DNA

DNA

How DNA was discovered

Scientists that determined Structure and Importance of DNA

1866 Gregor Mendel – offspring receive traits carried in a molecule

1869 Friedrich Meisher – isolated acid from cell nucleus – named it nucleic acid

1889 R.A. Altman-determined the chemical composition of the nucleic acid, DNA

Scientists that determined Structure and Importance of DNA

1919 Phoebus Levene – Determined the structure of a unit of DNA called a nucleotide, including the sugar composition of DNA

– first to propose that DNA was a polymer made of nucleotides

P = Phosphate S= 5C sugar B= Nitrogen base

1928 -Frederick GriffithTook one of the most important steps toward finding DNA by trying to find better ways to fight pneumonia. Working with bacteria that caused pneumonia, he discovered transformation

Transformation

Process by which one strain of bacteria is changed by a gene or genes from another strain of bacteria

Griffith isolated two different strains of the same bacterial species, but only one of the strains caused pneumonia.

The disease-causing bacteria (S strain) grew into smooth colonies on culture plates, whereas the harmless bacteria (R strain) produced colonies with rough edges.

When Griffith injected mice with disease-causing bacteria, the mice developed pneumonia and died.

When he injected mice with harmless bacteria, the mice stayed healthy.

Perhaps the S-strain bacteria produced a toxin that made the mice sick? To find out, Griffith ran a series of experiments.

First, Griffith took a culture of the S strain, heated the cells to kill them, and then injected the heat-killed bacteria into laboratory mice.

The mice survived, suggesting that the cause of pneumonia was not a toxin produced by these disease-causing bacteria.

In Griffith’s next experiment, he mixed the heat-killed, S-strain bacteria with live, harmless bacteria from the R strain and injected the mixture into laboratory mice.

  The injected mice developed pneumonia, and many died.

The lungs of these mice were filled with the disease-causing bacteria. How could that happen if the S strain cells were dead?

Griffith reasoned that some chemical factor that could change harmless bacteria into disease-causing bacteria was transferred from the heat-killed cells of the S strain into the live cells of the R strain.

He called this process transformation, because one type of bacteria had been changed permanently into another.

Because the ability to cause disease was inherited by the offspring of the transformed bacteria, Griffith concluded that the transforming factor had to be a gene.

R

1944-Oswald AveryA group of scientists at the Rockefeller Institute in New York, led by the Canadian biologist Oswald Avery, wanted to determine which molecule in the heat-killed bacteria was most important for transformation.

Avery and his team extracted a mixture of various molecules from the heat-killed bacteria and treated this mixture with enzymes that destroyed proteins, lipids, carbohydrates, and some other molecules, including the nucleic acid RNA.

Transformation still occurred.

When DNA was destroyed, he discovered that transformation did not occurConclusion: Genes are made from DNA

1949-Erwin ChargaffWhen studying the chemistry of DNA, he noticed each sample of DNA always contained equal amounts of adenine (A) and thymine (T), and equal amounts of cytosine (C) and guanine (G)

Rules: Adenine binds to Thymine (A to T)and

Cytosine bind to Guanine (C to G)

Hershey – Chase ExperimentIn 1952, the work of two scientists, Hershey and Chase, with bacteriophages confirmed Avery’s results, convincing many scientists that DNA was the genetic material found in genes—not just in viruses and bacteria, but in all living cells.

Hershey and Chase studied viruses—nonliving particles that can infect living cells.

The kind of virus that infects bacteria is known as a bacteriophage, which means “bacteria eater.”

Bacteriophages– 1. attach to the surface of the bacterial cell and

injects its genetic information into it.

– 2. genes act to produce many new bacteriophages, which gradually destroy the bacterium.

– 3. the cell splits open and hundreds of new viruses burst out.

–

The Hershey-Chase ExperimentThe bacteriophage was composed of a DNA core and a protein coat.

They wanted to determine which part of the virus—the protein coat or the DNA core—entered the bacterial cell.

Their results would either support or disprove

Avery’s finding that genes were made of DNA.

The Hershey-Chase Experiment– Hershey and Chase grew viruses in

cultures containing radioactive isotopes of phosphorus-32 (P-32) sulfur-35 (S-35)

The Hershey-Chase Experiment– Since proteins contain almost no

phosphorus and DNA contains no sulfur, these radioactive substances could be used as markers, enabling the scientists to tell which molecules actually entered the bacteria and carried the genetic information of the virus.

The Hershey-Chase Experiment– If they found radioactivity from S-35 in the

bacteria, it would mean that the virus’s protein coat had been injected into the bacteria.

– If they found P-32 then the DNA core had been injected.

The Hershey-Chase Experiment

– The two scientists mixed the marked viruses with bacterial cells, waited a few minutes for the viruses to inject their genetic material, and then tested the bacteria for radioactivity.

Hershey & Chase

The Hershey-Chase Experiment– Nearly all the radioactivity in the bacteria was

from phosphorus P-32, the marker found in DNA.

