DNA Structure & Protein Synthesis. Must Knows Unit 5 – DNA Objectives Describe the location of DNA...

Post on 28-Dec-2015

216 views 3 download

Transcript of DNA Structure & Protein Synthesis. Must Knows Unit 5 – DNA Objectives Describe the location of DNA...

DNA Structure & Protein Synthesis

DNA

Must KnowsUnit 5 – DNA Objectives

Describe the location of DNA inside the cell and explain the importance of its location. How many chromosomes are found in a human cell and what are the two types. Explain the structure of chromosomes related to

chromatidscentromeresDouble helixHomology (parents)DNA

Describe structure and function of the DNA molecule.

BackboneNucleotides Complementary base pairing

Summarize the process of DNA replication. How does the structure make it easier for it to undergo self

replication? Explain the role of enzymes in the process of replication. Explain how the arrangement of nucleotides in a DNA molecule relates to that arrangement of amino acids in

a protein.

“the location of DNA inside the cell”

“importance of its location”

Why does a Eukaryotic Cell store DNA inside the nucleus?

“How many chromosomes are found in a human cell…”Humans have 46 Chromosomes. 23 Homologous pairs.

“what are the two types?”

Sex Chromosomes – Controls the production of proteins that determine whether someone is Male or Female.

Autosomal Chromosomes – Controls the production of proteins that control everything else.

“structure of chromosomes”

Remember: “structure of chromosomes”

Terms to Knowchromatids

centromeres

Double helix

Homology (parents)

DNA

“structure of chromosomes…”

“structure and function of the DNA molecule”

“structure and function of the DNA molecule”

Key Terms

– Backbone

– Nucleotides

– Complementary base pairing

“structure and function of the DNA molecule”

– What bond holds the nitrogenous bases together?

– What chemicals make up a Nucleotides?

– What chemicals make up the Backbone?

– What are the 4 nitrogenous bases?

– How do the nitrogenous bases pair?

“structure and function of the DNA molecule”

Bell Ringer

Draw a strand of DNA and label its parts…Include…– Backbone– Phosphate– Adenine– Guanine– Cytosine– Thymine– Deoxyribose

DNA Replication

DNA Replication Lab

Must dos…• Follow Lab directions step-by-stepAnalysis…• Must write out questions • Answer the questions when directed to do so by the directions• Must tape nucleotides after done• Conclusion would be in tell-con format (3 paragraphs)

“the process of DNA replication”

Role of the Helicase and Polymerase• Helicase -- Enzyme that unzips the “Double Helix”• DNA Polymerase – Enzyme attaches “complementary base pairs” to create two identical DNA Strands

“the process of DNA replication”

Called the “Replication Fork”

“the process of DNA replication”

How do the two DNA strands compare?

Why does DNA Replication need to occur?

What stage of Interphase does DNA Replication occur in?

“the process of DNA replication”

Occurs in The “S” phase of Interphase

PROTEIN SYNTHESIS

The Code

Create a code using a minimum sequence of numbers from 1-4 (0,5-on cannot be used) that represents each letter in the alphabet. Sequence of numbers cannot repeat?

Ex. 1 = A, 2 = B, etc.

What was the minimum number you used?

Sequence of 1 Sequence of 2 Sequence of 3

1 11 111 A

2 12 112 B

3 13 113 C

4 14 114 D

21 121 E

22 122 F

23 123 G

24 124 H

31 131 I

32 132 J

33 133 K

34 134 L

41 141 M

42 142 N

43 143 O

44 144 P

211 Q

212 R

213 S

214 T

221 U

222 V

223 W

224 X

231 Y

232 Z

431 Start

432 Stop

Complete this Code

The Secret Code Of Gorbology

222431112131143432142144431131213432143133431111223121213143141121432134

What Message did you get?

The Secret Code of DNA

22 Essential amino acids

• Humans can produce 11 of the 22 amino acids.

• The other 11 must be supplied in the food.

• Failure to obtain enough of even 1 of the 11 essential amino acids, those that we cannot make, results in degradation of the body's proteins—muscle and so forth—to obtain the one amino acid that is needed

• the amino acids must be in the food every day.

