFAL will also not pick any liabilities after closure of the project.
- Ministry of Food, Agriculture and Livestock will conduct annual audits and the
external audit will be carried out by the Federal Audit Department.
- The provision of funds to any component program in this PC-I will be conditional on
good performance. The funds to slow moving or not good performing components
will be restricted/close.
- Provincial Government will follow the procedures laid down in the provincial
purchase manual or standing instructions for effecting purchases.
- PCCC and CABI will follow these rules for affecting purchases.
- CABI SA will recruit its staff as per CABI’s guidelines and procedures
H. Risks
There is no major risk involved in achieving the objectives of the project. However, the project
may face two types of remote and minor risks. (i) Non-cooperation of farmers could be the
possible risk. Farmers are inclined to use chemicals to control insect attack which also kills the
friend insects. Therefore, this issue will be addressed by developing field reservoirs of the natural
enemies of the mealy bug under the project. From where these will be released to farmers fields
to promote biological control which is the only way out for the control of this insect. (ii)
Polyphagous nature of the pest is also a possible risk. This insect can feed on several host plant
therefore, its population continue through out the year and could attack cotton crop. Biological
control offers an opportunity of controlling the bug on other plants during winter and spring
season before the planting of cotton. It also sets basis for intensive survey to be carried out for
natural enemies on all host plants to detect the naturally associated parasitoids and predators who
can be mass produced in insectaries for releases in field and redistributed from one to other
areas. Both of these strategies for combating the menace will be used in this project.
7. Capital cost estimates: 368.722 Rs million
◊ Indicate date of estimation of project cost: January, 2008
◊ Basis of determining the capital cost be provided: Market survey was done and latest
cost estimates were collected and used for working out the cost of project.
20
Capital Cost:
i) Component wise capital costs of the project
Component Rs million
Federal Monitoring & Coordination Unit, Islamabad 2.005 CABI South Asia, Rawalpindi 2.873 Ayub Agriculture Research Institute, Faisalabad 19.240 Agriculture Research Institute, Tando Jam 6.290
Agriculture Research Institute, D.I.Khan 3.750 Agriculture Research Institute, Quetta 4.440 Central Cotton Research Institute, Multan 3.310 Cotton Research Institute, Sakrand 3.19 NIAB, Faisalabad 6.120 Total: 51.218
ii) Item wise project costs
Item Rs (million)
Establishment Charges 122.946
Operational Charges 84.180
Sub-total: 207.126
Cost of durable goods
Purchase of Motorcycles 1.0350
Purchase of Vehicles 12.850
Lab & Office Equipment/machinery 37.333
Sub-total: 51.218
Civil works 89.200
Institutional charges 6.579
Contingency 9.599
Out sourcing 5.000
Total 368.722
iii) Component wise establishment costs of the project
Component Rs million
Federal Monitoring & Coordination Unit, Islamabad 9.959
CABI South Asia, Rawalpindi 33.385
Ayub Agriculture Research Institute, Faisalabad 30.713
Agriculture Research Institute, Tando Jam 14.692
Agriculture Research Institute, D.I.Khan 3.994
Agriculture Research Institute, Quetta 7.349
Central Cotton Research Institute, Multan 7.914
Cotton Research Institute, Sakrand 8.214 NIAB, Faisalabad 6.726
Total: 122.946
21
iv) Component wise operational costs of the project
Component Rs million
Federal Monitoring & Coordination Unit, Islamabad 11.145
CABI South Asia, Rawalpindi 29.540
Ayub Agriculture Research Institute, Faisalabad 8.455
Agriculture Research Institute, Tando Jam 14.790
Agriculture Research Institute, D.I.Khan 3.210
Agriculture Research Institute, Quetta 4.750
Central Cotton Research Institute, Multan 4.410
Cotton Research Institute, Sakrand 4.025
NIAB, Faisalabad 3.855
Total: 84.1800
v) Year wise financial phasing of project cost
Rs (million) Components
Year 1 Year 2 Year 3 Total
Federal Monitoring & Coordination Unit,
Islamabad
13.792 7.194 7.779 28.765
CABI South Asia, Rawalpindi 26.854 22.532 22.991 72.377
Ayub Agriculture Research Institute, Faisalabad 60.475 16.554 17.413 94.442
Agriculture Research Institute, Tando Jam 48.782 11.202 11.490 71.474
Agriculture Research Institute, D. I. Khan 8.391 2.485 2.735 13.611
Agriculture Research Institute, Quetta 26.396 4.159 4.292 34.847
Central Cotton Research Institute, Multan 7.455 4.212 4.352 16.019
Cotton Research Institute, Sakrand 7.167 4.228 4.394 15.789
NIAB, Faisalabad 14.211 3.599 3.588 21.398
Total: 213.523 76.165 79.034 368.722
◊ Provide year-wise estimation of Physical activities as per following:
Summary of the year wise physical activities and targets of the project
CABI SA, Rawalpindi for mealy bug
This unit will play key role in operation of the project in coordination with other units. CABI
will prepare all project technical activities regarding bioecological research and management of
the pest for coordinating units, train staff for survey, conservation, rearing, augmentation,
biology and ecology of pest and natural enemies. CABI will maintain natural enemies field
reservoirs, explore, collaborate with foreign institutes for introduction of natural enemies,
facilitate MINFAL for holding international and national workshops,. Based on research findings
biological control based IPM technology will be developed and tested in cotton at project
maintained farms and farmers fields in collaboration with other coordinating units.
22
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1 Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Development of IPM of mealy bugs for control on cotton and other
economic plants.
Identification of the mealy bug complex and their natural enemies
associated with cotton and other plants
Train staff of coordinating units in methodology of sampling, rearing of
mealy bugs and their natural enemies data keeping.
Foreign exploration of natural enemies Redistribution of natural enemies Screening of exotic natural enemies Evaluation of exotic natural enemies Importation of exotic natural enemies from abroad Augmentation and conservation of natural enemies (exotic and endemic
ones)
Maintenance of Natural enemies field reservoir at farmers field and
conservation of endemic and exotic natural enemies
Impact of IPM package in controlling mealy bug Visit abroad for search of natural enemies of Phenacoccus spp and on site
observations of association of natural enemies with fauna and flora,
screening and selection of natural enemies for introduction in
Collaboration with foreign institutes for collection, screening and supply
of natural enemies in Pakistan.
Establishment of model farms Report writing
CCRI, Multan This center will operate at Multan, D.G. Khan Muzaffar Garh and Rajan Pur, conduct surveys on
natural enemies and study phenology of the pest and natural enemies. The center will also test
the technology of conservation of natural enemies at research farms and farmers fields. The
center will contribute to development and test IPM technology in collaboration with CABI on
cotton and other plants.
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2 Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Study population development of the mealy bug and their natural
enemies on malvaceous plants in different seasons of the year at
Multan.
Conduct surveys for endemic natural enemies on weeds,
malvaceous plants including cotton.
Study phenology and identify weaknesses in the life cycle of the
pest and its and natural enemies at farmers managed farms. The
knowledge gathered above will be shared with CABI at natural
enemy field reservoirs
Develop mass rearing techniques and maintain stocks of
parasitoids and predators of the mealy bug at the insectary in
collaboration with CABI.
Asses the impact of biological control based IPM technology for
controlling pest on weeds and malvaceous plants with special
emphasis on cotton.
Field and laboratory studies on suitability and preferences of the
mealy bug and its natural enemies for different cotton varieties
Train farmers and extension workers on application of biological
control techniques for controlling mealy bugs on cotton and other
plants and promotion of this product on large scale
Report writing
23
CRI, Sakrand
CRI, Sakrand will operate at Nawab ShahNosheroferoz,Dadu,Khairpur,Sukkur,and Ghotki. This
center will also test the technology of conservation of natural enemies at research farms and
fields. The center will contribute to develop and test IPM technology in collaboration with
CABI on cotton and other plants.
Year 1 Year 2 Year 3
Activity Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Study population development of the Mealy bug and
their natural enemies on malvaceous plants in deferent
seasons of the year at Sakrand.
Conduct Surveys for endemic natural enemies on weeds,
malvaceous plants including cotton.
Study phenology and identify weaknesses in the life
cycle of the pest and its natural enemies at farmers
managed farms. The knowledge gathered above will be
shared with CABI at natural enemy field reservoirs.
Develop mass rearing techniques and maintain stocks of
parasitoids and predators of the Mealy bug at the
insectary in collaboration with CABI.
Assess the impact of biological control based IPM
techniques for controlling pest on weeds and malvaceous
plants with special emphasis on cotton.
Field and Laboratory studies on suitability and
preferences of the Mealy bug and its natural enemies for
different cotton varieties.
Train farmers and extension workers on application of
biological control techniques for controlling Mealy bug
on cotton and other plants and promotions of this
product on large scale.
Report writing
AARI, Faisalabad This center will operate at Faisalabad, Sahiwal, Vehari, Khanewal, Bahawalpur, etc, for surveys
of mealy bugs and their natural enemy complex, study phenology of the cotton mealy bug and
natural enemies. They will do studies on safe use of pesticides. The center will also look after
insectary for mass production of natural enemies in collaboration with CABI. The center will
contribute to develop and test IPM technology in collaboration with CABI on cotton and other
plants at research farms. The center will collaborate with extension for implementation of IPM
technology at farmer fields. .
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q2 Q3 Q
4
Q1 Q
2
Q
3
Q
4
Study population development of the mealy bugs and their natural
enemies on vegetables, crops and cotton in different seasons of the year.
Establish insectary at Fiasalabad and supply natural enemies stocks to
supporting units at Vehari, Bahawalpur and Khanewal for mass
production and field releases.
Asses the impact of biological control based IPM technology for
controlling mealy bug on cotton and other plants.
Study safe use of pesticides. Train farmers and extension workers on application of biological control
techniques for controlling mealy bugs on cotton and other plants and
promotion of this product on large scale.
The knowledge gathered above will be shared with CABI at natural
enemy field reservoirs
Report writing
24
ARI, Tandojam This center will operate at Hydrerabad, Mir Pur Khas, Sanghar, Badin Sanghar etc., conduct
surveys on natural enemies and study phenology of the pest and natural enemies. The center will
do studies on safe use of pesticides. The center will also look after the maintenance of insectary
mass production of natural enemies and field releases, develop IPM technology in collaboration
with CABI and do the studies on conservation of natural enemies. The center will collaborate
with extension for implementation of IPM technology at farmer fields.
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Study population development of the mealy bug and their natural enemies
on cotton and other malvaceous plants.
Conduct surveys for endemic natural enemies, seasonal abundance on
weeds, vegetables, ornamentals, forests and crops.
Study phenology and identify weaknesses in the life cycle of the pest and
its natural enemies.
The knowledge gathered above will be shared with CABI at natural
enemy field reservoirs.
Asses the impact of biological control based IPM technology for
controlling pest on different crops with special emphasis on cotton.
Establish insectary at Tando Jam and supply natural enemies stocks to
supporting units at Sanghar, Sakrand etc, for mass production and field
releases.
Train farmers and extension workers on application of biological control
techniques for controlling mealy bugs on cotton and other plants and
promotion of this product on large scale.
Study safe use of pesticides. Report writing
ARI, Quetta This center will operate at Las Bela, Khuzdar, Dera Murad Jamali etc., conduct surveys on
natural enemies and study phenology of the pest and natural enemies. The center will do studies
on safe use of pesticides. The center will also look after the maintenance of insectary mass
production of natural enemies and field releases, develop IPM technology in collaboration with
CABI and do the studies on conservation of natural enemies. The center will also do studies on
safe use of pesticides. The center will collaborate with extension for implementation of IPM
technology at farmer fields.
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Study population development of the mealy bug and their natural
enemies on cotton and other malvaceous plants.
Conduct surveys for endemic natural enemies, seasonal abundance on
weeds, vegetables, ornamentals, forests and crops.
Study phenology and identify weaknesses in the life cycle of the pest
and its natural enemies.
The knowledge gathered above will be shared with CABI at natural
enemy field reservoirs.
Asses the impact of biological control based IPM technology for
controlling pest on different crops with special emphasis on cotton.
Establish insectary at Khuzdar and supply natural enemies stocks to
supporting units at Sanghar, Sakrand etc, for mass production and field
releases.
Train farmers and extension workers on application of biological
control techniques for controlling mealy bugs on cotton and other
plants and promotion of this product on large scale.
Study safe use of pesticides. Report writing
25
ARI, D. I. Khan This unit will operate at Dera Ismael Khan and other cotton growing areas of NWFP, conduct
surveys on natural enemies and study phenology of the pest and natural enemies. This unit will
do studies on safe use of pesticides. The center will also look after the maintenance of natural
enemies field reservoir, insectary and development of IPM technology in collaboration with
CABI and do the studies on conservation of natural enemies.
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Study population development of the mealy bug and their natural
enemies on cotton and other malvaceous plants.
Conduct surveys for endemic natural enemies, seasonal abundance on
weeds, vegetables, ornamentals, forests and crops.
Study phenology and identify weaknesses in the life cycle of the pest
and its natural enemies.
The knowledge gathered above will be shared with CABI at natural
enemy field reservoirs.
Asses the impact of biological control based IPM technology for
controlling pest on different crops with special emphasis on cotton.
Establish Lab and mini insectary at D. I. Khan and supply natural
enemies stocks to supporting units at Sanghar, Sakrand etc, for mass
production and field releases.
Train farmers and extension workers on application of biological
control techniques for controlling mealy bugs on cotton and other plants
and promotion of this product on large scale.
Study safe use of pesticides. Report writing
NARC, Islamabad Activity Year 1 Year 2 Year 3 Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Collection of biologically active plant materials at Multan and Islamabad Conduct studies on repellency of biopesticides to mealy bug and their natural
enemies on cotton and other preferred host plants.