– Hershey and Chase concluded that the genetic material of the bacteriophage was DNA, not protein.

• http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::600::480::/sites/dl/free/0077290801/788005/Hershey_and_Chase_Experiment.swf::Hershey+and+Chase+Experiment

1952- Rosalind Franklin

Studied DNA using X-ray diffractionWas able to show a picture of the structure of DNA, but was not able to reveal the actual make-up of DNA

Franklin’s X-Rays– X-ray diffraction revealed an X-shaped pattern

showing that the strands in DNA are twisted around each other like the coils of a spring.

– The angle of the X-shaped pattern suggested that there are two strands in the structure.

– Other clues suggest that the nitrogenous bases are near the center of the DNA molecule.

Solving the Structure of DNA

– Clues in Franklin’s X-ray pattern would enable the building of a model that explained the specific structure and chemical properties of DNA.

DNA Structure

–DNA specifies how to assemble proteins, which are needed to regulate the various functions of each cell, without variation from cell to cell. The structure is key.

1953-Watson & Crick

They built three-dimensional models of the molecule and introduced the structure of DNAUsed Franklin’s work and were able to determine that DNA had 2 strands that were wrapping around each other

Each strand was in the shape of a helixThe structure of DNA is now known to be a double helix.Watson & Crick also determined how the strands were connected

The Double-Helix Model

–

– 1.accounted for Franklin’s X-ray pattern

– 2. explains Chargaff’s rule of base pairing and how the two strands of DNA are held together.

DNADeoxyribonucleic Acid

de- away from

The Components of DNA

– Nucleic acids are long, slightly acidic molecules originally identified in cell nuclei.

– DNA is a nucleic acid made up of monomers called nucleotides joined into long strands or chains by covalent bonds.

Nucleotides are made ofA phosphate groupA nitrogenous baseA 5-carbon sugar deoxyribose

Nitrogenous Bases and Covalent Bonds

– The nucleotides in a strand of DNA are joined by covalent bonds formed between their sugar and phosphate groups.

Nitrogenous Bases and Covalent Bonds

The nucleotides can be joined together in any order, meaning that any sequence of bases is possible.

4 Different Nitrogenous bases Make Up DNAAdenine ACytosine CGuanine GThymine T

Nitrogenous Bases and Covalent Bonds

– The nitrogenous bases stick out sideways from the nucleotide chain.

Forming the Double HelixComposed of sugar-phosphate strands ( two of them)The strands are held together by hydrogen bonds

Hydrogen Bonding– Watson and Crick

discovered that relatively weak chemical forces called hydrogen bonds could form between certain nitrogenous bases, providing just enough force to hold the two DNA strands together, but would allow the two strands of the helix to separate, a necessary property.

–

Two hydrogen bonds form between Adenine and thymine.

Three hydrogen bonds form between Cytosine & Guanine

Adenine & Guanine are called purines, they have a double ring structure.

Cytosine and Thymine are called pyrimidines, they have a single ring structure.

Anti-Parallel StrandsIn the double-helix model, the two strands of DNA are “antiparallel”—they run in opposite directions.

This arrangement enables the nitrogenous bases on both strands to come into contact at the center of the molecule.

It also allows each strand of the double helix to carry a sequence of nucleotides, arranged almost like letters in a four-letter alphabet.

Base-PairingWatson and Crick’s model showed that hydrogen bonds could create a nearly perfect fit between nitrogenous bases along the center of the molecule.These bonds would form only between certain base pairs—adenine with thymine, and guanine with cytosine.

This nearly perfect fit between A–T and G–C nucleotides is known as base pairing, and is illustrated in the figure.

Watson and Crick realized that base pairing explained Chargaff’s rule. It gave a reason why [A] = [T] and [G] = [C].

For every adenine in a double-stranded DNA molecule, there had to be exactly one thymine. For each cytosine, there was one guanine.

The Role of DNA– The DNA that makes up genes must be capable

of storing, copying, and transmitting the genetic information in a cell.

– These three functions are analogous to the way in which you might share a treasured book, as pictured in the figure.

Storing Information– The foremost job of DNA, as the molecule of heredity, is

to store information.

– Genes control patterns of development, which means that the instructions that cause a single cell to develop into an oak tree, a sea urchin, or a dog must somehow be written into the DNA of each of these organisms.

Copying Information– Before a cell divides, it must make a

complete copy of every one of its genes, similar to the way that a book is copied.

Copying Information– To many scientists, the most puzzling aspect

of DNA was how it could be copied.

– Once the structure of the DNA molecule was discovered, a copying mechanism for the genetic material was soon put forward.

Transmitting Information– When a cell divides, each daughter cell must

receive a complete copy of the genetic information.

– Careful sorting is especially important during the formation of reproductive cells in meiosis.

– The loss of any DNA during meiosis might mean a loss of valuable genetic information from one generation to the next.

