DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of...

Post on 31-Dec-2015

214 views 1 download

Transcript of DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of...

DNA

How is the expression of genes controlled in prokaryotes?

What are some ways the expression of genes are controlled in eukaryotes?

What are histones?

DNA Technology

Meet Dolly

Biotechnology

The manipulation of organisms or use of living things as technology

i.e. genetic engineering, manipulating genes for practical purposes

Studying One Gene

If we want to study a particular gene in depth, it is cumbersome to use the entire DNA molecule

Much easier if we can make multiple copies of that one gene to focus on

Gene Cloning

We will first look at the overview of cloning a particular gene, then go into it in detail

The goal is to create multiple copies of a single segment of DNA

Step 1A

Isolate a plasmid from a bacterial cell

Step 1B

Isolate the DNA we wish to clone

Step 2

Insert gene into plasmid

Recombinant DNA

Step 3

Reinsert Plasmid into Bacteria

Recombinant Bacterium

Step 4

Plasmids replicate independently, reproducing the gene of interest

Step 5 / Step 6

Identify the bacterial plasmids that did in fact clone the gene

Use the gene! Can use copies of the gene itself Can use the protein products of the gene

Why Is This Useful?

We can insert genes into other organisms

i.e. in agriculture we can introduce pest-resistance to crops

Alter bacteria to accomplish a task Create proteins for medicines and other uses

Create Human Growth Hormone to treat short kids

Restriction Enzymes

Cut DNA at specific places (recognize target sequences)

Used to combat foreign DNA in nature

Create restriction fragments

Creates the same fragments every time

Sticky Ends

Doesn't cut at the same spot on both strands

Leaves single stranded edges called sticky ends

These two ends can be resealed by DNA ligase

Or new DNA can be inserted between

Recombinant DNA using Restriction Enzymes

DNA

What is a restriction enzyme? What are sticky ends? What is a plasmid? What are some of the uses of genetic

engineering?

A More Detailed Look at Cloning

We use a plasmid containing 2 useful genes

1 – ampicillin resistance

2 – lacz gene Called a cloning

Vector Easy to insert in

bacteria

Restriction Enzyme Targets lacz Gene

A restriction enzyme recognizes and cuts a segment of the lacz gene

Also cuts DNA containing gene of interest into small fragments

Mix Plasmids with Our DNA

Sticky ends of plasmid can base pair with sticky ends of DNA

Also end up with plasmid-plasmid combos and DNA-DNA combos etc.

Seal Plasmid and DNA using DNA ligase

Some Plasmids take in the DNA, some Don't

DNA is inserted in the middle of the lacz gene if DNA is taken by plasmid

Amp gene is intact either way

Introduction of Plasmids to Bacterial Cells

Recall transformation, bacteria will take up plasmids

The bacteria do not have the lacz gene

Some bacteria take in plasmids with our DNA

Some take in unaffected plasmids

Plate the Bacteria

We place the bacteria on a plate containing ampicillin and X-gal

Only bacteria containing the plasmid can grow (the ampicillin resistance allows their survival)

Bacterial Colonies

What Is X-Gal?

X-gal reacts with galactosidase to create a blue product

The product of the lacz gene breaks down galactosidase

If the lacz gene is intact – no blue

If there is foreign DNA then lacz gene is interrupted and bacteria are blue White Blue

Checking our Agar Plate

Blue colonies have taken in foreign DNA in their plasmids

White colonies have the plasmid – but no foreign DNA is in the plasmid and the lacz gene is intact

Isolate Our Gene of Interest

The foreign DNA may not have been the gene we care about!