Role of use of biopesticides in IPM of the mealy bug sharing knowledge with
CABI.
Evaluation of promising plant extracts against natural enemies of the mealy
bug at Multan on cotton and other host plants
Train farmers and extension workers on application of biopesticides for
controlling mealy bugs on cotton and other plants and promotion of this
product on large scale
Report writing
For Cotton pests at Model farms
CABI SA for cotton pests at Model Farms (for insect parasitoids & Predators for pests
���� anagement
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 This center will coordinate with AARI, Faisalabad, NIAB, Faisalabad and
ARI, Tando Jam for management of cotton pests at Model farms.
Work out management strategies in consultation with coordinating units and
specialists on different insects, diseases composting and other agronomic
practices.
Maintain field reservoir of natural enemies, studies and development of
conservation technology of natural enemies for controlling cotton pests.
Work with AARI, NIAB and ARI for documentation of crop yields per acre
and population levels of pests and natural enemies at Model Farms.
Train and assist in mass production of natural enemies (Trichogramma,
Chrysopa, predatory coccinellids and parasitoids of major cotton pests.
Report writing
26
CABI SA for gene studies and entomopathogens for cotton pests control
Year 1 year 2 year3
Activity Q 1
Q 2
Q 3
Q 4
Q 1
Q 2
Q 3
Q 4
Q 1
Q 2
Q 3
Q 4
Collection of mealy bug samples
Cloning of genes
Checking role as vector
Identification of variabilities in cotton pests,insect parasitoids and predators
Identification of entomopathogens associated with cotton pests
Maintain pure cultures of Trichogramma starins associated with cotton pests and supply for large production to team at model farms
CABI SA for EPNs section for management of cotton pests
Activity Year 1 year 2 year3
Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4
Survey of the project area for isolation of strains of entomopathogenic nematodes in Pakistan
Investigation of pathogenecity of EPNs against different cotton pests
Determine best EPN use strategy to manage cotton mealy bug
Establishing technology for mass production of EPNs for cotton pests
Conduct field assays on efficacy of EPNs attacking cotton pests
Import exotic useful nematodes strains for trials against cotton pests Training extension officers in EPNs mass rearing and use to assist the implementation of the programme for farmers
CABI SA for cotton pests at Model Farms (Insect parasitoids & Predators for pests management)
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 This center will coordinate with AARI, Faisalabad, NIAB, Faisalabad and ARI,
Tando Jam for management of cotton pests at Model farms.
Work out management strategies in consultation with coordinating units and
specialists on different insects, diseases composting and other agronomic
practices.
Maintain field reservoir of natural enemies, studies and development of
conservation technology of natural enemies for controlling cotton pests.
Work with AARI, NIAB and ARI for documentation of crop yields per acre and
population levels of pests and natural enemies at Model Farms.
Train and assist in mass production of natural enemies (Trichogramma, Chrysopa,
predatory coccinellids and parasitoids of major cotton pests.
Report writing
27
AARI and NIAB in Punjab and ARI Tando Jam in Sindh for cotton pests at Model Farms (Insect
parasitoids & Predators for pests management)
Activity Year 1 Year 2 Year 3
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4
Q
1
Q
2
Q
3
Q
4 Work together with CABI at Model Farm and will maintain a proactive
interactive role with farmers through FFS for management of cotton pests.
Mass production of Trichogramma, Chrysopa, predatory coccinellids and
parasitoids of mealy bug and other pests.
Engage staff and hire labor on daily wages for mechanical control of some
of the pests and other management practices.
Arrange extension staff for training and running of FFS at the model farm. Work with CABI for documentation of crop yields and population levels of
pests and natural enemies.
Report writing
8. Annual operating cost after completion of project
The recurrent cost of operation of the insectaries established under this project will be
picked up by the respective federal/provinces agencies out of their current budget as given
below:
i. AARI Faisalabad
Financial Requirement (Rs million) Particulars
Year 1
Establishment 3.100
Operational 1.700
Total 4.800
ii. ARI Tandojam
Financial Requirement (Rs million) Particulars
Year 1
Establishment 3.100
Operational 1.700
Total 4.800
iii. ARI Quetta/Khuzdar
Financial Requirement (Rs million) Particulars
Year 1
Establishment 1.900
Operational 0.900
Total 2.800
iv. ARI D.I. Khan
Financial Requirement (Rs million) Particulars
Year 1
Establishment 1.200
Operational 0.500
Total 1.700
28
v. CCRI Multan
Financial Requirement (Rs million Particulars
Year 1
Establishment 1.800
Operational 0.600
Total 2.400
vi. CRI Sakrand
Financial Requirement (Rs million) Particulars
Year 1
Establishment 1.200
Operational 0.500
Total 1.700
vii. NIAB Faislabad
Financial Requirement (Rs million) Particulars
Year 1
Establishment 1.600
Operational 0.600
Total 2.200
9. Demand and supply analysis (for Industrial and Agricultural
Production Projects) Description of product/services: N/A
Demand/Supply along with Unit Price for the last five years: N/A
Imports/Exports for the last five years along with unit price N/A
Projected demand/supply for 10 years: N/A
Proposed year-wise production and unit price of the product N/A
Existing and proposed arrangements for marketing: N/A
10. Financial Plan and mode of financing a) Sponsoring own resources: Federal Government (PSDP)
b) Debt: Not Applicable
c) Grants Not Applicable
d) Weighted cost of capital Not Applicable
11. Project benefits and analysis
i. Financial: Not applicable.
ii. Economics: Increase in agriculture productivity by reducing pest losses with effective control
strategies developed and implemented on the basis of the research information
generated in the project will be greatly helpful in enhancing farmer’s produce and
their income. It will assist in establishing cotton industry in the country by providing
29
sufficient quality raw material. The foreign exchange will also increase with the
improvement in cotton production and export of textile products, quantitatively and
qualitatively.
iii. Social benefits with indicators: The effective control strategy developed by the project will enhance the agriculture
productivity by minimizing pest losses. This will ultimately help increase income of
the farmers community and reduce poverty in rural areas.
iv. Employment generation (direct and indirect) Sufficient supply of the raw material to our textile industry, quantitatively and
qualitatively, will improve the standard of the textiles products and enhance price of
the textile products in the market. The increase in the income of the farmers,
manufactures, business community, exporters and the Government will greatly help
establish new textile and related industry and ultimately improve/generate job
opportunities.
v. Environmental impact The Integrated Pest Management (IPM) developed for the effective control of Cotton
Mealy Bug and other cotton pests on the completion of the project, will be greatly
helpful in decreasing pesticides use and their ill-effects on environment and
consequently strengthen renewable resources (population regulating bio-control
agents like parasites, predators of pests), minimize health hazards, etc.
vi. Impact of delay on project cost and validity Delay in project implementation will not only affect the project validity but its costs
may increase due to price escalation. The agriculture productivity is suffering greatly.
The new insect pest is exotic and has invaded almost every agricultural crop,
ornamental, fruit and vegetables. The insect is highly prolific and is spreading fast in
Pakistan and is serious threat to whole agriculture. It is specially devastating to
cotton, the yield is decreasing every year since its invasion in 2005 and farmers
suffered high monetary losses. The insect has to be addressed with holistic approach
every season and every plant has to be considered to manage this insect. There is
urgent need to take immediate actions. Biological control based IPM technology is
the best tool to address this insect. Need is to start studies on its habits relationship
with host plants to identify weaknesses in the life cycle of the pest and to look for
promising natural enemies inland and exotic ones from the area of its native home,
develop conservation techniques for enhancing natural enemies to suppress the pest to
tolerable limits. Delay in action means multiple of losses suffered this year in crops
losses every farm, every season every year. Besides mealy bug other cotton pests
have to be addressed by all available options other than insecticides to minimize the
pesticides use, save environment and build farmers confidence.
vii. Internal Economic Rate of Return:
Project Analysis:
(a) Quantifiable output of the Project:
Quantitative out put of the technologies developed under the project cannot be
qualified. However, the information generated by the project will be utilized by the
farmers for increasing their yield, quantitatively and qualitatively, by averting pest
30
losses. The income of the farmers will not only increase but income of the
Government will also enhance including foreign exchange by exporting quality
textile products. Resultantly, improvement in the cotton production, quantitatively
and qualitatively, will be greatly helpful in establishing textile industry in many
ways including sufficient availability of quality raw material.
a.1 Project investments and returns
All out efforts will be made to bring provincial agriculture extension departments in
loop for the dissemination of biological based IPM interventions on farmers’ fields
for mealy bug control. Applications of these interventions on 40,000 acres each in 5
core cotton growing districts of Punjab and 3 core cotton growing districts of Sindh
is possible with available resources under the project. In this way about 320,000
acres will be directly benefited from project interventions. Benefit cost ratio has
been calculated below based on the assumptions:
(i) Saving on Chemicals About 320,000 acres is the target area of the project for biological control of mealy
bug. At present on average 8 sprays of insecticides are being made over the season
against mealy bug in cotton. This will be reduced to 3 sprays and net saving on
production costs will be gained as per calculations below:
Area directly benefiting by the project interventions = 320,000 acres
Year wise breakup of area
1st year = 1,000 acres
2nd year = 150,000 acres
3rd year = 169,000 acres
Traditional number of average sprays of insecticides = 8
Reduction of sprays through biological control = 5
Cost of 8 sprays @ Rs 600 per spray = Rs 1536.0 million
Cost for 3 sprays = Rs 576.0 million
Gross Saving or benefit = Rs 960.0 million Cost of the project = Rs 368.7 million
Net benefit = Rs 591.3 million
Benefit Cost ratio = 1.60 : 1
(ii) Additional income due to yield increase
Total Area directly benefiting from project = 320,000 acres
Average Increase in Cotton Yield = 2 maunds per acre
Benefit per acre @ Rs 1200 per mnd of phutti = Rs 2,400/ acre
Total benefit in the area = Rs 768.0 million
Benefit cost ratio due to increase in Yield = 2.08 : 1
Net benefit due to both factors: Rs 591 + 768 = 1359.0 million
BC ratio due to savings on chemical cost and yield increase = 3.685 : 1
Note: There will be horizontal effect of the project beyond direct benefited
project area due to knowledge dissemination through extension services,
print media, radio and TV talks.
31
Additional benefits overtime: - Private insectaries will emerge overtime reducing the burden and cost of mass
production of predators on public sector.
- Biological control practices will takeover in plant protection.
- There will be more opportunities for jobs for skilled and unskilled labour at farms and
for plant protectionists engaged in supervised control of pests.
- Promotion of biological based IPM of pests in compliance with international standards
will ensure better price of farms produce in trade.
- Strong natural enemy fauna will result in perpetual control of pests.
- Farmers will have confidence in resource conserving technologies rather than sole
reliance on insecticides for controlling pests. Cotton yield per acre will be optimized.
(b) Unit Cost Analysis: NA
12. Implementation schedule (including starting and completion dates.)
(a) Indicate starting and completion date of the project: Date of commencement: 01-07-2008
Date of completion: 30-06-2011
(b) Item-wise year wise implementation schedule in line charts correlated with the
phasing of physical activities
Please see item No. 7 for this information
32
(c) Result based Monitoring Indicators (RBI) framework indicators in quantitative
Terms:
Out come Input Output
Baseline
indicator
Targets at
completion of
project
Targeted
Impact/measurable
indicators
1.Import of natural enemies
of the cotton mealy bug
The identified natural
enemies associated
with P. solani
imported from
California
Cryptolaemus
montrouzieri has already
been imported from
California in one year
project
Four more natural
enemies introduced
from California
About 300-500
individuals of the
parasitoids
(Acerophagus pallidus,
Coccophagus gurneyi,
Allotropa utilis and
predator Hyperaspis sp)
associated with P.
solani) imported from
California by CABI,
mass produced and
supplied to coordinating
units
2. Mass rearing of imported
natural enemies of mealy
bug
Mass production of
exotic imported
natural enemies at
CABI, AARI Fd, ARI
Tj, CCRI Multan, CRI
Sakrand ARI Q, ARI
DIK, NIAB for release
at farmers fields
Cryptolaemus
montrouzieri imported
from California is already
being mass produced by
CABI, AARI Fd, ARI Tj,
CCRI Multan, NIAB, also
supplied by CABI to UAF
Large numbers of
natural enemies of
the mealy bug will
be available at
different research
centers of the
country .
Above 1000 individuals
of each natural enemy
available all time at each
center. More than
100,000 individuals of
each natural enemy
produced and released
at farmers fields by each
center
3. Establishment of
infrastructure(insectaries)for
mass scale rearing of
natural enemies of cotton
pests
i) Establishment of
large insectaries at:
AARI, Faisalabad,
ARI, Tandojam,
Khuzdar and
ii) small insectaries at
NIAB , Faisalabad,
ARI, D. I. Khan will
be established
At present, mass scale
insect rearing
infrastructure does not
exist.
Mass scale rearing
infrastructure is
built and friendly
insects are mass
produced and
released in cotton
growing areas.
control
3 large insectaries one
each at AARI,
Faisalabad 16476 sq ft),
ARI, Tandojam
(16476)and Khuzdar
(8500)
2 small insectaries one
each at NIAB ,
Faisalabad (2000) and
ARI, D. I. Khan (1100)
4. Mass scale release of
natural enemies of mealy
bug and other cotton pests
in insectaries
The local and exotic
natural enemies of the
mealy bug and other
cotton pests produced
at mass scale and
released at farmers
fields
No regular parasites occur
on mealy bug in Pakistan.
Trichogramma chilonis
and Chrysoperla carnea
are being mass produced at
some places in private and
public sector.
With establishment
of exotic natural
enemies and
increased
population of
endemic natural
enemies
populations of pests
will reduce. .