DNA Replication

Copying the Code– Base pairing in the double helix explains how

DNA can be copied, or replicated, becauseeach strand of the double helix has all the information needed to reconstruct the other half .

–

DNA ReplicationProcess through which DNA is copied or duplicated

This happens during the Synthesis Phase (S phase) of the cell cycle

Occurs to copy the genetic information from one cell to another to produce a new cellEnzymes separate the two strands from the double helix and then “synthesize” two new strands in order to get two copies of the double helix.Each strand of the double helix of DNA serves as a template, or model, for the new strand.

Because each strand can be used to make the other strand, the strands are said to be complementary.

The role of enzymes

The principal enzyme involved in DNA replication is called DNA polymerase.

DNA polymerase is an enzyme that joins individual nucleotides to produce a new strand of DNA.

DNA polymerase also “proofreads” each new DNA strand, ensuring that each molecule is a perfect copy of the original.

The Role of Enzymes

– An enzyme called helicase first “unzips” a molecule of DNA by breaking the hydrogen bonds between base pairs and unwinds the two strands of the molecule, allowing two replication forks to form. The region where DNA has unzipped is called a replication bubble.

• Each strand then serves as a template for the attachment of complementary bases.

The Replication Process

– As each new strand forms, new bases are added following the rules of base pairing.

– If the base on the old strand is adenine, then thymine is added to the newly forming strand.

– Likewise, guanine is always paired to cytosine.

DNA replication results in two DNA molecules each with one new strand and one original strand

5’ vs 3’ end of DNA

The carbon atoms in the sugar can be numbered from 1 to 5. Carbon #1 starts at the nitrogenous base and C#5 is attached to the phosphate group.

5’ vs 3’ end of DNA

• The end of the • molecule that has• the phosphate • group attached to• Carbon #5 is called• the 5’ (five prime)• end of DNA.

5’ vs 3’ end of DNA

In this picture, C#3is attached to a hydroxylgroup ; this is the 3’ end of the molecule; strands run antiparallel from 5’ to 3’ and from 3’ to 5’

Leading or lagging strand?

• When direction of replication occurs from the 5’ to the 3’ end of the original strand, this new strand is called the lagging strand.

• At the same time, the original strand undergoing replication from its 3’ to 5’end is called the leading strand.

Lagging

leading

Telomeres

– The tips of chromosomes are known as telomeres.

– The ends of DNA molecules, located at the telomeres, are particularly difficult to copy.

– Over time, DNA may actually be lost from telomeres each time a chromosome is replicated.

– An enzyme called telomerase compensates for this problem by adding short, repeated DNA sequences to telomeres, lengthening the chromosomes slightly and making it less likely that important gene sequences will be lost from the telomeres during replication.

DNA SequenceThe sequence of DNA runs complementary on each of the two strandsEx> For each Adenine (A) on one strand of DNA there will be one complementary Thymine (T). For each Guanine there will be a complementary Cytosine.

FIRST STRAND:ATGCCTAAGGCACGGTAAA

COMPLEMENTARY STRANDTACGGATTCCGTGCCATTT

• It is important to note that chromosomes are not entirely made up of DNA. In fact, there is more protein than DNA in eukaryotic cells. Remember that chromosomes are made up of a material called chromatin.

Prokaryotic DNA Replication

– Prokaryotic cells have a single, circular DNA molecule in the cytoplasm, containing the cell’s genetic information.

Prokaryotic DNA Replication

– DNA replication starts when regulatory proteins bind to a single starting point on the chromosome, triggering replication in two directions until the entire chromosome is copied.

Eukaryotic DNA ReplicationEukaryotic cells can have up to 1000 times more DNA, and nearly all of the DNA of eukaryotic cells is found in the nucleus.

– Eukaryotic chromosomes are generally much bigger than those of prokaryotes, and replication may begin at dozens or even hundreds of places on the DNA molecule, proceeding in both

directions until each chromosome

is completely copied.

Eukaryotic DNA Replication

Eukaryotic DNA Replication

– The two copies remain together until prophase of mitosis, when two chromatids in each chromosome become clearly visible.They separate from each other in anaphase of mitosis, producing two cells, each with a complete set of genes coded in DNA.

RNA

DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to understand it.

RNA Ribonucleic acid- a nucleic acid that consists of a long

chain of nucleotides; it is the principle molecule that carries out the instructions coded in DNA

RNA is a nucleic acid that contains 5-C sugar ribose

RNA vs. DNA1. RNA contains ribose instead of deoxyribose like

DNA.

2. RNA contains uracil instead of thymine (a pyrimidine)

3. RNA is a single strand instead of a double-strand. RNA is complementary to one DNA strand.

The Role of RNA

Genes contain coded DNA instructions that tell cells how to build proteins.

The first step in decoding these genetic instructions is to copy part of the base sequence from DNA into RNA.

RNA uses the base sequence copied from DNA to direct the production of proteins.

