Post on 28-Dec-2015
Must KnowsUnit 5 – DNA Objectives
Describe the location of DNA inside the cell and explain the importance of its location. How many chromosomes are found in a human cell and what are the two types. Explain the structure of chromosomes related to
chromatidscentromeresDouble helixHomology (parents)DNA
Describe structure and function of the DNA molecule.
BackboneNucleotides Complementary base pairing
Summarize the process of DNA replication. How does the structure make it easier for it to undergo self
replication? Explain the role of enzymes in the process of replication. Explain how the arrangement of nucleotides in a DNA molecule relates to that arrangement of amino acids in
a protein.
“what are the two types?”
Sex Chromosomes – Controls the production of proteins that determine whether someone is Male or Female.
Autosomal Chromosomes – Controls the production of proteins that control everything else.
Remember: “structure of chromosomes”
Terms to Knowchromatids
centromeres
Double helix
Homology (parents)
DNA
“structure and function of the DNA molecule”
Key Terms
– Backbone
– Nucleotides
– Complementary base pairing
“structure and function of the DNA molecule”
– What bond holds the nitrogenous bases together?
– What chemicals make up a Nucleotides?
– What chemicals make up the Backbone?
– What are the 4 nitrogenous bases?
– How do the nitrogenous bases pair?
Bell Ringer
Draw a strand of DNA and label its parts…Include…– Backbone– Phosphate– Adenine– Guanine– Cytosine– Thymine– Deoxyribose
DNA Replication Lab
Must dos…• Follow Lab directions step-by-stepAnalysis…• Must write out questions • Answer the questions when directed to do so by the directions• Must tape nucleotides after done• Conclusion would be in tell-con format (3 paragraphs)
“the process of DNA replication”
Role of the Helicase and Polymerase• Helicase -- Enzyme that unzips the “Double Helix”• DNA Polymerase – Enzyme attaches “complementary base pairs” to create two identical DNA Strands
“the process of DNA replication”
How do the two DNA strands compare?
Why does DNA Replication need to occur?
What stage of Interphase does DNA Replication occur in?
The Code
Create a code using a minimum sequence of numbers from 1-4 (0,5-on cannot be used) that represents each letter in the alphabet. Sequence of numbers cannot repeat?
Ex. 1 = A, 2 = B, etc.
What was the minimum number you used?
Sequence of 1 Sequence of 2 Sequence of 3
1 11 111 A
2 12 112 B
3 13 113 C
4 14 114 D
21 121 E
22 122 F
23 123 G
24 124 H
31 131 I
32 132 J
33 133 K
34 134 L
41 141 M
42 142 N
43 143 O
44 144 P
211 Q
212 R
213 S
214 T
221 U
222 V
223 W
224 X
231 Y
232 Z
431 Start
432 Stop
Complete this Code
The Secret Code Of Gorbology
222431112131143432142144431131213432143133431111223121213143141121432134
What Message did you get?
22 Essential amino acids
• Humans can produce 11 of the 22 amino acids.
• The other 11 must be supplied in the food.
• Failure to obtain enough of even 1 of the 11 essential amino acids, those that we cannot make, results in degradation of the body's proteins—muscle and so forth—to obtain the one amino acid that is needed
• the amino acids must be in the food every day.
Videos
Protein and essential amino acids
Essential Amino Acids
Question of Thought
If there are only 22 amino acids and only 4 nucleotides in DNA, how long is the sequence of nucleotides need to be to code for one amino acid?
Answer is 3.
It takes 3 nucleotides to code for 1 amino acid, referred to as a “codon”.
Proteins are a long chain of amino acids, called a “polypeptide”.
Overview of Protein Synthesis
DNA
RNA
Protein
Transcription
Translation
Location:- In the Nucleus performed by the RNA Polymerase
- In the endoplasmic reticulum performed by the ribosome and the tRNA
Definition of Transcribe
To make a full written or typewritten copy of
The process of Transcription = to make a copy of DNA. This is called RNA.
Where: Nucleus
Why: So DNA stays protected
What would happen if the DNA for making a necessary protein is damaged?
Transcription
Transcription is the process of creating a complementary RNA copy of a sequence of DNA
Who: The enzyme RNA Polymerase performs this task, by complementary base pairing.
Watch Transcription in Real Time
How does transcription work in your world?
First you need to know the difference between DNA and RNA
DNA RNA
-Thymine
- Sugar in nucleotide is called “Deoxyribose”
- DNA molecule is double stranded
-Uracil
- Sugar in nucleotide is called “Ribose”
- RNA molecule is single stranded
Venn Diagram
Transcription
RNA Polymerase does the work
Attaches Complementary Base pairs (C-G and A-U and T-A and G-C) by using the DNA as a template.
The RNA that is created is referred to as mRNA
Let’s Practice Transcription
If the RNA Polymerase reads the DNA as …
ATCGATTTAGCGCCAATT
Transcribe the messenger RNA (mRNA) strand above
Getting rid of the nonsense
Before the mRNA leaves the nucleus it goes through a editing process.
Introns are the nonsense that will remain in the nucleus.
Exon is the mRNA that will leave the nucleus and travel to the ribosomes.
Review of the whole process
After the DNA has been transcribed into mRNA by the RNA polymerase and edited leaving the intron behind. The mRNA exits (called the Exons) the nucleus and makes its way to the ribosomes on the Endoplasmic Reticulum.
Bellringer
Transcribe the following DNA molecule into mRNA
ACTGTAGCCCGGTATAAATGA
What are the 3 difference between DNA and RNA?1. 2. 3. What enzyme performs this process?Where does this take place?
How do the Ribosomes turn the mRNA into Proteins (translation)?
Translation is defined as…
• expressing of something in different language
In Biology Translation is the process where the Ribosome reads the mRNA and turn it into a protein by linking amino acids together.
Translation
1. Ribosome reads the mRNA on Codon at a time.
2. For Each Codon, the tRNA matches its complementary base pair (Anti-codon).
3. When a match is created, the amino acids are bonded together and a chain of amino acids are created.
Click on picture for animation
Translation Table on p 211
Click here for video on how to use the table.
Pair up and do the Protein Synthesis Quiz
Point Mutations of DNA
Mutations of DNA occur to the word that makes sense
ATCATTTAGCGCCAATT
A point mutation occurs when a single nucleotide is either inserted or deleted
What happens to the mRNA when it is created?
GA
Frameshift Mutations of DNA
Mutations of DNA occur to the word that makes sense
ATC
A frameshift occurs when a single nucleotide is either inserted or deleted forcing the entire sequence to shift over.
What happens to the mRNA when it is created?
GATTTAGCGCCAATT
Griffith’s Experiement
Virulent – Microorganism able to cause a disease
Vaccine-- Substance made from killed or weakened disease causing agents to increase ones immune system.