More than 100,000
individuals monthly
production of the 5
natural enemies and
released at the farmers
fields (May-Nov ) in 2nd
and 3rd year at AARI,
ARI Tj, ARI Q with
technical support from
CABI
5.Training of the project
staff of coordinating units
for mass scale rearing of
natural enemies
Project staff of
coordinating units
trained on rearing of
natural enemies
Very less trained personnel
are in the country on mass
rearing of the natural
enemies of the pests.
More than 100
skilled persons l on
rearing of natural
enemies in public
sector will be
available in the
country
18 trainings for 35
scientists and more than
100 staff/persons of
coordinating units will
be given time to time on
mass rearing of exotic
and endemic parasitoids
and predators by CABI
6.Maintain natural enemy
field reservoirs for their
Five (5) acres plots
one each at Multan,
Data on abundance of
naturally existing predators
Improved
technology on mass
Production of more than
100000 predators at
33
mass production and
conservation
Tandojam and Lasbela
will be maintained
on mealy bug production of
predators and
conservation
monthly intervals
(May.—Dec).
Expectation of
production is in millions
on improvement of
technology. Data
available for monthly
production and release
of predators from the
three field reservoirs by
CABI.
7. Application of
Entomopathogens in cotton
at model farms
1.Entomopathogens
associated with cotton
pests will get
identified
2.Technologies for
mass production EPNs
and their application
will be available
This is a new work not
done before in Pakistan in
cotton
Continue this work
from other sources
of funding for
integration of this
technology with
other control
measures in cotton
3 species of
entomopathogenic
nematodes will be
applied for control of
four major cotton pests.
Isolation and mass
culturing of 5 insect
pathogens and applied
for insect control at
model farms.
Isolation, maintenance
and application of 10
promising parasitoids in
cotton environment for
use in control of cotton
pests.
Data on crop yield, pest
status and reduction in
pesticides use compared
with farmers managed
fields
8. Establish two model
farms for large scale
demonstration of biological
control based IPM
Two model farms of
about 500 acres one
each established at
Bahawalpur and in
Sindh
No such model farms exist
in the country for cotton up
till now on biological
control of cotton pests
Rapid
popularization of
the biological based
IPM technology in
cotton
Data on biocontrol
techniques applied for
control of cotton pests.
pests status at model
farm compared with
farmers managed farms
Enhanced confidence of
farmers and policy
makers on resource
conserving technologies.
Perpetual control of
cotton pests
9. Establish farmer field
school (FFS) for farmers,
training and community
involvement in biological
control based IPM of pests
Framers will be
trained for application
of the pest
management
technology.
Farmers have very little
information and
knowledge about the
season long activities of
biological control based
IPM technology
Agri. Extension
Department will be
in the loop to
further spread the
technology
a). 10 FFS (5 each at
Bahwalpur and Sindh)
established at model
farms
b). 300 farmers and
extension staff will be
trained on season long
activity in FFS
c) 10 Resource persons
engaged, lectures
delivered in sessions
held
50 FFS already
operating in national
program in the districts
of the model farm will
also be involved
10. Training of Agriculture
Officers Extension
Trained Agriculture
Officers of extension
department
AOs little information and
knowledge about the
season long activities of
biological control based
Agri. Extension
Department will be
in the loop to
further spread the
50-60 AOs will be
trained over the year at
Bahawalpur and
Sanghar by AARI, ARI
34
IPM technology technology Tj, ARI Quetta, ARI
DIK,
11. Training of farmers by
field days seminars, farmers
gathering and farmers in
already running FFS at
Bahawalpur and at Sanghar
on biological based IPM
techniques
Some 1300- 1550
farmers per year
trained on applying
IPM techniques by the
components: CCRI
Multan. CRI Sakrand,
NARC Multan , ARI
DIKhan, ARI Quetta.
Tj
Farmers have very little
information on biological
control based IPM
technology for controlling
Agri. Extension
Department will be
in the loop to
further spread the
technology
Farmers per year trained
on applying IPM
techniques. Some 200-
300 each by the
components: CCRI
Multan. CRI Sakrand,
NARC Multan , ARI
DIKhan, and ARI
Quetta
More than 1300 farmers
per year will be trained
by AARI, NIAB and
ARI Tj
12. Study phenology and
population dynamics of
cotton pests
The weakest links
ascertained in the life
cycles of cotton pest
Data on population trends
and insects behavior in
different seasons.
Better understanding
of the pests and
natural enemies
Changes introduced in
agricultural practices.
Increase in population of
natural enemies on
farmers fields (by all
coordinating units ).
These will be base on
findings
13. Conservation of natural
enemies by judicious use of
pesticides for control of
cotton pests
Reduction of
pesticides use in
cotton
Data on toxicity of
different insecticides to
pests and natural enemies
Knowledge on safe
use of insecticides
Data on effectiveness of
application of at defined
timing and special
methodology on use of
soft insecticides on need
basis only.
Availability of extension
materials with the
recommendations of use
of safe pesticides (all
centers except CABI for
this study )
14. Study the bio-
pesticides for control of
mealy bug
9. Study the bio-
pesticides for
control of mealy
bug
Work has already been
started in first phase of the
project
The mass
production of new
products will be
ensured through
involving private
sector
This is NARC specific
activity.
5 formulations of the
biopesticides will be
tested
NARC will maintain
cultures of natural
enemies for testing of
biopesticides
Data on compatibility of
neem sprays on cotton
with use natural enemies
in cotton.
9 trainings given to
staff of coordinating
units on application of
the biopesticides.
15. Reports:
(quarterly and annual
reports produced
12 quarterly and 3
annual reports
produced of the
project
project activities,
experiments results
Comprehensive
information on
possibilities of
control of cotton
pests
Numbers of reports
produced
35
13. Management structure and manpower requirements including specialized skills
during construction, execution and operational phases
The present proposed project is continuation of the already on going 15 months project
titled “Control of cotton mealy bug in Pakistan”. The expanded project will be
implemented under the administrative and financial rules/instructions of the Government
of the Pakistan under the administrative control of Ministry Food, Agriculture and
Livestock. An independent Project Director will head the project and would organize
annual planning meetings, review meetings, annual reports from the respective units will
be submitted to PD who will produce the final report annually and terminal report at the
termination of the project. The Project Manager/Incharge of different units will be Insect
Bio-control Specialist (IBS) at CABI SA Rawalpindi; Provincial Project Director
Entomology at AARI, Faisalabad; Entomologist at ARI, Tandojam; Director Agriculture
Research at ARI, Quetta; Deputy Director General at NARC; Senior Scientific Officer at
CCRI, Multan; Director at CRI Sakrand, Deputy Chief Scientists at NIAB, Faisalabad;
Entomolgist/Director at ARI, D I Khan.
Manpower requirements during execution and operation of the project: The project would require scientists, skilled and semi-skilled personnel for laboratories,
skilled field technician for greenhouses, field reservoirs and insect rearing facilities. The
provincial institutes will create the project posts in their system which will be paid
through this project during project life and later on will be sustained by provincial current
budget after completion of the project. The project staff will be hired from open market
or through transfer posting, hiring on deputation, contract basis or as daily paid
labour/contingent paid staff as and when needed. Manpower required for the project is
given below:
i) Number of staff of project, “Biological Control Of Major Cotton Pests”
Component No of Scientists
No of supporting staff
Federal Monitoring & Coordination Unit, Islamabad
3 5
CABI South Asia, Rawalpindi 11 12 Ayub Agriculture Research Institute, Faisalabad
11 28
Agriculture Research Institute, Tando Jam 8 1 Agriculture Research Institute, D.I.Khan 2 1 Agriculture Research Institute, Quetta 4 1 Central Cotton Research Institute, Multan 4 3 CRI, Sakrand 3 3 NIAB, Faisalabad 6 2 Total: 52 56
36
Project Organization Administrative
Administrative and Institutional Arrangements for implementation of Project:
i. Monitoring and Coordination The project would have monitoring system at federal and provincial levels. At
federal and provincial levels, National Steering Committees will be constituted. These
committees will have an advisory role and would deal with high-level policy matters and
review annual action plans. These will meet twice during each project year to discuss
issues, monitor progress and review the latest action plan and achievements for overall
monitoring of the project and providing policy guidelines. The P&D Division has its own
system of monitoring which will also be in effect simultaneously during the execution of
the project. However, overall monitoring and guidelines for running of the project will be
supervised by the Agriculture Development Commissioner of the MINFAL.
a) National Steering Committee (NSC): The committee will be headed by the
Secretary, Ministry of Food, Agriculture and Livestock (MINFAL). Other
members of the committee will be from finance and planning of the Federal
Government and the provincial secretaries for agriculture and any other related
department. It will oversee the progress of project and provide policy guidance
and resolve policy and financial issues recurring from the field situation and also
will be authorized to do restructuring of the project objectives, scope, re-
allocation of funds within project components at its own level/end without being
referred to P&D Division and the project approving authority. It will also oversee
the formulation of next phase of the project for further replication of productivity
model/project on a wide range of areas in the country. They constitution of the
committee will be as follows:
• Secretary, MINFAL (Chairman)
• Secretary, Finance
• Secretary, P & D
• Chairman, PARC
Project Director
CABI
SA
NARC AARI ARI
TJ
CCRI
& CRI
ARI
Quetta
NIAB
ARI
D.I.K
37
• Cotton Commissioner, MINFAL
• Secretary Agriculture, Punjab
• Secretary Agriculture, Sindh
• Secretary Agriculture, NWFP
• Secretary Agriculture, Balochistan
• Director, CABI SA
• Director NIAB
• Director CRI
• Project Director/Member Secretary
b) Provincial Implementation Committee (PIC): The Provincial Implementation Committee
will be headed by the respective Secretary (Agriculture). The D. Gs. Research and Extension,
concerned provincial project incharge will be its members. This Committee at provincial level,
will resolve policy and financial issues related to the project implementation, performance and
progress in close collaboration with the Federal Coordination Unit (FCU)
14. Additional projects/decisions required to maximize socio-economic benefits from the
proposed project
--
38
39
Annexure I I. Entomology Section, Ayub Agricultural Research Centre, Faisalabad
Table 1. Budget Summary of AARI, Faisalabad
Table 2. Pay of Staff at AARI, Faisalabad (Cotton Mealy Bug) Particulars Rs (million)
PAY OF OFFICERS
Pay Scale equivalent
No. of posts 2008-09 2009-10 2010-11 Total
Provincial Project Director @ Rs 75,000 pm 19 1 0.9 0.945 0.992 2.837
Asstt. Entomologist @ Rs.45,000/-p.m 17+150 2 1.080 1.134 1.190 3.404
Asstt. Res. Officer (Ento.) @ Rs. 30,000/-p.m 17 4 1.440 1.512 1.587 4.539
Contingent paid staff - - 0.500 0.500 0.500 1.500
Sub-Total: 7 3.92 4.091 4.269 12.28
PAY OF OTHER STAFF
Office Assistant @ Rs 15,000/pm 14 1 0.180 0.189 0.198 0.567 Laboratory Assistant @ Rs 10,000/pm 06 4 0.480 0.504 0.529 1.513
Driver on contract @ Rs 10,000/pm 05 1 0.120 0.126 0.132 0.378 Laboratory Attendant @ Rs 6,000/pm 01 4 0.288 0.302 0.317 0.907
Field-man @ Rs 6,000/pm 01 1 0.072 0.075 0.078 0.225
Chowkidar @ Rs 6,000/pm 01 1 0.072 0.075 0.078 0.225 Sweeper @ Rs 6,000/pm 01 1 0.072 0.075 0.078 0.225 Sub-Total of support staff: 13 1.284 1.346 1.41 4.040 Total of establishment for AARI, FD: 20 5.204 5.437 5.679 16.320