A master plan has all the information needed to construct a building. Builders never bring a valuable master plan to the building site, where it might be damaged or lost. Instead, they prepare inexpensive, disposable copies of the master plan called blueprints.

Similarly, the cell uses DNA “master plans” to prepare RNA “blueprints.” The DNA molecule stays safely in the cell’s nucleus, while RNA molecules go to the protein-building sites in the cytoplasm—the ribosomes.

Function of RNA RNA is a disposable copy of a segment of DNA, a

working copy of a single gene.

RNA has many functions, but most RNA molecules are involved in protein synthesis only.

RNA controls the assembly of amino acids into proteins. Each type of RNA molecule specializes in a different aspect of this job.

Types of RNA

The three main types of RNA are messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).

Messenger RNA (mRNA)

Carries copies of the instructions for assembling amino acids into proteins from DNA to other parts of the cell.

Ribosomal RNA (rRNA) Proteins are assembled on

ribosomes, small organelles composed of two subunits.

These ribosome subunits are made up of several ribosomal RNA (rRNA) molecules and as many as 80 different proteins.

Ribosomal RNA (rRNA)

Ribosomal RNA (rRNA) aids in the assembly of proteins and also makes up part of the ribosome.

Transfer RNA (tRNA)

Transfer RNA (tRNA) molecules transfer each amino acid to the ribosome as it is specified by the coded messages in mRNA to build proteins.

RNA SYNTHESIS

Segments of DNA serve as templates, which produce complementary RNA molecules.

Transcription

Transcription: The process by which RNA molecules are made; part of the nucleotide sequence of a DNA molecule is copied into RNA

Transcription

During transcription, segments of DNA serve as templates or patterns to produce complementary RNA molecules.

The base sequences of the transcribed RNA complement the base sequences of the template DNA.

Prokaryotes Vs. Eukaryotes In prokaryotes, RNA synthesis and protein

synthesis take place in the cytoplasm.

In eukaryotes, RNA is produced in the cell’s nucleus and then moves to the cytoplasm to play a role in the production of proteins. Our focus will be on transcription in eukaryotic cells.

RNA Polymerase Transcription requires an enzyme, known as RNA

polymerase, that is similar to DNA polymerase.

RNA polymerase binds to DNA during transcription and separates the DNA strands.

RNA Polymerase RNA polymerase then uses one strand of DNA as

a template from which to assemble nucleotides into a complementary strand of RNA.

DNA strand: AACTTTGAG

Complementary mRNA strand: UUGAAACUC

TRANSCRIPTION EXAMPLE:

Example :

DNA: AACTGCTCGTATACG

mRNA: UUGACGAGCAUAUGC

Promoters RNA polymerase binds only to promoters,

regions of DNA that have specific base sequences.

Promoters signal RNA polymerase exactly where to start making RNA.

Similar signals in DNA cause transcription to stop when a new RNA molecule is completed.

RNA EDITING

RNA molecules sometimes require bits and pieces to be cut out of them before they can go into action.

The portions of mRNA that are cut out and discarded are called introns.

RNA EDITING

In eukaryotes, introns are taken out of pre-mRNA molecules while they are still in the nucleus.

The remaining pieces of mRNA, known as exons, are then spliced back together to form the final mRNA.

Biologists don’t have a complete answer as to why cells use energy to make a large RNA molecule and then discard parts of that molecule .

Some pre-mRNA molecules may be cut and spliced in different ways in different tissues, making it possible for a single gene to produce several different forms of RNA.

Introns and exons may also play a role in evolution, making it possible for very small changes in DNA sequences to have dramatic effects on how genes affect cellular function.

Genetic Code The sequence of amino acids

that give a person his or her genetic information.

The Genetic Code

The genetic code is read three “letters” at a time, so that each “word” is three bases long and corresponds to a single amino acid.

The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to RNA. This transcribed information contains a code for making proteins.

Proteins are made by joining amino acids together into long chains, called polypeptides.

As many as 20 different amino acids are commonly found in polypeptides.

The specific amino acids in a polypeptide, and the order in which they are joined, determine the properties of different proteins.

The order of this sequence of amino acids is given in the DNA.

The sequence of amino acids influences the shape of the protein, which in turn determines its function.

RNA contains four different bases: adenine, cytosine, guanine, and uracil.

These bases form a “language,” or genetic code, with just four “letters”: A, C, G, and U.

Each three-letter “word” in mRNA is known as a codon.

A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain.

Each amino acid can be found by reading the mRNA sequence complementary to DNA.

Every group of three nucleotides gives one amino acid.

How to Read Codons Because there are four

different bases in RNA, there are 64 possible three-base codons (4 × 4 × 4 = 64) in the genetic code.

This circular table shows the amino acid to which each of the 64 codons corresponds. To read a codon, start at the middle of the circle and move outward.

Most amino acids can be specified by more than one codon.

For example, six different codons—UUA, UUG, CUU, CUC, CUA, and CUG—specify leucine. But only one codon—UGG—specifies the amino acid tryptophan.