We must use nucleic acid probe (a short segment of complementary DNA) to find the gene of interest

Attach fluorescent protein to probe

Making the Bacteria Express the Gene

We can express the gene in the bacteria, but sometimes we need to insert a promoter as well

Called an expression vector

The promoter tells the prokaryotic RNA polymerase to transcribe the gene

cDNA

Introns are a pain for prokaryotes

Sometimes it's necessary to make DNA without the introns first

Use reverse transcriptase to make cDNA from mRNA

Genomic Library vs. cDNA library

Collection of all of the segments of the DNA that is separated by restriction fragments

The library will have multiple copies of each gene

Some genes are split between two segments

cDNA library contains only the segments that code for a gene

In fact only codes for genes transcribed – useful for studying genes expressed in brain cells for example

Polymerase Chain Reaction (PCR)

Allows us to quickly make many copies of a segment of DNA

Very specific, due to use of specific primers that recognize each gene

Need only small amount of DNA to replicate

PCR

Heat the DNA to separate the strands

Cool strands and allow DNA primers to bind to DNA

DNA polymerase synthesizes new strand

Repeat

Why is PCR So Amazing?

From a small amount of DNA we can make millions of copies

Important in solving crimes with DNA, determining paternity etc.

Useful for a lot of other biotech processes

Gel Electrophoresis

Separates DNA, Proteins etc. based on charge and size

For DNA, all molecules have the same charges, so separates DNA by length of strand

Restriction Fragment Analysis

Cut pieces of DNA with restriction enzymes

The same DNA with the same enzymes will produce the same fragments every time

Show up as bands on gel electrophoresis

Southern Blotting

The full genome has too many genes to use simple gel electrophoresis (get too many bands)

But we can use Southern Blotting to identify only the genes we care about

Southern Blotting

We add radioactively labelled DNA to our gel electrophoresis

We can figure out A) if the DNA segment we are interested in is present and

B) What size fragment the segment is located on

C) How many times the gene is present

Restriction Length Polymorphisms (RFLPs)

Recall that human's have DNA that is 99.9% similar

So how can we compare DNA? By identifying locations in the genome where

people often differ If two people differ in a nucleotide that is part of

a restriction site, then only one of the people will have their DNA cut by that restriction enzyme

RFLPs

Finding Genes in Genomes

In situ hybridization Use a radioactive

probe that can base pair with the gene

i.e. we can see if a gene from a mouse is present in humans

The Human Genome Project

Working version of genome worked out in 2000

“Final Draft” in 2003 Not a single individual

– there are many places where nucleotides differ

Available on the Internet

Genetic Linkage Mapping

As discussed earlier, we can figure out the order of genes by the frequency of recombination

Genes that are further apart are more likely to be separated during crossing over

Getting the Whole Genome

Cut the genome into tons of little pieces

These pieces are identifiable restriction fragments

Then order fragments by how they overlap

Must first clone DNA so we have copies

Chromosome Walking

Each segment overlaps, so we can use the end of one segment to probe for the next segment

DNA Sequencing (The Basics)

We take a strand of DNA and make copies of it The DNA is added to a solution containing

everything necessary for DNA replication Primer, DNA Polymerase, A, T, G and C

nucleotides One more ingredient in each batch

Dideoxy Nucleotides!

Special nucleotides that are missing another OH group

ddA nucleotides are added to the DNA

If a dd nucleotide is added DNA replication ends

No phosphodiester bond can be made

Each dd nucleotide is labelled with a fluorescent color

Synthesize New DNA

The DNA is replicated, BUT replication ends as soon as a dd nucleotide is added

We end up with a bunch of different length strands, each labelled by the dd nucleotide on the end

DNA Segments Are Separated By Size

DNA is run through a machine – smaller segments get through faster

A computer reads the color at the end

Tells us the order of the nucleotides

Much Faster than the Sanger Method

This revolutionized the Human Genome Project Sanger method – have 4 batches, introduce 1

dd nucleotide to each batch Use gel electrophoresis 4 separate times to

determine the length of the strands ending in A, C, G and T

We Can Use cDNA to Identify Which Genes Are Expressed

Separate genes (by gene cloning and hybridization)

Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA

Microassay

Practical Applications

Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!

Identifying Diseases

Using PCR we can identify a small amount of a virus in a blood sample

Can examine a person's genes to look for diseases

i.e. Huntington's disease

Gene Therapy

Correct genetic disorders by changing genes or inserting genes

Can we change a person's genes using retroviruses?