Note: All above staff will be hired on contract basis at the given Lump Sum Salary
Table 3. Pay of Staff at Model Farm, Bahawalpur Particulars Rs (million)
PAY OF OFFICERS
Pay Scale equivalent
No. of posts 2008-09 2009-10 2010-11 Total
Asstt. Entomologist @ Rs.45,000/-p.m 17+150 1 0.540 0.567 0.595 1.702
Asstt. Res. Officer (Ento.) @ Rs. 30,000/-p.m 17 3 1.080 1.134 1.190 3.404
Honorarium - - 0.050 0.050 0.050 0.150
Contingent paid staff - - 0.500 0.500 0.500 1.500
Sub-Total: 4 2.170 2.251 2.335 6.756
PAY OF OTHER STAFF
Senior Clerk @ Rs 15,000 pm 09 1 0.180 0.189 0.198 0.567
Field Assistants @ Rs 15,000 pm 06 4 0.720 0.756 0.793 2.269 Laboratory Assistant @ Rs 10,000/pm 06 4 0.480 0.504 0.529 1.513
Driver on contract @ Rs 7,000/pm 05 1 0.084 0.088 0.092 0.264
Field-man @ Rs 6,000/pm 01 5 0.360 0.378 0.396 1.134 Sub-Total of support staff: 15 1.824 1.915 2.008 5.747
Total of establishment for Model Farm, Bahawalpur: 19 3.994 4.166 4.343 12.503 Note: All above staff will be hired on contract basis at the given Lump Sum Salary
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for AARI, Faisalabad 5.204 5.437 5.679 16.320
Establishment cost of Model Farm, Bahawalpur 3.994 4.166 4.343 12.503 Sub-total: 9.424 10.212 11.077 30.713
Durable goods 13.040 3.200 3.000 19.240 Civil Works at AARI, FD 33.000 0.000 0.000 33.000 Sub-total of Capital & Civil Works: 46.04 3.200 3.000 52.240 Operating Expenses at AARI, Faisalabad 1.535 1.575 1.430 4.540
Operating Expenses at Model Farm, Bahawalpur 1.045 1.265 1.605 3.915 Sub-total of operating cost: 2.580 2.840 3.035 8.455
Total: 58.044 16.252 17.112 91.408
Contingency /unforeseen/escalating cost @ 5% 2.431 0.302 0.301 3.034
Grand total: 60.475 16.554 17.413 94.442
40
Table 4. Capital cost estimates, AARI, Faisalabad Particulars Rs (million)
Vehicles & Motorcycles Qty 2008-09 2009-10 2010-11 Total
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0.000 0.000 1.500
Motor Cycles (70 CC) 2 0.110 0.000 0.000 0.110 Sub-Total: - 1.61 0.000 0-000 1.61
Machinery & Equipment
Refrigerators (12/14 cubic feet each) 8 0.200 0.000 0.000 0.200
Split Type A/C (2 tonnes) 20 0.900 0.000 0.000 0.900
Dissecting Microscopes 2 0.300 0.000 0.000 0.300
Pocket Weather Monitor 6 0.300 0.000 0.000 0.300
Humidifier with accessories 5 0.750 0.000 0.000 0.750
Computers with accessories 6 0.420 0.000 0.000 0.420
Lap Tops with accessories 1 0.095 0.000 0.000 0.095
Multimedia Projector with Screen 1 0.200 0.000 0.000 0.200
Phase Contrast Microscope with Photomicrography Unit 1 0.500 0.000 0.000 0.500
Oil Heaters 20 0.200 0.000 0.000 0.200
Incubators 4 1.000 0.000 0.000 1.000
Colour Laser Printer 1 0.080 0.000 0.000 0.080
Fume Hood 1 0.650 0.000 0.000 0.650
Stereo Microscope with Digital Camera 1 0.350 0.000 0.000 0.350
Power Generator 40KV with accessories 1 1.200 0.000 0.000 1.200 Sub-total: - 7.145 0.000 0.000 7.145
Purchase Of Furniture & Fixture (office and lab) Various 0.700 0.100 0.000 0.800 Sub-total: - 0.700 0.100 0.000 0.800
Durable Goods Total at AARI, FD: 9.455 0.100 0.000 9.555
Building & Structure (Civil Works)
Laboratory & Insectary building with complete necessary equipment, fittings, furniture at AARI, Faisalabad (16,476 sq ft)
- 33.000 0.000 0.000 33.000
Sub-total for civil works: - 33.000 0.000 0.000 33.000
Durable Goods & Civil Works Total: - 42.455 0.100 0.000 42.555
Table 5. Capital cost estimates, Model Farm, Bahawalpur Particulars Rs (million)
Vehicles & Motorcycles Qty 2008-09 2009-10 2010-11 Total
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0.000 0.000 1.500
Motor Cycles (70 CC) 2 0.110 0.000 0.000 0.110 Sub-Total: - 1.61 0.000 0.000 1.61
Machinery & Equipment
Refrigerators (12/14 cubic feet each) 4 0.100 0.000 0.000 0.100
Split Type A/C (2 tonnes ) with accessories 2 0.090 0.000 0.000 0.090
Dissecting Microscopes 2 0.300 0.000 0.000 0.300
Lap Top 1 0.095 0.000 0.000 0.095
Multimedia Projector with Screen 1 0.200 0.000 0.000 0.200
Computers with Accessories 1 0.070 0.000 0.000 0.070
Oil Heaters 2 0.010 0.000 0.000 0.010
Power Sprayers 1 0.050 0.000 0.000 0.050
Hand Sprayers 2 0.010 0.000 0.000 0.010
Stereo Microscope 1 0.350 0.000 0.000 0.350
Power Generator 20KV with accessories 1 0.600 0.000 0.000 0.600 Sub-total: - 1.875 0.000 0.000 1.875
Purchase of Furniture & Fixture Various 0.100 0.100 0.000 0.200
Farmer’s incentive - 0.0 3.000 3.000 6.000 Sub-total: - 0.100 3.100 3.000 6.200
Durable Goods for Model Farm, Bahawalpur: 3.585 3.100 3.000 9.685
41
Table 6. Operating expenses of AARI, Faisalabad
Rs (Million) Particulars
2008-09 2009-10 2010-11 Total
Communications
Postage & Telegraph 0.005 0.005 0.005 0.015
Telephone Trunk Calls 0.020 0.020 0.020 0.060 Sub-total: 0.025 0.025 0.025 0.075
Utilities
Electricity 0.095 0.095 0.095 0.285
Hot and cold weather charges 0.005 0.005 0.005 0.015 Sub-total: 0.100 0.100 0.100 0.300
Occupancy cost
Rent & Taxes 0.020 0.010 0.010 0.040 Sub-total: 0.020 0.010 0.010 0.040
Travel & Transportation
Traveling Allowance 0.300 0.300 0.300 0.900
P.O.L. Charges 0.400 0.400 0.400 1.200 Sub-total: 0.700 0.700 0.700 2.100
General
Stationery 0.100 0.100 0.100 0.300
Newspaper Periodicals & Book 0.150 0.150 0.000 0.300
Advertisement & Publicity 0.025 0.025 0.025 0.075
Cost of Other Stores 0.300 0.300 0.300 0.900
Others 0.050 0.050 0.050 0.150 Sub-total: 0.625 0.625 0.475 1.725
Entertainment & gifts
Entertainment & Gifts 0.005 0.015 0.020 0.040 Sub-total: 0.005 0.015 0.020 0.040
TOTAL OPERATING EXP:- 1.475 1.475 1.330 4.280
Repairs & maintenance of durable goods
Transport 0.030 0.050 0.050 0.130
Machinery & Equipment 0.015 0.030 0.030 0.075
Furniture & Fixture 0.015 0.020 0.020 0.055 Sub-total: 0.060 0.100 0.100 0.260
Total: 1.535 1.575 1.430 4.540
42
Table 7. Operating expenses of Model Farm, Bahawalpur Rs (million)
Particulars 2008-09 2009-10 2010-11 Total
Communications
Postage & Telegraph 0.005 0.015 0.015 0.035
Telephone Trunk Calls 0.040 0.050 0.050 0.140 Sub-total: 0.045 0.065 0.065 0.175
Utilities
Electricity 0.100 0.125 0.150 0.375
Hot and cold weather charges 0.005 0.005 0.005 0.015 Sub-total: 0.105 0.130 0.155 0.390
Occupancy Cost
Rent & Taxes 0.050 0.020 0.025 0.095 Sub-total: 0.050 0.020 0.025 0.095
Travel & Transportation
Traveling Allowance 0.200 0.250 0.300 0.750
P.O.L. Charges (Vehicle + Motor Cycles) 0.200 0.300 0.400 0.900 Sub-total: 0.400 0.550 0.700 1.650
General
Stationery 0.100 0.120 0.150 0.370
Newspaper Periodicals & Book 0.100 0.050 0.050 0.200
Advertisement & Publicity 0.050 0.050 0.100 0.200
Others 0.150 0.150 0.175 0.475 Sub-total: 0.400 0.370 0.475 1.245
Entertainment & Gifts
Entertainment & Gifts 0.010 0.025 0.030 0.065 Sub-total: 0.010 0.025 0.030 0.065
Repairs & Maintenance of Durable Good:
Transport 0.020 0.050 0.100 0.170
Machinery & Equipment 0.010 0.050 0.050 0.110
Furniture & Fixture 0.005 0.005 0.005 0.015 Sub-total: 0.035 0.105 0.155 0.295
Total: 1.045 1.265 1.605 3.915
43
Annexure-II II. CABI SA, Rawalpindi (mealy bug section) Table 1. Budget Summary of CABI SA, Rawalpindi
Table 2. Pay of Staff at CABI, Rawalpindi (Cotton Mealy Bug) Particulars Rs (million)
PAY OF OFFICERS
No. of posts 2008-09 2009-10 2010-11 Total
Insect Biocontrol Specialist @ Rs 140,000 pm 1 1.680 1.764 1.852 5.296
Project Officer @ Lump sum Rs 45,000 pm 4 2.160 2.268 2.381 6.809
Sub-Total: 5 3.840 4.032 4.233 12.105
PAY OF OTHER STAFF
Technical Assistant @ Rs 15,000 pm 6 1.080 1.188 1.306 3.574
Senior Clerk @ Rs 15,000 pm 1 0.180 0.198 0.218 0.596
Accountant @ Rs 15,000 pm 1 0.180 0.198 0.218 0.596
Contingent paid skilled and unskilled labour - 0.300 0.300 0.300 0.900 Sub-total of support staff: 8 1.740 1.884 2.042 5.666
Total of establishment for CABI, Rwp 13 5.580 5.916 6.275 17.771
Table 3. Pay of Staff at Model Farms in Punjab & Sindh Particulars Rs (million)
PAY OF OFFICERS
No. of posts 2008-09 2009-10 2010-11 Total
Entomologist @ lump sum Rs 45,000 pm 2 1.080 1.134 1.190 3.404
Expert Field Facilitator @ lump sum Rs 45,000 pm 2 1.080 1.134 1.190 3.404
Entomopathogens scientist @ Rs 50,000 pm 1 0.600 0.630 0.661 1.891
Molecular scientist @ lump sum Rs 50,000 pm 1 0.600 0.630 0.661 1.891 Sub-total for officers: 6 3.360 3.528 3.702 10.59
PAY OF OTHER STAFF
Technical Assistant @ Rs 15,000 pm 4 0.720 0.756 0.793 2.269
Contingent skilled and unskilled labour - 0.500 0.500 0.500 1.500 Sub-total for support staff 4 1.220 1.256 1.293 3.769 Total of establishment for farms: 10 4.580 4.784 4.995 14.359
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for CABI SA, Rawalpindi 5.580 5.916 6.275 17.771
Establishment cost of Model Farms in Punjab & Sindh 4.700 5.120 5.579 15.399 Sub-total: 10.160 11.104 12.121 33.385
Durable Goods Total for CABI SA, Rawalpindi 2.873 0.000 0.000 2.873 Sub-total of Capital 2.873 0.000 0.000 2.873 Operating Expenses at CABI, Rawalpindi 6.880 4.680 4.180 15.740 Operating Expenses at Model Farms in Punjab & Sindh 4.500 4.700 4.600 13.800 Sub-total of operating cost: 11.380 9.380 8.780 29.540 Total: 24.413 20.484 20.901 65.798
Institutional charges 10% 2.441 2.048 2.090 6.579
Grand total: 26.854 22.532 22.991 72.377
44
Table 4. Capital cost estimates of CABI for two model farms in Punjab & Sindh
Rs (million) Particulars Qty
2008-09 2009-10 2010-11 Total
Vehicles/Motorcycles
Motorcycle (70 CC) Honda 4 0.210 0.000 0.000 0.210 Sub-total: 0.210 0.000 0.000 0.210
Machinery & Equipment
Refrigerator 1 with accessories (12/14 cu.ft) 1 0.040 0.000 0.000 0.040
Split AC 1 with accessories (2 tonnes) 2 0.090 0.000 0.000 0.090
Dissecting microscope 1 1 0.150 0.000 0.000 0.150
Lap top with colored laser printer 1 0.140 0.000 0.000 0.140
Digital camera (with close up lens) 1 0.050 0.000 0.000 0.050
Computer with printer 2 0.150 0.000 0.000 0.150 Sub-total: - 0.620 0.000 0.000 0.620
For Entomopathogenic nematodes
Granulator 1 0.010 0.000 0.000 0.010
Lab vacuum pump with multiple funnels 1 0.028 0.000 0.000 0.028
Incubators ( 70 to 100 lit) 3 0.200 0.000 0.000 0.200
Sprayer 2 2 0.010 0.000 0.000 0.010
Electric balance ( measuring up to 30kg) 1 0.020 0.000 0.000 0.020 Purification, mass production of biocontrol agents (insects and pathogens)
Table top centrifuge 1 0.400 0.000 0.000 0.400
Gel documentation system 1 0.400 0.000 0.000 0.400
Water distillation apparatus and deionizer 1 0.150 0.000 0.000 0.150
Digital autoclave 1 0.400 0.000 0.000 0.400
Thermo mixer compact 1 0.125 0.000 0.000 0.125 Sub total - 1.743 1.743
Furniture & Fixture (office cum lab furniture) Various 0.150 0.000 0.000 0.150
Racks & Cages Various 0.150 0.000 0.000 0.150 Sub-total: - 0.300 0.000 0.000 0.300
Total D/Goods for CABI, Rawalpindi: - 2.873 0.000 0.000 2.873
45
Table 5. Operating expenses of CABI SA, Rawalpindi
Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Operating expenses
Travel and perdiem (TA/DA) 0.500 0.500 0.500 1.500
Vehicle mobility charges 0.400 0.400 0.400 1.200
Car hiring/fares 0.300 0.300 0.300 0.900
POL for motorcycles 0.200 0.200 0.200 0.600
Communication charges 0.050 0.050 0.050 0.150 Utilities 0.100 0.100 0.100 0.300 Sub-total 1.550 1.550 1.550 4.650
Other expenses
Supplies and materials 0.300 0.300 0.300 0.900
Stationery 0.100 0.100 0.100 0.300
Advertisement publication 0.050 0.050 0.050 0.150
Technical, reprints, journals & other printed matter 0.050 0.050 0.050 0.150
Operation expenses of three natural enemy (NE) field reservoirs (3) at farmer’s field
s
2.000 2.000 2.000 6.000
Insect Identification charges 0.050 0 0 0.050
Entertainment 0.030 0.030 0.030 0.090 Importation of known predators and parasitoids 0.100 0 0 0.100 Collaboration with foreign institutes for survey and host specificity studies and importation of parasitoids of P. solani
2.000 0 0 2.000
Travel abroad by IBS for appraisal of parasitoids of cotton mealy bug from California and other countries
0.500 0.500 0 1.000
Sub-total 5.18 3.03 2.53 10.74
Repair and maintenance
Transport , machinery and furniture 0.050 0.050 0.050 0.150 Sub-total 0.050 0.050 0.050 0.150
Books 0.050 0 0 0.050 Sub-total: 0.050 0 0 0.050
Unforeseen expense
Miscellaneous (Customs, duties taxes etc) 0.050 0.050 0.050 0.150 Sub-total 0.050 0.050 0.050 0.150
Total 6.880 4.680 4.180 15.74
B = Costs of the three field insect reservoirs, includes their maintenance, land rent, cultivation, watching, Mali, sanitation, irrigation, fertilizers, insecticides, DPL, roof provision on farm, transportation, parasites predators production, their distribution and release at farmers fields and experimentation expenses.