Examples: Example 1: GGA codes for glycineExample 2: AGU codes for serineExample 3: UGG codes for tryptophan

mRNA : AAACAGGCA

Codons: AAA CAG GCA

Examples:

Example 1: mRNA: AUGGUGGCCCCUCODONS:

_______________________________

Example 2: mRNA: UUUGUGGGCAAGCUA CODONS: ______________________________

Start and Stop Codons The genetic code

has punctuation marks.

The methionine codon AUG serves as the initiation, or “start,” codon for protein synthesis.

Start and Stop Codons

Following the start codon, mRNA is read, three bases at a time, until it reaches one of three different “stop” codons, called terminators. Three codons serve as stop signals. These three codons-UAA, UAG, and UGA signify the end of a genetic message just like a period signifies the end of a sentence.

A system to read the messages that are coded in genes and transcribed into RNA is needed. Rather than reading the bases one at a time, as if the code were a language with just four words, reading bases as individual letters then can be combined to spell longer words.

Translation

The sequence of nucleotide bases in mRNA gives the order amino acids should be joined to produce a polypeptide.

In order to build proteins, this sequence of mRNA must be translated into this sequence of amino acids.

The forming of a protein requires the folding of one or more polypeptide chains.

Ribosomes use this sequence of codons in mRNA to assemble amino acids into polypeptide chains.

The decoding of an mRNA message into a protein is a process known as translation.

Steps in Translation

Messenger RNA undergoes transcription in the nucleus and then enters the cytoplasm for translation.

A ribosome attaches to the mRNA molecule in the cytoplasm.

As the ribosome reads each codon of mRNA, it directs tRNA to bring the specified amino acid into the ribosome.

Each tRNA molecule carries just one kind of amino acid.

Each tRNA molecule has three unpaired bases, collectively called the anticodon—which is complementary to one mRNA codon.

–

For example, the tRNA molecule for methionine has the anticodon UAC, which pairs with the methionine codon, AUG.

One at a time, the ribosome then attaches each amino acid to the growing chain.

The ribosome brings a second tRNA molecule for the next codon to the next binding site.

If that next codon was UUC, a tRNA molecule with an AAG anticodon would bring the amino acid phenylalanine into the ribosome.

Steps in Translation

The ribosome helps form a peptide bond between the first and second amino acids—methionine and phenylalanine.

At the same time, the bond holding the first tRNA molecule to its amino acid is broken and tRNA is released.

Steps in Translation

The ribosome then moves to the third codon, where tRNA brings it the amino acid specified by the third codon.

Steps in Translation

The polypeptide chain continues to grow until the ribosome reaches a “stop” codon on the mRNA molecule.

When the ribosome reaches a stop codon, it releases both the newly formed polypeptide and the mRNA molecule, completing the process of translation.

The Role of rRNA in Translation Ribosomes are composed of roughly 80

proteins and three or four different rRNA molecules.

These rRNA molecules help hold ribosomal proteins in place and help locate the beginning of the mRNA message.

They may even carry out the chemical reaction that joins the amino acids together.

Most genes contain instructions for assembling proteins.

Many proteins are enzymes, which catalyze and regulate chemical reactions. They also have specific functions.

For example, a gene that codes for an enzyme to produce pigment can control the color of a flower. Another gene produces proteins that regulate patterns of tissue growth in a leaf. Yet another may trigger the female or male pattern of development in an embryo.

Proteins are microscopic tools, each specifically designed to build or operate a component of a living cell.

The Molecular Basis of Heredity

The central dogma of molecular biology is that information is transferred from DNA to RNA to protein.

Molecular biology seeks to explain living organisms by studying them at the molecular level, using molecules like DNA and RNA.

Gene expression Gene expression is the way in which DNA,

RNA, and proteins are involved in putting genetic information into action in living cells.

The cell uses the sequence of bases in DNA as a template for making mRNA.

The codons of mRNA specify the sequence of amino acids in a protein, which play a key role in producing an organism’s traits.

Near-universal nature of the genetic code

Although some organisms show slight variations in the amino acids assigned to particular codons, the code is always read three bases at a time and in the same direction.

Despite their enormous diversity in form and function, living organisms display remarkable unity at life’s most basic level, the molecular biology of the gene.

Given the following DNA sequence, provide the complementary DNA sequence, mRNA sequence, tRNA sequence. Translate the mRNA codons when finished.

ATCTTATCTAATCTATATAGC

PROTEIN SYNTHESIS Summary

1. DNA serves as a template for RNA production in the nucleus

2. RNA moves from the nucleus to the cytoplasm

3. mRNA attaches to a ribosome

4. tRNA carries a specific amino acid to mRNA

5. amino acids are bonded together

Mutations

amiThe sequence of bases in DNA are like the letters of a coded message. If a few of those letters changed accidentally, the message would be altered. This would affect genes and the polypeptides for which they code.

What are mutations?

Mutations are heritable changes in genetic information.