Ethical dilemma?

Pharmaceuticals

Make hormones and proteins using bacteria

Make vaccines by altering viruses

Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?

Forensics

We can match up DNA found at a crime scene with suspect's DNA

Used both to help prove guilt and innocence!

Ethical dilemma – should we store DNA of convicted criminals?

Agricultural Uses

Bovine Growth Hormone to raise milk production

Can speed up growth of animals

Easier to manipulate genes in plants

Can introduce pest resistance, or change nutrition

Ti Plasmids in Plants

Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria

Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant

Gene CloningRestriction Enzyme

Plasmid

Restriction Enzyme Cuts Plasmid

Sticky Ends

Same Restriction Enzyme Cuts DNA

Mix Plasmid and DNA

Make Bacteria Take Up Plasmid

Place Bacteria on Agar Plate

Bacteria with No Plasmids Are Killed By Ampicillin

ampicillin

Bacteria with DNA Turns Blue

Our DNA

Bacteria and Plasmids Replicate

DNA Libraries

DNA Libraries

Genomic(all DNA)

cDNA(DNA expressed)

Then we make copies!

Isolate Cells and Collect mRNA

Cells from Brain Tissue

RNA Polymerase

pre-mRNA

SpliceosomemRNA

Make cDNA out of RNA

mRNAReverse Transcriptase

DNA

DNA Polymerase

cDNA

DNA Libraries

Genomic(all DNA)

cDNA(DNA expressed)

Restriction Fragment Length Polymorphism

AAAATTTTAAAATTTTAAAATTTT TTTTAAAATTTTAAAATTTTAAAA

AAAATTTTAAAGTTTTAAAATTTT TTTTAAAATT TCAAAATTTTAAAA

We find the one spot in the sequence where human's are known to differ. We can then find a restriction enzyme that cuts around that spot

If We Then Place the DNA in Gel Electrophoresis, We Can Tell the

DNA Apart

Southern Blotting

DNA A DNA B DNA C

Red is our gene of interest. We can check if any of the 3 individuals have it and how many times. If we have a sample containing the gene 3 times, we can figure out which person it belongs to

Chop up DNA with Restriction Enzyme

DNA A DNA B DNA C

Use Gel Electrophoresis to Separate Fragments

Use X-Ray to View Only the Gene of Interest

Compare that to our sample DNA to confirm a match!

Chromosome Walking

ACGTTGCATTGCAACGTA Use GCAT as a probe

Chromosome Walking

ACGTTGCATTGCAACGTA

GCATACGTCGATTGCGTATGCAGCTAAC

Use ATTG as probeGATTGCCTGC

CTAACCGACG

We Can Use cDNA to Identify Which Genes Are Expressed

Separate genes (by gene cloning and hybridization)

Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA

Microassay

Fluorescent labelled cDNA from a salivary gland

Practical Applications

Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!

Identifying Diseases

Using PCR we can identify a small amount of a virus in a blood sample

Can examine a person's genes to look for diseases

i.e. Huntington's disease

Gene Therapy

Correct genetic disorders by changing genes or inserting genes

Can we change a person's genes using retroviruses?

Ethical dilemma?

Pharmaceuticals

Make hormones and proteins using bacteria

Make vaccines by altering viruses

Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?

Forensics

We can match up DNA found at a crime scene with suspect's DNA

Used both to help prove guilt and innocence!

Ethical dilemma – should we store DNA of convicted criminals?

Agricultural Uses

Bovine Growth Hormone to raise milk production

Can speed up growth of animals

Easier to manipulate genes in plants

Can introduce pest resistance, or change nutrition

Ti Plasmids in Plants

Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria

Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant

DNA

How can we separate bacteria that took up the plasmid from those that did not? What important gene does the plasmid contain?

How can we separate bacteria that have our DNA in them from those that do not What gene gets interrupted when foreign DNA is

inserted? What is Gel Electrophoresis?