46
Table 6. Operational expenses two model farms in Punjab and Sindh
Item Rs (million)
Operating expenses 2008-09 2009-10 2010-11 Total
Travel and subsistence 0.300 0.300 0.300 0.900
Vehicle mobility charges 0.300 0.300 0.300 0.900
Car hiring/fares 0.400 0.400 0.400 1.200
POL for motor cycles 0.200 0.200 0.200 0.600
Communication s 0.050 0.050 0.050 0.150 Sub-total: 1.250 1.250 1.250 3.750
Lab supplies
Supplies and materials for insets rearing, etc 0.300 0.300 0.300 0.900
Supplies for molecular studies 0.500 0.700 0.700 1.900
Chemicals & glass wares (Bio-pesticides, neem extracts, lures etc) for Entomopathogen studies
0.300 0.300 0.300 0.900
Sub-total: 1.100 1.300 1.300 3.700
Other Supplies
Stationery 0.100 0.100 0.100 0.300
Advertisement publication, printing 0.200 0.200 0.200 0.600
Technical, reprints, journals, other printed matter 0.050 0.050 0.050 0.150
Operation cost for two field reservoir at farmer field
B
1.000 1.000 1.000 3.000
Insect Identification charges by British Museum 0.200 0.200 0.100 0.500
FFS (5) all expenses 0.500 0.500 0.500 1.500 Sub-total: 2.050 2.050 1.950 6.050
Unforeseen expense
Miscellaneous (Customs, duties taxes etc) 0.050 0.050 0.050 0.150 Sub-total: 0.050 0.050 0.050 0.150
Repair and maintenance
Transport , machinery and furniture 0.050 0.050 0.050 0.150 Sub-total: 0.050 0.050 0.050 0.150
Grand total: 4.500 4.700 4.600 13.8
B = Operational charges includes all maintenance costs, land rent, cultivation, watching, Mali, sanitation, irrigation, fertilizers, insecticides, DPL, roof provision on farm, transportation, parasites predators production ,their distribution and release at farmers fields, etc), and experimentations expense
47
Annexure-III III. Central Cotton Research Institute, Multan
Table 1. Budget Summary of CCRI, Multan
Table 2. Pay of Staff at CCRI, Multan Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Honorarium (Project incharge SSO) 0.120 0.120 0.120 0.360
Senior Scientific Officer (MB Management Expert) @ Rs 50,000 pm
1 0.600 0.630 0.661 1.891
Assistant Scientific Officer @ Rs 30,000 pm 3 1.08 1.134 1.190 3.404
Sub-Total: 4 1.800 1.884 1.971 5.655
PAY OF OTHER STAFF
Office Assistant @ Rs 15,000 pm 1 0.180 0.189 0.198 0.567
Senior Clerk @ Rs 10,000 pm 1 0.120 0.126 0.132 0.378
Driver @ Rs 7,000 pm 1 0.084 0.088 0.092 0.264
Contingent paid staff ( skilled & unskilled labour) - 0.400 0.450 0.500 1.350 Sub-total: 3 0.684 0.753 0.822 2.259 Total cost of establishment: 7 2.484 2.637 2.793 7.914
Table 3. Capital cost estimates of CCRI, Multan
Rs (million) Particulars Qty
2008-09 2009-10 2010-11 Total
Vehicles/Motorcycles
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0.000 0.000 1.500 Sub-total: 1.500 0.000 0.000 1.500
Machinery & Equipment
Oil Heaters 4 0.040 -- -- 0.040
Humidifier 2 0.200 -- -- 0.200
Laptop with Color Printer 1 0.150 -- -- 0.150
UPS (Un-interrupted Power Supply) 1 0.050 -- -- 0.050
Refrigerator 2 0.080 -- -- 0.080
Split AC 2 0.090 -- -- 0.090
Microscope with auto photo-system 1 1 0.350 -- -- 0.350
Pocket weather tracker 2 0.100 -- -- 0.100
Aluminum racks &cages Various 0.300 -- -- 0.300
Incubator 1 0.100 -- -- 0.100 Sub-total: - 1.46 - - 1.46
Furniture & Fixture (Office cum lab) Various 0.350 0 0 0.350 Sub-total: - 0.350 0.000 0.000 0.350
Total of D/Goods for CCRI, Multan: - 3.310 0 0 3.310
Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Establishment cost for CCRI, Multan 2.484 2.637 2.793 7.914
Durable Goods 3.310 0.000 0.000 3.310
Operating Expenses 1.425 1.500 1.485 4.41 Total: 7.219 4.137 4.278 15.634
Contingency /unforeseen/escalating cost @ 5% 0.236 0.075 0.074 0.385
Grand total: 7.455 4.212 4.352 16.019
48
Table 4. Operational expenses for CCRI, Multan
Particulars Rs (million)
Operating expenses 2008-09 2009-10 2010-11 Total
Travel and subsistence 0.300 0.300 0.300 0.900
POL charges 0.300 0.400 0.400 1.100
Communications 0.050 0.050 0.050 0.150
Utilities 0.100 0.100 0.100 0.300 Sub-total: 0.750 0.850 0.850 2.450
Other expenses
Consumable stores 0.350 0.350 0.350 1.050
Stationery 0.100 0.100 0.100 0.300
Advertisement publication 0.025 0.025 0.025 0.075
Technical books 0.050 0.025 0.010 0.085
Miscellaneous 0.050 0.050 0.050 0.150 Sub-total: 0.575 0.550 0.535 1.660
Repair and maintenance
Transport , machinery and furniture , etc 0.100 0.100 0.100 0.300 Sub-total: 0.100 0.100 0.100 0.300
Total: 1.425 1.500 1.485 4.41
49
Annexure-IV IV. Cotton Research Institute, Sakrand
Table 1. Budget Summary of CCRI, Sakrand Rs. (million)
Particulars 2008-09 2009-10 2010-11 Total
Establishment Cost for CCRI, Sakrand 2.584 2.737 2.893 8.214
Durable Goods 3.190 - - 3.190
Operational Expenses 1.175 1.420 1.430 4.025
Total 6.949 4.157 4.323 15.429
Contingency /unforeseen/escalating cost @ 5% 0.218 0.071 0.071 0.360
Grand total: 7.167 4.228 4.394 15.789
Table 2. Pay of Staff at CCRI, Sakrand Rs. (million)
Particulars No. of
Posts 2008-09 2009-10 2010-11 Total
Pay of Officers:
Honorarium project incharge 0.120 0.120 0.120 0.360
Principal Scientific Officer
(Entomology Expert) @ Rs. 75,000/- pm 1 0.900 0.945 0.992 2.837
Assistant Scientific Officer @ Rs.30,000/- pm 2 0.72 0.756 0.793 2.269
Sub Total 3 1.74 1.821 1.905 5.466
Pay of Staff
Accountant @ Rs. 15,000/- pm 1 0.180 0.189 0.198 0.567 Computer Operator @ Rs. 15,000/- pm 1 0.180 0.189 0.198 0.567 Driver @ Rs. 7,000/- pm 1 0.084 0.088 0.092 0.264
Contingent paid staff 0.400 0.450 0.500 1.350 Sub Total 3 0.844 0.916 0.988 2.748
Total Cost of Establishment 2.584 2.737 2.893 8.214
Table 3. Capital Cost Estimates of CCRI, Sakrand Rs. (million)
Particulars Qty. 2008-09 2009-10 2010-11 Total
Vehicles/Motorcycles
Vehicle 1 with AC (single cabin customized) 4x2
1 1.500 - - 1.500
Sub Total 1.500 - - 1.500
Machinery & Equipment
Oil Heaters 2 0.030 - - 0.030
Humidifier 2 0.300 - - 0.300
Laptop with Colour Printer 1 0.150 - - 0.150
UPS (Un-interrupted Power Supply) 1 0.050 - - 0.050
Split AC 2 0.090 - - 0.090
Microscope with Auto Photo-system 1 1 0.350 - - 0.350
Pocket weather tracker 1 0.050 - - 0.050
Aluminum racks & cages Various 0.300 - - 0.300
Incubator 1 0.100 - - 0.100
Sub Total 1.420 - - 1.420
Furniture & Fixture Various 0.270 - - 0.270
Sub Total 0.270 - - 0.270
Total D/Goods of CCRI, Sakrand 3.190 - - 3.190
50
Table 4. Operational Expenses for CCRI Sakrand Rs. (million)
Particulars 2008-09 2009-10 2010-11 Total
Operating Expenses
Traveling & Subsistence 0.280 0.300 0.300 0.880
POL Charges 0.290 0.380 0.380 1.050
Communications 0.050 0.060 0.060 0.170
Sub Total 0.620 0.740 0.740 2.100
Other Expenses
Stationary 0.070 0.090 0.090 0.250
Advertisement / Publication 0.035 0.040 0.050 0.125
Consumable Stores 0.300 0.350 0.400 1.050
Technical books 0.050 0.050 0 0.100
Miscellaneous 0.050 0.050 0.050 0.150
Sub Total 0.505 0.580 0.590 1.675
Repair & Maintenance
Transport, Machinery and Furniture etc. 0.050 0.100 0.100 0.250
Sub Total 0.050 0.100 0.100 0.250
Total 1.175 1.420 1.430 4.025
51
Annexure-V V. Agriculture Research Institute, Tandojam
Table 1. Budget Summary of ARI, Tandojam
Table 2. Pay of Staff at ARI, Tandojam (Cotton Mealy Bug) Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Honoraria for Entomologist Incharge Unit - 0.120 0.120 0.120 0.360
Scientific Officers @ 45,000 pm 2 1.080 1.134 1.190 3.404
Research Associate @ 30,000 pm 2 0.720 0.756 0.794 2.270
Sub-Total: 4 1.920 2.010 2.104 6.034
PAY OF OTHER STAFF
Driver @ Rs 7000 PM 1 0.084 0.088 0.092 0.264
Contingent paid staff ( skilled & unskilled labour) - 0.300 0.350 0.400 1.050 Sub-total: 1 0.384 0.438 0.492 1.314
Total cost of establishment: 5 2.304 2.448 2.596 7.348
Table 3. Pay of Staff at Model Farm, Sindh
Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Scientific Officers @ 45,000 pm 2 1.080 1.188 1.306 3.574
Research fellow @ 30,000 pm 2 0.720 0.756 0.794 2.270
Sub-Total: 4 1.800 1.944 2.100 5.844
PAY OF OTHER STAFF
Contingent paid staff ( skilled & unskilled labour) - 0.500 0.500 0.500 1.500 Sub-total: - 0.500 0.500 0.500 1.500
Total cost of establishment: 4 2.300 2.444 2.600 7.344
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for ARI, T-Jam 2.304 2.448 2.596 7.348
Establishment cost of Model Farm in Sindh 2.300 2.444 2.600 7.344 Sub-total: 4.604 4.892 5.196 14.692
Durable goods, vehicles, civil works 39.290 0 0 39.290
Operating cost
Operating Expenses at ARI, T-Jam 1.255 1.430 1.415 4.100
Operating Expenses at Model Farms in Sindh 1.530 4.580 4.580 10.690 Sub-total of operating cost: 2.785 6.010 5.995 14.790
Total: 46.679 10.902 11.191 68.772 Contingency /unforeseen/escalating cost @ 5% 2.103 0.300 0.299 2.702 Grand total: 48.782 11.202 11.490 71.474
52
Table 4. Capital cost estimates for ARI, Tandojam and model farm in Sindh Rs (million) Particulars Qty
2008-09 2009-10 2010-11 Total
Vehicles
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500
Motorcycle for ARI, TJ 4 0.220 0 0 0.220 Sub-total: - 1.720 0 0 1.720
Lab equipment for ARI,T Jam
Refrigerators (12/14 cubic feet each) 8 0.200 0.000 0.000 0.200
Split Type A/C (2 tonnes) 20 0.900 0.000 0.000 0.900
Dissecting microscope 2 0.300 0 0 0.300
Pocket weather tracker 2 0.100 0 0 0.100
Humidifier with accessories 1 0.100 0 0 0.100
Oil heaters 4 0.040 0 0 0.040
Incubator 1 0.075 0 0 0.075
Stereomicroscope with digital camera and other attachments
1 0.350 0 0 0.350
Power generator 20KV with accessories 1 0.600 0 0 0.600
Desk top Computer w/ colored laser printer 1 0.130 0 0 0.130
Lap top computer 1 0.095 0 0 0.095
Photocopier 1 1 0.200 0 0 0.200 Sub-total: - 3.090 0 0 3.090
Total: - 4.810 0 0 4.810
Lab equipment for Model Farm in Sindh
Refrigerator with stabilizer 1 0.040 0 0 0.040
Split AC with accessories 2 0.080 0 0 0.080
Dissecting microscope 1 0.150 0 0 0.150
Humidifier with accessories 1 0.100 0 0 0.100
Computer with printer 1 0.070 0 0 0.070
Oil heaters 4 0.040 0 0 0.040
Power generator 20KV with accessories 1 0.600 0 0 0.600 Sub-total: - 1.080 0 0 1.080
Furniture & Fixture
Furniture Various
0.200 0 0 0.200
Racks and cages Various
0.200 0 0 0.200
Sub-total: - 0.400 0 0 0.400
Civil work
Laboratory & Insectary building with complete necessary equipment, fittingsat ARI, Tando Jam (16,476 sq ft)
1 33.000 0 0 33.000
Sub-total: - 33.000 0 0 33.000
Total: - 39.290 0 0 39.290
53
Table 5. Operational expenses for ARI, Tandojam
Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Operating expenses
Travel and subsistence 0.300 0.300 0.300 0.900
POL charges 0.300 0.400 0.400 1.100
Communications 0.050 0.050 0.050 0.150
Utilities 0.100 0.100 0.100 0.300 Sub-total: 0.750 0.850 0.850 2.450 Other expenses
Consumable stores 0.300 0.300 0.300 0.900
Stationery 0.100 0.100 0.100 0.300
Advertisement publication 0.025 0.025 0.025 0.075