Now and then cells make mistakes in copying their own DNA, inserting the wrong base or even skipping a base as a strand is put together.

These variations are called mutations, from the Latin word mutare, meaning “to change.”

Types of Mutations

1. Gene mutations– produce changes in a single gene

2. Chromosomal mutations– produce changes in whole

chromosomes

Gene MutationsMutations that involve changes in one or a few nucleotides are known as point mutations because they occur at a single point in the DNA sequence. They generally occur during replication.

If a gene in one cell is altered, the alteration can be passed on to every cell that develops from the original one.

Point MutationsPoint mutations include substitutions, insertions, and deletions.

Substitutions In a substitution, one base is changed to a different base.

Substitutions usually affect no more than a single amino acid, and sometimes they have no effect at all.

Substitutions In this example, the base cytosine is replaced by the base thymine, resulting in a change in the mRNA codon from CGU (arginine) to CAU (histidine).

– However, a change in the last base of the codon, from CGU to CGA for example, would still specify the amino acid arginine.

Insertions and Deletions Insertions and deletions are point mutations in which one base is inserted or removed from the DNA sequence.

If a nucleotide is added or deleted, the bases are still read in groups of three, but now those groupings shift in every codon that follows the mutation.

Insertions and Deletions Insertions and deletions are also called frameshift mutations because they shift the “reading frame” of the genetic message. Frameshift mutations can change every amino acid that follows the point of the mutation and can alter a protein so much that it is unable to perform its normal functions.

Chromosomal Mutations Chromosomal mutations involve changes in the number or structure of chromosomes.

These mutations can change the location of genes on chromosomes and can even change the number of copies of some genes.

– There are four types of chromosomal mutations: deletion, duplication, inversion, and translocation.

Types of Chromosomal Mutations

DeletionDuplicationInversionTranslocation

DeletionDeletion involves the loss of all or part of a chromosome.

DuplicationDuplication produces an extra copy of all or part of a chromosome.

InversionInversion reverses the direction of parts of a chromosome.

TranslocationTranslocation occurs when part of one chromosome breaks off and attaches to another.

Effects of MutationsHow do mutations affect genes?

The effects of mutations on genes vary widely. Some have little or no effect; and some produce beneficial variations. Some negatively disrupt gene function.

Mutations often produce proteins with new or altered functions that can be useful to organisms in different or changing environments.

Effects of MutationsGenetic material can be altered by natural events or by artificial means.

The resulting mutations may or may not affect an organism.

Some mutations that affect individual organisms can also affect a species or even an entire ecosystem.

Effects of Mutations

Many mutations are produced by errors in genetic processes.

For example, some point mutations are caused by errors during DNA replication.

The cellular machinery that replicates DNA inserts an incorrect base roughly once in every 10 million bases.

Small changes in genes can gradually accumulate over time.

Effects of Mutations

Stressful environmental conditions may cause some bacteria to increase mutation rates.

This can actually be helpful to the organism, since mutations may sometimes give such bacteria new traits, such as the ability to consume a new food source or to resist a poison in the environment.

Mutagens Some mutations arise from mutagens, chemical or physical agents in the environment.

Chemical mutagens include certain pesticides, a few natural plant alkaloids, tobacco smoke, and environmental pollutants.

Physical mutagens include some forms of electromagnetic radiation, such as X-rays and ultraviolet light.

Mutagens If these mutagens interact with DNA, they can produce mutations at high rates.

Some compounds interfere with base-pairing, increasing the error rate of DNA replication.

Others weaken the DNA strand, causing breaks and inversions that produce chromosomal mutations.

Cells can sometimes repair the damage; but when they cannot, the DNA base sequence changes permanently.

Harmful and Helpful Mutations

Whether a mutation is negative or beneficial depends on how its DNA changes relative to the organism’s situation.

Mutations are often thought of as negative because they disrupt the normal function of genes.

However, without mutations, organisms cannot evolve, because mutations are the source of genetic variability in a species.

Harmful Effects Some of the most harmful mutations are those that dramatically change protein structure or gene activity.

The defective proteins produced by these mutations can disrupt normal biological activities, and result in genetic disorders.

Some cancers, for example, are the product of mutations that cause the uncontrolled growth of cells.

Harmful Effects

Sickle cell disease is a disorder associated with changes in the shape of red blood cells. Normal red blood cells are round. Sickle cells appear long and pointed.

Sickle cell disease is caused by a point mutation in one of the polypeptides found in hemoglobin, the blood’s principal oxygen-carrying protein.

Among the symptoms of the disease are anemia, severe pain, frequent infections, and stunted growth.

Beneficial Effects Some of the variation produced by mutations can be highly advantageous to an organism or species.

Mutations often produce proteins with new or altered functions that can be useful to organisms in different or changing environments.

For example, mutations have helped many insects resist chemical pesticides.

Some mutations have enabled microorganisms to adapt to new chemicals in the environment.

Beneficial Effects Plant and animal breeders often make use of “good” mutations.