Videos

Protein and essential amino acids

Essential Amino Acids

Question of Thought

If there are only 22 amino acids and only 4 nucleotides in DNA, how long is the sequence of nucleotides need to be to code for one amino acid?

Answer is 3.

It takes 3 nucleotides to code for 1 amino acid, referred to as a “codon”.

Proteins are a long chain of amino acids, called a “polypeptide”.

Overview of Protein Synthesis Process

Step by Step Protein Sythesis

Human Genome Project

Click Here!

Overview of Protein Synthesis

DNA

RNA

Protein

Transcription

Translation

Location:- In the Nucleus performed by the RNA Polymerase

- In the endoplasmic reticulum performed by the ribosome and the tRNA

Definition of Transcribe

To make a full written or typewritten copy of

The process of Transcription = to make a copy of DNA. This is called RNA.

Where: Nucleus

Why: So DNA stays protected

What would happen if the DNA for making a necessary protein is damaged?

Transcription

Transcription is the process of creating a complementary RNA copy of a sequence of DNA

Who: The enzyme RNA Polymerase performs this task, by complementary base pairing.

Watch Transcription in Real Time

How does transcription work in your world?

First you need to know the difference between DNA and RNA

DNA RNA

-Thymine

- Sugar in nucleotide is called “Deoxyribose”

- DNA molecule is double stranded

-Uracil

- Sugar in nucleotide is called “Ribose”

- RNA molecule is single stranded

Venn Diagram

Transcription

RNA Polymerase does the work

Attaches Complementary Base pairs (C-G and A-U and T-A and G-C) by using the DNA as a template.

The RNA that is created is referred to as mRNA

Let’s Practice Transcription

If the RNA Polymerase reads the DNA as …

ATCGATTTAGCGCCAATT

Transcribe the messenger RNA (mRNA) strand above

Getting rid of the nonsense

Before the mRNA leaves the nucleus it goes through a editing process.

Introns are the nonsense that will remain in the nucleus.

Exon is the mRNA that will leave the nucleus and travel to the ribosomes.

Review of the whole process

After the DNA has been transcribed into mRNA by the RNA polymerase and edited leaving the intron behind. The mRNA exits (called the Exons) the nucleus and makes its way to the ribosomes on the Endoplasmic Reticulum.

Bellringer

Transcribe the following DNA molecule into mRNA

ACTGTAGCCCGGTATAAATGA

What are the 3 difference between DNA and RNA?1. 2. 3. What enzyme performs this process?Where does this take place?

How do the Ribosomes turn the mRNA into Proteins (translation)?

Translation is defined as…

• expressing of something in different language

In Biology Translation is the process where the Ribosome reads the mRNA and turn it into a protein by linking amino acids together.

Translation

The Ribosome

tRNA

The Codon

The Anti-codon

Amino Acids

Translation

1. Ribosome reads the mRNA on Codon at a time.

2. For Each Codon, the tRNA matches its complementary base pair (Anti-codon).

3. When a match is created, the amino acids are bonded together and a chain of amino acids are created.

Click on picture for animation

Translation Table on p 211

Click here for video on how to use the table.

Pair up and do the Protein Synthesis Quiz

Point Mutations of DNA

Mutations of DNA occur to the word that makes sense

ATCATTTAGCGCCAATT

A point mutation occurs when a single nucleotide is either inserted or deleted

What happens to the mRNA when it is created?

GA

Frameshift Mutations of DNA

Mutations of DNA occur to the word that makes sense

ATC

A frameshift occurs when a single nucleotide is either inserted or deleted forcing the entire sequence to shift over.

What happens to the mRNA when it is created?

GATTTAGCGCCAATT

Griffith’s Experiement

Virulent – Microorganism able to cause a disease

Vaccine-- Substance made from killed or weakened disease causing agents to increase ones immune system.

Human Genome Project

Click Here for Video!

End of the day assignment

Pair up with your tablemate.

• Go through chapter 9 & 10 and identify all the key terms that we covered.

• Create 20 note cards to help with your review.