Technical books 0.050 0.025 0.010 0.085
Miscellaneous 0.030 0.030 0.030 0.090 Sub-total: 0.505 0.480 0.465 1.450
Repair and maintenance
Transport , machinery and furniture - 0.100 0.100 0.300 Sub-Total - 0.100 0.100 0.200
Total for ARI, TJ 1.255 1.430 1.415 4.100
Table 6. Operational expenses for Model Farm, Sindh
Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Operating expenses
Travel and subsistence 0.300 0.300 0.300 0.900
POL for motor cycles 0.200 0.200 0.200 0.600
Communications 0.050 0.050 0.050 0.150
Office cum lab building rent 0.180 0.180 0.180 0.540
Utilities 0.100 0.100 0.100 0.300 Sub-total: 0.830 0.830 0.830 2.490
Other expenses
Supplies and materials 0.200 0.200 0.200 0.600
Stationery 0.100 0.100 0.100 0.300
Advertisement publication, printing 0.050 0.050 0.050 0.150
Training to farmers 0.300 0.300 0.300 0.900 Sub-total: 0.650 0.650 0.650 1.950
Unforeseen expense
Miscellaneous (Customs, duties taxes etc) 0.050 0.050 0.050 0.150 Sub-total: 0.050 0.050 0.050 0.150
Repair and maintenance
Transport , machinery and furniture - 0.050 0.050 0.100 Sub-total: - 0.050 0.050 0.100
Incentives for farmers (compensation for any unexpected losses to crops)
0 3.000 3.000 6.000
Grand Total 1.530 4.580 4.580 10.690
54
Annexure-VI
VI. Agriculture Research Institute, Quetta
Table 1. Budget Summary of ARI, Quetta
Table 2. Pay of Staff at ARI, Quetta Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Honoraria for Entomologist/Director Incharge Unit - 0.120 0.120 0.120 0.360
Scientific Officers @ 45,000 pm 2 1.080 1.134 1.190 3.404
Research Associate @ 30,000 pm 2 0.720 0.756 0.794 2.270
Sub-Total: 4 1.920 2.010 2.104 6.034
PAY OF OTHER STAFF
Driver @ Rs 7,000 pm 1 0.084 0.088 0.093 0.265
Contingent paid staff ( skilled & unskilled labour) - 0.300 0.350 0.400 1.050 Sub-total: 1 0.384 0.438 0.493 1.315
Total cost of establishment: 5 2.304 2.448 2.597 7.349
Table 3. Operational expenses for ARI, Quetta
Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Operating expenses
Travel and perdiem (TA/DA) 0.300 0.300 0.300 0.900
POL charges 0.300 0.400 0.400 1.100
Communications 0.050 0.050 0.050 0.150
Utilities 0.100 0.100 0.100 0.300 Sub-total: 0.750 0.850 0.850 2.450
Other expenses
Consumable stores 0.300 0.300 0.300 0.900
Stationery 0.100 0.100 0.100 0.300
Advertisement publication 0.025 0.025 0.025 0.075
Technical books 0.050 0.025 0.010 0.085
Training of farmers cost 0.200 0.200 0.200 0.600
Miscellaneous 0.030 0.030 0.030 0.090 Sub-total: 0.705 0.680 0.665 2.050
Repair and maintenance
Transport , machinery and furniture 0.050 0.100 0.100 0.250 Sub-total: 0.050 0.100 0.100 0.250
Total: 1.505 1.630 1.615 4.750
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for ARI, Quetta 2.304 2.448 2.597 7.349 Sub-total: 2.304 2.448 2.597 7.349
Durable goods, vehicles and civil work 21.440 0 0 21.440 Sub-total: 21.440 0 0 21.440
Operating cost
Operating Expenses at ARI, Quetta 1.505 1.630 1.615 4.750
Total: 25.249 4.078 4.212 33.539 Contingency /unforeseen/escalating cost @ 5% 1.147 0.081 0.080 1.308
Grand total: 26.396 4.159 4.292 34.847
55
Table 4. Capital cost estimates for ARI, Quetta Rs (million) Particular Qty
2008-09 2009-10 2010-11 Total
Vehicles
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500
Motorcycle (70 cc) 4 0.220 0 0 0.220 Sub-total: 1.720 0 0 1.720
Lab Equipment
Refrigerators (12/14 cubic feet each) 4 0.100 0.000 0.000 0.100
Split Type A/C (2 tonnes) 10 0.450 0.000 0.000 0.450
Dissecting microscope 2 0.300 0 0 0.300
Pocket weather tracker 2 0.100 0 0 0.100 Humidifier with accessories 1 0.100 0 0 0.100
Oil heaters 2 0.020 0 0 0.020
Incubator 1 0.075 0 0 0.075
Stereomicroscope with digital camera and attachments
1 0.350 0 0 0.350
Power generator 20 Kv with accessories 1 0.600 0 0 0.600
Desk top computer with colored laser printer 1 0.130 0 0 0.130
Lap top computer 1 0.095 0 0 0.095 Sub-total - 2.320 0 0 2.320
Furniture & Fixture
Furniture (office cum lab furniture) Various 0.200 0.0 0.0 0.200
Racks & cages Various 0.200 0.0 0.0 0.200 Sub-total: - 0.400 0 0 0.400
Civil work Laboratory & Insectary building with complete necessary equipment, fittings, at Khuzdar
8,500 Sq ft
17.000 0 0 17.000
Sub-total: 17.000 0 0 17.000
Total: 21.440 0 0 21.440
56
Annexure-VII
VII. Agriculture Research Institute, D. I. Khan
Table 1. Budget Summary of ARI, D. I. Khan
Table 2. Pay of Staff at ARI, D. I. Khan Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Honoraria for Entomologist/Director Incharge Unit - 0.120 0.120 0.120 0.360
Scientific Officers @ 45,000 pm 1 0.540 0.594 0.650 1.784
Research Associate @ 30,000 pm 1 0.360 0.378 0.397 1.135
Sub-Total: 2 1.020 1.092 1.167 3.279
PAY OF OTHER STAFF
Driver @ Rs 7,000 pm 1 0.084 0.088 0.093 0.265
Contingent paid staff ( skilled & unskilled labour) - 0.100 0.150 0.200 0.450 Sub-total: 1 0.184 0.238 0.293 0.715
Total cost of establishment: 3 1.204 1.330 1.460 3.994
Table 3. Operational expenses for ARI, D. I. Khan
Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Operating expenses
Travel and perdiem (TA/DA) 0.100 0.150 0.200 0.450
POL charges 0.200 0.230 0.260 0.690
Communications 0.050 0.050 0.050 0.150
Utilities 0.050 0.060 0.070 0.180 Sub-total: 0.400 0.490 0.580 1.470
Other expenses
Consumable stores 0.200 0.230 0.260 0.690
Stationery 0.040 0.050 0.060 0.150
Advertisement publication 0.025 0.025 0.025 0.075
Technical books 0.050 0.025 0.010 0.085
Training of farmers cost 0.100 0.150 0.150 0.400
Miscellaneous 0.030 0.030 0.030 0.090 Sub-total: 0.445 0.510 0.535 1.490
Repair and maintenance
Transport , machinery and furniture 0.050 0.100 0.100 0.250 Sub-total: 0.050 0.100 0.100 0.250
Total: 0.895 1.100 1.215 3.210
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for ARI, D.I.Khan 1.204 1.330 1.460 3.994 Durable goods & vehicles &civil work 5.950 0 0 5.950 Operating cost 0.895 1.100 1.215 3.210 Total: 8.049 2.430 2.675 13.154 Contingency /unforeseen/escalating cost @ 5% 0.342 0.055 0.060 0.457 Grand total: 8.391 2.485 2.735 13.611
57
Table 4. Capital cost estimates for ARI, D. I. Khan Rs (million) Particular Qty
2008-09 2009-10 2010-11 Total
Vehicles
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500
Motorcycle (70 cc) 2 0.110 0 0 0.110 Sub-total: 1.61 0 0 1.61
Lab Equipment
Refrigerator (14/16 cu ft) with accessories 2 0.080 0 0 0.080
Split AC with accessories 2 0.090 0 0 0.090
Dissecting microscope 2 0.300 0 0 0.300
Pocket weather tracker 2 0.100 0 0 0.100
Humidifier with accessories 1 0.100 0 0 0.100
Oil heaters 2 0.020 0 0 0.020
Incubator 1 0.075 0 0 0.075
Stereomicroscope with digital camera and attachments
1 0.350 0 0 0.350
Power generator 20 Kv with accessories 1 0.600 0 0 0.600
Desk top computer with colored laser printer 1 0.130 0 0 0.130
Lap top computer 1 0.095 0 0 0.095 Sub-total - 1.940 0 0 1.940 Furniture & Fixture
Furniture (Office cum lab furniture) Various 0.100 0.0 0.0 0.100
Racks & cages Various 0.100 0.0 0.0 0.100 Sub-total: - 0.200 0 0 0.200
Civil work Mini Laboratory & Insectary building with complete necessary equipment, fittings, air conditioning, furniture & racks cages in D I Khan
11,00 Sq ft
2.200 0 0 2.200
Sub-total: 2.200 0 0 2.200
Total: 5.950 0 0 5.950
58
Annexure-VIII
VIII. Agriculture Research Institute, NIAB, Faisalabad Table 1. Budget Summary of NIAB, Faisalabad
Table 2. Pay of Staff at NIAB, Faisalabad Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Project allowance for Dy. Chief Sc (bio-control) (PI) - 0.120 0.120 0.120 0.360
Honorarium for Sub-unit for Insect resistance - 0.120 0.120 0.120 0.360
Research Associate @ Rs 30,000 pm 2 0.720 0.756 0.793 2.269
Scientific Assistants @ Rs 15,000 pm 4 0.720 0.756 0.793 2.269
Sub-Total: 6 1.680 1.752 1.826 5.258
PAY OF OTHER STAFF
Clerk @ Rs 10,000 pm 1 0.120 0.126 0.132 0.378
Driver @ Rs 7,000 pm 1 0.084 0.088 0.093 0.265
Contingent paid staff ( skilled & unskilled labour) - 0.200 0.300 0.325 0.825 Sub-total: 2 0.404 0.514 0.550 1.468
Total cost of establishment: 2.084 2.266 2.376 6.726
Table 3. Operational expenses for NIAB, Faisalabad Rs (million) Particulars
2008-09 2009-10 2010-11 Total
Operating expenses
Travel and perdiem (TA/DA) 0.150 0.200 0.250 0.600
POL charges 0.130 0.150 0.180 0.460
Communications 0.070 0.070 0.070 0.210
Stationary 0.080 0.080 0.080 0.240
Utilities 0.050 0.050 0.050 0.150
Books and journals 0.100 0.050 0.050 0.200 Sub-total: 0.580 0.600 0.680 1.860
Other expenses
Consumable stores 0.500 0.350 0.150 1.000
Advertisement, publication, printing 0.100 0.050 0.050 0.200
Miscellaneous (unforeseen, duties, taxes etc.) 0.200 0.150 0.125 0.475 Sub-total: 0.800 0.550 0.325 1.675 Repair and maintenance
Transport, machinery and furniture 0.050 0.120 0.150 0.320 Sub-total: 0.050 0.120 0.150 0.320
Total: 1.430 1.270 1.155 3.855
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for NIAB, Faisalabad 2.084 2.266 2.376 6.726 Sub-total: 2.084 2.266 2.376 6.726
Durable goods, civil works & vehicles 10.120 0.000 0.000 10.120
Operating cost
Operating Expenses at NIAB, Faisalabad 1.430 1.270 1.155 3.855 Total 13.634 3.536 3.531 20.701 Contingency /unforeseen/escalating cost @ 5% 0.577 0.063 0.057 0.697
Grand total: 14.211 3.599 3.588 21.398
59
Table 4. Capital cost estimates for NIAB, Faisalabad Rs (million) Particulars Qty
2008-09 2009-10 2010-11 Total
Vehicles
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500 Sub-total: - 1.500 0 0 1.500
Equipment and machinery
Incubators 1 0.250 0 0 0.250
Deep freezers 1 0.025 0 0 0.025
Refrigerators 2 0.075 0 0 0.075
Analytical balance 1 0.200 0 0 0.200
Digital camera and accessories 1 0.050 0 0 0.050
Computers with printers 2 0.140 0 0 0.140
Stereomicroscope with camera and attachments 1 0.350 0 0 0.350
Diet preparation kettle 1 0.200 0 0 0.200
Power generator 20KV with accessories 1 0.600 0 0 0.600
Photocopier 1 0.200 0 0 0.200
Oven heavy duty for sterilizing rearing equipments 1 0.300 0 0 0.300
Microwave oven for sterilizing diet ingredients 1 0.010 0 0 0.010
Rearing cages, stands, fixtures 1 0.500 0 0 0.500
Heating and cooling system for rearing labs 1 1.000 0 0 1.000
Humidifiers 1 0.150 0 0 0.150
Thermometers Various 0.020 0 0 0.020
Dust and chemical masks with filters for rearing 4 0.100 0 0 0.100
Storage kits for transportation of natural enemies Various 0.050 0 0 0.050
Research equipment/ machinery for IRM labs Various 0.200 0 0 0.200 Sub-total: - 4.420 0 0 4.420
Furniture & Fixture
Furniture and fixtures (office cum lab furniture) Various 0.200 0 0 0.200 Sub-total: - 0.200 0 0 0.200
Civil Works
Lab building expansion/construction for establishing Insectary with complete necessary equipment, fittings, air conditioning, furniture & racks cages etc.