For example, when a complete set of chromosomes fails to separate during meiosis, the gametes that result may produce triploid (3N) or tetraploid (4N) organisms.

The condition in which an organism has extra sets of chromosomes is called polyploidy.

Beneficial Effects Polyploid plants are often larger and stronger than diploid plants.

Important crop plants—including bananas and limes—have been produced this way.

Polyploidy also occurs naturally in citrus plants, often through spontaneous mutations.

GeneA section of DNA that carries or contains hereditary information

A tiny bacterium contains more than 4000 genes. Most of its genes code for proteins that do everything from building cell walls to breaking down food. E. coli does not use all 4000-plus volumes in its genetic library at the same time.

Prokaryotic Gene Regulation

DNA-binding proteins in prokaryotes regulate genes by controlling transcription.Bacteria and other prokaryotes do not need to transcribe all of their genes at the same time.

Prokaryotic Gene Regulation

To conserve energy and resources, prokaryotes regulate their activities, producing only those genes necessary for the cell to function.

Ex> it would be wasteful to produce enzymes needed to make a molecule that is readily available from the environment; by regulating gene expression, bacteria respond to changes in the environment—the presence or absence of these nutrients.

Prokaryotic Gene Regulation

Some of these regulatory proteins help switch genes on, while others turn genes off.

Prokaryotic Gene Regulation

The genes in bacteria are organized into operons, a group of genes that are regulated together that usually have related functions.

Prokaryotic Gene Regulation

For example, the 4288 genes that code for proteins in E. coli include a cluster of 3 genes that must be turned on together before the bacterium can use the sugar lactose as a food.

These three lactose genes in E. coli are called the lac operon.

The Lac Operon

Lactose is a compound made up of two simple sugars, galactose and glucose.

To use lactose for food, the bacterium must transport lactose across its cell membrane and then break the bond between glucose and galactose. These tasks are performed by proteins coded for by the genes of the lac operon.

The Lac Operon

If the bacterium grows in a medium where lactose is the only food source, it must transcribe these genes and produce these proteins.

If grown on another food source, such as glucose, it would have no need for these proteins. The lac genes are turned off by proteins that bind to DNA and block transcription.

Promoters and Operators On one side of the operon’s three genes are two regulatory regions.

The first is a promoter (P), which is a site where RNA-polymerase can bind to begin transcription.

– The other region is called the operator (O), which is where a DNA-binding protein known as the lac repressor can bind to DNA.

Promoters and Operators

The other region is called the operator (O), which is where a DNA-binding protein known as the lac repressor can bind to DNA.

The Lac Repressor Blocks Transcription

When lactose is not present, the lac repressor binds to the O region, blocking the RNA polymerase from reaching the lac genes to begin transcription.

The Lac Repressor Blocks Transcription

The binding of the repressor protein switches the operon “off” by preventing the transcription of its genes.

Lactose Turns the Operon “On” The lac repressor protein has a binding site for lactose.

When lactose is present, it attaches to the lac repressor and changes the shape of the repressor protein in a way that causes it to fall off the operator.

Lactose Turns the Operon “On” With the repressor no longer bound to the O site, RNA polymerase can bind to the promoter and transcribe the genes of the operon.

In the presence of lactose, the operon is automatically switched on.

Eukaryotic Gene Regulation

By binding DNA sequences in the regulatory regions of eukaryotic genes,transcription factors control the expression of those genes.

Eukaryotic Gene Regulation

One interesting feature of a typical eukaryotic gene is the TATA box, a short region of DNA containing the sequence TATATA or TATAAA that is usually found just before a gene.

Eukaryotic Gene Regulation

– The TATA box binds a protein that helps position RNA polymerase by marking a point just before the beginning of a gene.

Transcription Factors Gene expression in eukaryotic cells can be regulated at a number of levels.

By binding DNA sequences in the regulatory regions of eukaryotic genes, DNA-binding proteins known as transcription factors control the expression of those genes at the transcription level.

Transcription Factors Transcription factors can:

1. enhance transcription by opening up tightly packed chromatin

2. help attract RNA polymerase3. block access to certain genes

In most cases, multiple transcription factors must bind before RNA polymerase is able to attach to the promoter region and start transcription.

Transcription Factors Gene promoters have multiple binding sites for transcription factors, each of which can influence transcription.

Certain factors activate many genes at once, dramatically changing patterns of gene expression in the cell.

Transcription Factors

Other factors form only in response to chemical signals.

Eukaryotic gene expression can also be regulated by many other factors, including the exit of mRNA molecules from the nucleus, the stability of mRNA, and even the breakdown of a gene’s protein products.

Gene regulation in eukaryotes is more complex than in prokaryotes

Cell specialization requires genetic specialization, yet all of the cells in a multicellular organism carry the same genetic code in their nucleus. Complex gene regulation in eukaryotes is what makes specialization possible.