2000 sq ft
4.000 - - 4.000
Sub-total 4.000 - - 4.000
Total 10.120 - - 10.120
60
Annexure-IX
IX. National Agriculture Research Centre, Islamabad
Table 1. Budget Summary of NARC, Islamabad
Table 2. Pay of Staff at NARC, Islamabad Particulars Rs (million)
PAY OF OFFICERS
No. of posts
2008-09 2009-
10 2010-11 Total
Honoraria/Project allowance for Principla Investigator - 0.120 0.120 0.120 0.360
Scientific Officer @ Rs 45,000 pm 1 0.540 0.594 0.650 1.784
Scientific Assistants @ Rs 15,000 pm 1 0.180 0.189 0.198 0.567
Sub-Total: 2 0.84 0.903 0.968 2.711
PAY OF OTHER STAFF
Honoraria for support staff - 0.060 0.070 0.080 0.210
Contingent paid staff ( skilled & unskilled labour) - 0.180 0.200 0.240 0.620
Stipend/internship - 0.180 0.180 0.240 0.600 Sub-total: 2 0.420 0.450 0.560 1.430
Total cost of establishment: 2 1.260 1.353 1.528 4.141
Table 3. Operational expenses for NARC, Islamabad
Rs (million) Particulars 2008-09 2009-10 2010-11 Total
Operating expenses
Travel and perdiem (TA/DA) 0.300 0.330 0.370 1.000
POL charges 0.300 0.310 0.320 0.930
Communications 0.085 0.095 0.100 0.280
Stationary 0.050 0.070 0.080 0.200
Utilities 0.000 0.020 0.020 0.040
Books and journals 0.100 0.050 0.050 0.200 Sub-total: 0.835 0.875 0.940 2.650
Other expenses
Consumable stores 0.250 0.300 0.350 0.900
Advertisement, publication, printing 0.080 0.090 0.100 0.270
Miscellaneous (unforeseen, duties, taxes etc.) 0.080 0.090 0.090 0.260
Seminar/Workshop 0.030 0.050 0.050 0.130 Sub-total: 0.440 0.530 0.590 1.560
Repair and maintenance
Transport, machinery and furniture 0.100 0.190 0.245 0.535 Sub-total: 0.100 0.190 0.245 0.535
Total: 1.375 1.595 1.775 4.745
Rs (million) Particulars
Year 1 Year 2 Year 3 Total
Establishment cost for NARC, Islamabad 1.260 1.353 1.528 4.141 Sub-total: 1.260 1.353 1.528 4.141
Durable goods & vehicles
Vehicle 1.500 0 0 1.500
Research equipments 0.260 0.515 0.000 0.775
Furniture & Fixture 0.100 0 0 0.100 Sub-total: 1.860 0.515 0 2.375
Operating cost
Operating Expenses at NARC 1.375 1.595 1.775 4.745 Sub-total: 1.375 1.595 1.775 4.745
Total: 4.495 3.463 3.303 11.261 Contingency /unforeseen/escalating cost @ 5% 0.161 0.105 0.088 0.354
Grand total: 4.656 3.568 3.391 11.615
61
Table 4. Capital cost estimates for NARC, Islamabad Rs (million) Particulars Qty
2008-09 2009-10 2010-11 Total
Vehicles
Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500 Sub-total: - 1.500 0 0 1.500
Equipment and machinery
Desk top Computer with printer 1 0.060 0 0 0.060
Research equipment/ machinery Various 0.200 0.515 0.000 0.715 Sub-total: - 0.260 0.515 0.000 0.775
Furniture & Fixture
Furniture and fixes Various 0.100 0 0 0.100 Sub-total: - 0.100 0 0 0.100
Total - 1.860 0.515 0 2.375
62
Annexure-X
X. Federal Monitoring & Coordination Unit, Islamabad Table 1. Budget Summary of FMCU
Rs (million) Particulars 2008-09 2009-10 2010-11 Total
Establishment charges 3.096 3.315 3.548 9.959
Operating cost 3.420 3.695 4.030 11.145 Sub-total: 6.516 7.010 7.578 21.104
Durable goods
Vehicle cost 0.850 0 0 0.850
Motorcycle cost 0.055 0 0 0.055
Office equipment 0.700 0 0 0.700
Furniture 0.400 0 0 0.400 Sub-total: 2.005 0 0 2.005
Total: 8.521 7.010 7.578 23.109 Contingency /unforeseen/escalating cost @ 5% 0.271 0.184 0.201 0.656 Outsourcing 5.000 5.000
Grand total: 13.792 7.194 7.779 28.765
Table 2. Staff Requirement for FMCU Designation Pay Scale No.
Officers
National Project Director (NPD) 20 1
Assistant Project Director 18 1
Accounts and Admin Officer 17 1
Sub-total: 3 Supporting staff
Personal Assistant (PA) w/Computer skills 16 1
Office Assistant w/Computer skills 11 1
Assistant Accounts officer 12 1
Driver 4 1
Naib Qasid 1 1
Sub-total: 5
Total: - 8
Table 3. Pay of Staff for FMCU
Rs (million) Particulars # of posts 2008-09 2009-10 2010-11 Total
National Project Director (NPD) @ Rs 100,000 pm
1 1.200 1.260 1.323 3.783
Assistant Project Director @ Rs 50,000 pm 1 0.600 0.660 0.726 1.986
Accounts Officer @ Rs 45,000 1 0.540 0.567 0.595 1.702 Sub-total (Rs million): 3 2.340 2.487 2.644 7.471
Supporting staff
Private Assistant (PA) @ Rs 20,000 pm 1 0.240 0.264 0.290 0.794
Accounts Assistant @ Rs 15,000 pm 1 0.180 0.198 0.217 0.595
Office Assistant @ Rs 15,000 pm 1 0.180 0.198 0.217 0.595
Driver @ Rs 7,000 1 0.084 0.088 0.093 0.265
Naib Qasid @ Rs 6,000 pm 1 0.072 0.080 0.087 0.239 Sub-total: 5 0.756 0.828 0.904 2.488
Grand Total: 8 3.096 3.315 3.548 9.959
63
Table 4. Operational expenses for FMCU Rs (million) Particulars
2008-09 2009-10 2010-11 Total
TA/DA 0.400 0.450 0.500 1.350
POL for vehicles 0.300 0.350 0.400 1.050
POL for motor cycles (1) 0.050 0.060 0.070 0.180
Repair and maintenance of M/cycles (1) 0.020 0.025 0.030 0.075
Repair and maintenance for vehicles (1) 0.050 0.060 0.080 0.190
Repair and maintenance of Office equipment 0.030 0.030 0.040 0.100
Postage/Courier 0.040 0.050 0.050 0.140
Telephone/fax 0.080 0.090 0.100 0.270
Publicity charges 0.050 0.060 0.070 0.180
Stationery 0.100 0.080 0.090 0.270
Utility bills 0.100 0.120 0.130 0.350
Office Rent 1.400 1.500 1.600 4.500
Rent of residence 0.400 0.450 0.500 1.350
Taxes and royalties 0.050 0.020 0.020 0.090
Printing 0.050 0.050 0.050 0.150
Meetings/workshops/seminars 0.200 0.200 0.200 0.600
Others 0.100 0.100 0.100 0.300 Total : 3.420 3.695 4.030 11.145
Table 5. Capital cost estimates for FMCU Item Qty Unit price (Rs) Total amount
(Rs million)
Vehicles 1000 cc w/CNG fitting 1 850,000 0.850
Motor cycles 1 55,000 0.055
Computer with printer 2 70,000 0.140
Lap tops 1 95,000 0.095
Scanner 1 30,000 0.030
Photo-copier 1 200,000 0.200
Fax 1 35,000 0.035
Multimedia with screen 1 200,000 0.200
Furniture - - 0.400 Total: - - 2.005
64
Annexure XI
Component wise total costs of the project Component Rs million Federal Monitoring & Coordination Unit, Islamabad 28.765 CABI South Asia, Rawalpindi 72.377
Ayub Agriculture Research Institute, Faisalabad 94.442 Agriculture Research Institute, Tandojam 71.474
Agriculture Research Institute, D. I. Khan 13.611 Agriculture Research Institute, Quetta 34.847 Central Cotton Research Institute, Multan 16.019 Cotton Research Institute, Sakrand 15.789 NIAB, Faisalabad 21.398 Total: 368.722
PARC to provide funding for NARC component of this project out of RADP
National Agriculture Research Center, Islamabad 11.615
65
Annexure-XII
Cost Summary of the project “Biological control of the cotton pests including mealy bug”
Items
FMCU ARI
FD
ARI
TJ
ARI
DIK
ARI
Qta
CCRI Multan
CABI
Rwp
NIAB
FD
CRI
Sakrand
Total
Establishment Charges 9.959 30.713 14.692 3.994 7.349 7.914 33.385 6.726 8.214 122.946 Operational Charges 11.145 8.455 14.790 3.210 4.750 4.410 29.540 3.855 4.025 84.1800 Sub-total: 21.104 39.168 29.482 7.204 12.099 12.324 62.925 10.581 12.239 207.126 Cost of durable goods Purchase of Motorcycles 0.055 0.220 0.220 0.110 0.220 0.000 0.210 0.000 0.000 1.0350 Purchase of Vehicles 0.850 3.000 1.500 1.500 1.500 1.500 0.000 1.500 1.500 12.850 Lab & Office
Equipment/machinery 1.100 16.020 4.570 2.140 2.720 1.810 2.663 4.620 1.690 37.333
Sub-total: 2.005 19.240 6.290 3.750 4.440 3.310 2.873 6.120 3.190 51.218 Civil works 0.000 33.000 33.000 2.200 17.000 0.000 0.000 4.000 0.000 89.200 Contingency 0.656 3.034 2.702 0.457 1.308 0.385 0.000 0.697 0.360 9.599 Institutional charges 0.000 0.000 0.000 0.000 0.000 0.000 6.579 0.000 0.000 6.579 Outsourcing 5.000 5.000 Total: 28.765 94.442 71.474 13.611 34.847 16.019 72.377 21.398 15.789 368.722
66
Annexure-XIII
References:
Abdel Razek, A. S. (2006). Infectivity prospects of both nematodes and bacterial symbionts
against cotton leaf worm, Spodoptera littoralis (Biosduval) (Lepidoptera: Noctuidae).
Journal of Pest Science 79, 11-15.
Abbas, M. S. T. and El-Deeb, A. A. (1993). On the natural enemies of the major pests infesting
cotton in Egypt. Egyptian Journal of Agricultural Research. 71: 131-138.
Ahmed, Z. (1991) Integrated pest management in Pakistan in the Asia Pacific Region. Proc.
Conf. IPM in the Asia Pacific region ,23-27 September 1991, Kuala Lumpur
Ahmed, Z. (2000). Integrated pest management in Pakistan. The NEWS, August 1, 2000.
Ahmed, Z. (1999). Pest problems of cotton-A regional perspective. Proc. ICAC-CCRI regional
consultation insecticide resistance management in cotton. CCRI, Multan,Pakistan,5-20.
Ahmad, I. and Poswal,A.2000. Cotton integrated pest management in Pakistan: Current status.
Country report presented in cotton IPM planning and curriculum workshop
organized by FAO, Bankok, Thailand, February 28-March 2,2000.
Akhurst, R.J. (1986). Controlling insects in soil with entomopathogenic nematodes. In: Samson,
R.A. Vlak, J.M. & Peters, D. (Eds). Fundamental and applied aspects of invertebrate
pathology. Proceedings 4th International Colloquium of Invertebrate. Pathology, pp.
265-267.
Amornsak, W., G. Gordh & G. Graham. 1998. Detecting parasitised eggs with polymerase chain
reaction and DNA sequence of Trichogramma australicum Girault (Hymenoptera:
Trichogrammatidae). Austr. J. Entomol. 37: 174-179.
Baloch, U. K. (1995). Pesticide monitoring programme. Paper presented for WWF-Pakistan,
Lahore.
Banu, J. G. & Rajendran, G. (2002). Host records of an entomopathogenic nematode,
Heterorhabditis indica. Insect Environment 8, 61-63.
Clausen ,C.P. (1978). Introduced parasites and predators of arthropod pests and weeds: A world
review. Agriculture Handbook No 480 USDA pp 545.
Ebssa, L., Borgemeister, C. & Poehling, H.M. (2004). Effectiveness of different species/strains
of entomopathogenic nematodes for control of western flower thrips (Frankliniella
Occidentalis) at various concentrations, host densities, and temperatures. Biological
Control 29, 145-154.
Ehlers, R.-U. (2001). Mass production of entomopathogenic nematodes for plant protection.
Applied Microbiology and Biotechnology 56, 623-633.
67
Flanders, S. E. (1944). Biological control of the potato mealy bug. J. Econ. Ent.37; 365-371.