RNA Interference

For years, biologists wondered why cells contain lots of small RNA molecules, only a few dozen bases long, that don’t belong to any of the major groups of RNA (mRNA, tRNA, or rRNA).

These small RNA molecules play a powerful role in regulating gene expression by interfering with mRNA.

RNA Interference After they are produced by transcription, the small interfering RNA molecules fold into double-stranded hairpin loops.

An enzyme called the “Dicer” enzyme cuts, or dices, these double-stranded loops into microRNA (miRNA), each about 20 base pairs in length. The two strands of the loops then separate.

RNA InterferenceOne of the miRNA pieces attaches to a cluster of proteins to form what is known as a silencing complex.

The silencing complex binds to and destroys any mRNA containing a sequence that is complementary to the miRNA.

RNA InterferenceThe miRNA sticks to certain mRNA molecules and stops them from passing on their protein-making instructions.

RNA Interference Blocking gene expression by means of an miRNA silencing complex is known as RNA interference (RNAi).

RNA Interference At first, RNA interference (RNAi) seemed to be a rare event, found only in a few plants and other species. It is now clear that RNA interference is found throughout the living world and that it even plays a role in human growth and development.

The Promise of RNAi Technology

The discovery of RNAi has made it possible for researchers to switch genes on and off at will, simply by inserting double-stranded RNA into cells.

The Dicer enzyme then cuts this RNA into miRNA, which activates silencing complexes.

The Promise of RNAi Technology

RNAi blocks the expression of genes producing mRNA complementary to the miRNA.

RNAi technology is a powerful way to study gene expression in the laboratory. It also holds the promise of allowing medical scientists to turn off the expression of genes from viruses and cancer cells, and it may provide new ways to treat and perhaps even cure diseases.

Genetic Control of Development

Master control genes are like switches that trigger particular patterns ofdevelopment and differentiation in cells and tissues.

Genetic Control of Development

Regulating gene expression is especially important in shaping the way a multicellular organism develops because each of the specialized cell types found in the adult originates from the same fertilized egg cell.

Genetic Control of Development

As an embryo develops, different sets of genes are regulated by transcription factors and repressors.

Gene regulation helps cells undergo differentiation, becoming specialized in structure and function.

–

Homeotic Genes Edward B. Lewis was the first to show that a specific group of genes controls the identities of body parts in the embryo of the common fruit fly.

Lewis found that a mutation in one of these genes actually resulted in a fly with a leg growing out of its head in place of an antenna!

From Lewis’s work it became clear that a set of master control genes, known as homeotic genes, regulates organs that develop in specific parts of the body.

Homeobox and Hox Genes Molecular studies of homeotic genes show that they share a very similar 130-base DNA sequence, which was given the name homeobox.

Homeobox genes code for transcription factors that activate other genes that are important in cell development and differentiation.

Homeobox genes are expressed in certain regions of the body, and they determine factors like the presence of wings or legs.

Homeobox and Hox Genes

In flies, a group of homeobox genes known as Hox genes are located side by side in a single cluster.

Hox genes determine the identities of each segment of a fly’s body. They are arranged in the exact order in which they are expressed, from anterior to posterior.

Homeobox and Hox Genes

In this figure, the colored areas on the fly show the approximate body areas affected by genes of the corresponding colors.

A mutation in one of these genes can completely change the organs that develop in specific parts of the body.

Homeobox and Hox Genes

Clusters of Hox genes exist in the DNA of other animals, including the mouse shown, and humans.

These genes are arranged in the same way—from head to tail.

Homeobox and Hox Genes

The colored areas on the mouse show the approximate body areas affected by genes of the corresponding colors.

The function of Hox genes in other animals seems to be almost the same as it is in fruit flies: They tell the cells of the body how to differentiate as the body grows.

Homeobox and Hox Genes

Nearly all animals, from flies to mammals, share the same basic tools for building the different parts of the body.

Master control genes—genes that control development—are like switches that trigger particular patterns of development and differentiation in cells and tissues.

–

Homeobox and Hox Genes

Common patterns of genetic control exist because all these genes have descended from the genes of common ancestors.

Environmental Influences In prokaryotes and eukaryotes, environmental factors like temperature, salinity, and nutrient availability can influence gene expression.

For example, the lac operon in E. coli is switched on only when lactose is the only food source in the bacteria’s environment.

Environmental Influences

Metamorphosis is another example of how organisms can modify gene expression in response to their environment.

Metamorphosis involves a series of transformations from one life stage to another, such as the transformation of a tadpole to an adult bullfrog. It is typically regulated by a number of external (environmental) and internal (hormonal) factors.

Environmental Influences

As organisms move from larval to adult stages, their body cells differentiate to form new organs.

At the same time, old organs are lost through cell death.

Environmental Influences

For example, under less than ideal conditions—a drying pond, a high density of predators, low amounts of food—tadpoles may speed up their metamorphosis.

The speed of metamorphosis is determined by various environmental changes that are translated into hormonal changes, with the hormones functioning at the molecular level.