Forlow Jech, L. & Henneberry, T. J. (1997). Pink bollworm larval mortality following
application of Steinernema riobravis entomopathogenic nematodes in cotton furrow
irrigation. Proceedings Beltwide Cotton Conferences 2, 6-10.
Gaugler, R. (1988). Ecological considerations in the biological control of soil-inhabiting insects
with entomopathogenic nematodes. Agriculture Ecosystems and Environment 24,
351-360.
Glazer, I., Nakache, Y. & Klein, M. (1992).Use of entomopathogenic nematodes against foliage
pests. Hassadeh 72, 351-354.
Gugerli, P. (2003). Grapevine leafroll and related viruses. In Extended Abstracts of the XIV
Meeting of the International Council for the Study of Virus and Virus-like Diseases
of the Grapevine, Locorotondo, Italy, 12–17
Hasnain, T. (1999) Pesticide –use and its impact on crop ecologies: issues and options. SDPI
working paper series. SDPI, Islamabad, pp73.
Hoy, M. 1994. Insect molecular genetics. An introduction to principles and applications.
Academic Press, Inc. San Diego, California, 546.
Hopkins, D.L., Purcell, A.H., 2002. Xylella fastidiosa: cause of Pierce’s disease of grapevine and
other emergent diseases. Plant Dis. 86, 1056–1066.
Hussaini, S.S., Singh, S.P., Parthasarathy, R. & Shakeela, V. (2000). Virulence of native
entomopathogenic nematodes against black cutworms, Agrotis ipsilon (Hufnagel) and
A. segetum (Noctuidae : Lepidoptera). Indian Journal of Nematology 30, 103-105.
Inayatullah, C. (1997). Re-thinking the cotton pesticide link. The NEWS, January 4,1997.
Inayatullah, C. and Haseeb,M. (1996). Poisoning by pesticides. Pakistan J. of Medical Res. , 35
(20): 57-58.
Mahmood, R., Mohyuddin, A. I.& Kazimi, S. (1980). Rastrococcus spinosus (Robinson)
(Homoptera: Pseudococcidae) and its natural enemies in Pakistan. Proceedings 1st
Pakistan Congress of Zoology Islamabad, 291-294.
Martinez, Andrés Rebolledo, Del Angel-Perez, Ana Lid, Becerril-Roman, Alberto E. 2005.
Growth analysis for three pineapple cultivars grown on plastic mulch and bare soil.
INCI, 30, 758-763.
Navon, A., Nagalakshmi, V.K., Shlomit, Levski., Salame, L. & Glazer, I. (2002). Effectiveness
of entomopathogenic nematodes in an alginate gel formulation against lepidopterous
pests. Biocontrol Science and Technology 12, 737-746.
Pimental, D. (1992). Assessment of environment and economic impact of pesticide use. A paper
appeared in the monograph (The pesticides Question: Environment, Economics and
ethics Chapman and Hall, New York.
68
Pinto, J. D., R. Stouthamer & G. R. Platner. 1997. A new cryptic species of Trichogramma
(Hymenoptera Trichogrammatidae) from the Mojave desert of California as
determined by morfological, reproductive and molecular data. Proc. Entomol. Soc.
Wash. 99: 238-247.
Poswal, M. A. and Williamson, S. (1998). Stepping off then cotton pesticide treadmill.
Preliminary findings from a farmers’ participatory cotton IPM training project in
Pakistan. CABI Bioscience Center, Rawalpindi..
Qasmi,F. (1997) Pesticides and existing policies in Pakistan. Paper presented during workshop
on “Environment friendly use of pesticides.” Organized by the Environmental
Protection Department, Government of Punjab, March 29, 1997, Lahore.
Qureshi, A. H. and Khan M. A. (2001). Policy and strategy for rational use of pesticides in
Pakistan. United Nations System in Pakistan Publication No UN-
PAK/FAO/2001/002: 55-72.
Sharad, M., Anil, S. & Gaur, H. S. (2004). Successful management of mango mealy bug,
Drosicha mangiferae by Photorhabdus luminescens, a symbiotic bacterium from
entomopathogenic nematode Heterorhabditis indica. International Journal of
Nematology14, 195-198.
Van Steenwyk, A.aR. Toscano, N.C., Bollmer, G.R., K. Kido and H.T. Andreynolds, (1975).
Increases of Heliothis spp. In Cotton under various insecticide treatment regimes.
Environ. Ent., 4: 993-996.
Zeddies, J.; Schaab, R.P.; Neuenschwander, P.; Herren, H.R. (2001)Economics of biological
control of cassava mealybug in Africa. Agricultural Economics, 24, 209–219.
69
Annex XIV
Justification/ ToR for each post in the project “Biological control of the cotton pests
Including mealy bug
Post Justification /TOR
FMCU,
Islamabad
National Project
Director
Will be overall project inchagre and coordinator to look after all
administrative, technical and accounts matters, of the project at national level,
arrange meetings, collect reports from the coordinating units and compile the
quarterly /six monthly report/annual/ final report,
Assistant Project
Director
Will assist the National Project Director in execution of the project
Accounts Officer Will be responsible to maintain the accounts of the project at national level
CABI SA
Rawalpindi
Insect Biocontrol
Specialist (IBS)
Will be overall incharge of the project of CABI Unit. With assistance of project
staff will be responsible for the following:
Collect baseline data on population levels of mealy bug and its natural enemies
on cotton and other plants in different ecological areas as mentioned in work
plan.
Contact scientists abroad and develop program for search and importation of
natural enemies
Develop monitoring protocol for quality assessment of contents and process of
studies in progress on biology and ecology of the pest and natural enemies.
Will give design and requirements for insectary, train the staff of coordinating
units in addressing entomological issues, assist in establishing insectaries at
provincial levels, guide and train in mmaintaining pure insect parasitoids and
predators cultures, their mass production, methods of releases and recovery
surveys. Collect quantitative and qualitative data on impact of natural enemies (exotic
and endemic ones) on mealy bug.
Organize workshops and field days for farmers training and implementation of
mealy bug and other cotton pests management strategies at model farms in
Sindh and Punjab.
Write progress reports and other related documents, brochures for farmers for
technology transfer
Project Officers Will work under guidance of IBS and maintain natural enemy field reservoirs
and do field and laboratory studies assigned by the project incharge
Entomologists They will work at model farms for management of all cotton pests under the
guidance of the IBS
Expert Field
Facilitators
They will work at model farms for conducting FPTR activities for management
of all cotton pests under the guidance of the IBS. They will conduct FFS to
involve the community at model farms for controlling all cotton pests.
Molecular
Scientist
Will be responsible for studies on molecular identification of mealy bugs and
other pests of cotton; checking of possible transmission role of cotton mealy
70
bug for some crop pathogens (bacteria, viruses or fungi) in cotton crop,
molecular identification of variability/races/subspecies in cotton pests, insect
parasitoids and predators; identification of insect pathogens (viruses, bacteria
and fungi) associated with cotton pests; maintain pure cultures of
Trichogramma and other local and newly introduced bio-control agents and
strains associated with cotton pests and supply for large production to
coordinating teams at model farms.
Entomopathogens
Scientist
Will do studies on identification of entomopathogenic nematodes (EPNs)
associated with cotton pests in Pakistan; pathogenecity of EPNs against
different cotton pests; role of EPNs in controlling cotton pests (mealy bug and
others); develop technology for mass production of EPNs for cotton pests;
conduct field assays on efficacy of EPNs attacking cotton pests and import
exotic useful nematodes strains for trials against cotton pests.
AARI,
Faisalabad
Provincial project
Director
Will be incharge of the project unit, design studies and supervise the unit
activities for controlling mealy bug and other pests on cotton in the specified
area.
Asstt
Entolmologists
and Asstt Res
Officers (Ento)
Will be responsible for conducting all studies assigned in the project plan for
controlling mealy bug on cotton in their project area and all other cotton pests
at the model farm in the Punjab. Their duties will be assigned by the incharge
of the unit
CCRI, Multan Senior Scientific Officer (MB Management Expert)
Will be incharge of the project unit, design studies and supervise the unit
activities for the staff for studies on controlling mealy bug on cotton in the
specified area.
Assistant
Scientific Officer
Will work under the guidance of the unit incharge for studies in controlling
mealy bug on cotton in the specified area
CCRI, Sakrand
Principal
Scientific Officer
Will be incharge of the project unit, design studies and supervise the unit
activities for the staff for studies on controlling mealy bug on cotton in the
specified area.
Assistant
Scientific Officer
Will work under the guidance of the unit incharge for studies in controlling
mealy bug on cotton in the specified area
ARI, Tando Jam
Scientific
Officers
Will work under the guidance of the unit incharge for studies in controlling
mealy bug on cotton in the specified area and at the model farm for controlling
all major cotton pests
Research Fellows Will work under the guidance of the unit incharge for studies in controlling
mealy bug on cotton in the specified area and at the model farm for controlling
all major cotton pests.
ARI, Quetta
Scientific
Officers
Will work under the guidance of the unit incharge for studies in controlling
mealy bug on cotton in the specified area
Research Fellows Will work under the guidance of the unit incharge and assist SOsfor studies in
controlling mealy bug on cotton in the specified area.
ARI, DI Khan
Scientific Will work under the guidance of the unit incharge for studies in controlling
71
Officers mealy bug on cotton in the specified area
Research Fellows Will work under the guidance of the unit incharge and assist SOs for studies in
controlling mealy bug on cotton in the specified area.
Scientific Officer Will do studies on biopesticides under guidance of the unit incharge for
controlling mealy bug on cotton, train farmers on application of the
biopesticides for controlling mealy bug on cotton
Scientific
Assistants
Will assist Scientific Officer in conducting studies on biopesticides
NIAB,
Faisalabad
Research
Associate
Will work under the guidance of the unit incharge for studies in controlling
mealy bug on cotton in the specified area, maintaining insect parasitoids and
predators cultures of the all cotton pests, assist AARI in providing natural
enemies cultures and conducting studies at the model farm at Bahawalpur
Scientific
Assistant
Will assist Scientific Officer in conducting studies on controlling mealy bug
and other cotton pests
Supporting Staff
Provided in each
project unit
Supporting staff provided in each project unit will assist the scientists and the
officers in execution of the project and conducting scientific experiments
72
Annex XV
Insectary site, needs and designs
In principle area of temperate climate offers the best location. Climatic area chosen should be
cool.
Location:
Consideration should be given to location away from immediate vicinity of agriculture area.
Minimum buffer zone is a kilometer to reduce chances of:
1. insecticidal drift from a crop
2. contaminant species of parasites or hosts
3. pest moving from insectary to crop area
Avoid locating an insectary where urban and industrial atmospheric contamination (smog) is a
problem
Greatest length of the building be arranged east-west direction
The wall on the sunny side be shaded by an over hanging roof or louvers and only the short west
wall is exposed to greatest heat source and can therefore be shaded by awnings ,louvers, or trees
Landscaping in the vicinity should exclude plant species which serve as hosts of phytophagous
insects
Building specifications
Local materials, construction regulations, and architecture decide the exterior features of the
permanent insectary
Temporary facilities are decided project wise and as the need basis
Primary insectary problem is climate control. Other aspects of design revolve around this
necessity regardless of permanent or temporary status of the insectary, therefore, appurtenances
such as coolers, louvers on windows and reflective roofs are expected to alter somewhat the
exterior of appearance of the insectary from the conventional buildings
Interior design
1. Main lab room with sufficient natural day light portioned into smaller rooms as needed
2. Floor plan: Minimum 20x40 ft to meet the basic requirement of mass rearing and some
experiments as per needs. Provide ample space for maneuvering bulky items such as carts
and racks, corridors are at least 4 feet wide and doors 3 feet wide. Concrete floor is a
source of dust from the scuffing of its surface. Painting and waxing are adequate if they
are maintained properly. Covering floor with linoleum or asphalt –vinyl tile is a
satisfactory solution. Windows should consist of rigidly fixed inner pane which is of
large dimension and free of cross bars and flush with interior wall surface and a
removable (for cleaning) but weather tight outer pane. Approximately 2 inches of space
73
of air space should separate the panes. . Ledges around windows, fixtures or ducts can be
eliminated by flush design.
3. Ceiling height recommended is 7 feet, this reduces costs of cooling and better
maintenance of room temperature control
4. For mealy bug and their parasitoids mass rearing the room temperature should be
maintained in the range 24-26 degree centigrade. It is the primary requirement. As cotton
growing areas are mostly dry and hot special attention is to be given to meet the basic
requirements of atmospheric humidity and temperature maintenance.
5. Sufficient provision of light with cool white fluorescent tubes, sufficient electrical
outlets below and at working table heights. Ensure cooling and heating provisions and
control on fluctuations of temperature. There should be provision of light traps in hall
ways, wash rooms, and anterooms to attract and escaped natural enemies or hosts and
reduce the chances of contaminations in rearing rooms. Since light traps will operate
constantly must be fixed against walls away from doors and windows.
6. 7. Provision of tap water and sink for washing dishes glass wares and other needs. Drains
should have dirt –tight covers. Toilets and lavatory facilities should be located away from
propagation rooms.
7. A small quarantine area for sorting and screening of field collections.
8. Small stores for equipment and temporary storage.
9. Staff room, office, Furnishing and equipment: In the beginning requirements are working
tables, racks storage cabinets, chairs stools insect rearing cages for insect adults, refrigerator,
microscopes, fans. Split AC , heaters ; miscellaneous (glass vials , Petri dishes, Plastic jars small
and large rearing dishes with covers tubes small and large, buckets, brushes, of different size.
Knife , hand lens, Sieve small and large as per need , large steel trays for rearing mealy bug and
predators, honey, cloth, rubber bands, parasitoids small dishes blower, blender, table lamps,
measuring cylinder , funnels , scissors, forceps, cavity blocks, spoons, steel can artificial diet
ingredients, etc.