Post on 14-Jan-2016
description
Developmental Trajectories to PTSD:
Genes and Environment
Karestan C. Koenen, Ph.D.
Departments of Society, Human Development & Health
& Epidemiology
Posttraumatic Stress Disorder
• Exposure to potentially-traumatic event
• 3 clusters of symptoms:– Reexperiencing– Avoidance/numbing– Arousal
• Duration of at least 1 month
• 50% becomes chronic and lasts many years
American Psychiatric Association, 1994
Traumatic Events are Common In the General Population
Event Males (%)
Females (%)
Physical Abuse 2.6 3.9
Neglect 2.1 3.4
Witnessed domestic violence
8.0 10.9
Victim of domestic violence
2.1 10.6
Unwanted sex 2.8 13.1
Mugged 15.5 7.11
Accident 22.9 12.3
Disaster 18.9 13.7
Any 94.0 93.4NESARC WAVE 2 2008
Hurricane KatrinaPTSD Prevalence 30% One Year
Later(Galea et al 2008)
OIF/OAF VeteransPTSD Prevalence ~20%
(Hoge et al. 2004)
Inner City ResidentsPTSD Prevalence ~>40%
(Schwartz et al 2005)
Lifetime PTSD Prevalence in the General U.S. Population:
11% in Women5.5% in Men
But the Prevalence is Increasing . . .
Public Health Consequences of PTSD
• Secondary mental disorders & suicide
• Impaired role functioning– 3.6 days work impairment per month– Productivity loss of $3 billion per year to the US
• Reduced life course opportunities
• Greater health care utilization
• Increased risk of negative physical health outcomes
Only Some Who Experience a Potentially Traumatic Event
Develop PTSDEvent Males
(%)Females
(%)Physical Abuse 35.2 44.8
Neglect 22.9 44.9
Witness Domestic Violence
13.7 24.4
Unwanted Sex 21.1 47.7
Combat 15.1 20.3
Accident 7.7 17.5
Disaster 3.7 7.1
Any 5.9 13.0
NESARC Wave 2
Genetics of PTSD
• What we know:– PTSD is heritable, ~33% of the variation in risk
for PTSD is due to genetic factors (True et al., 1993; Stein et al., 2002)
• What we want to know:– Which variations in inherited DNA sequence
influence response to traumatic events
• Central hypothesis of G-E research:– The effect of genotype (inherited DNA
sequence) on risk of PTSD will be conditional on environmental conditions – such as severity of trauma exposure
Genetics of PTSD: One Possible Visualization
genome locus gene site
Note: this is a simple schematic of the hierarchy, so these subdivisions should not be taken too literally. For example, a site does NOT have to be within a gene, and the terms locus / gene / site are often used interchangeably in the literature.
Pair of Chromosomes(2 Strands of DNA each)
FK506 Binding Protein 5 (FKBP5)
• Cochaperone of stress proteins
• Single nucleotide polymorphisms (SNPs) associated with variation in glucocorticoid receptor sensitivity and, therefore, HPA axis response
• Polymorphisms in FKBP5 thought to result in “more rapid onset of stress hormone hyperactivity after stressful life events” (Binder et al., 2004)
FKBP5 & Peri-Traumatic Dissociation
0123456789
101112
AA CA CC
Mean &
95%
C
I
RS3800373 Genotypes
Koenen et al., Molecular Psychiatry, 2005
Binder et al., JAMA, 2008
68
1012141618202224262830
AA CA CC
No Child Abuse 1 Type of Child Abuse 2 Types of Child Abuse
Mean P
TSD
Sym
pto
ms
RS3800373 Genotypes
Serotonin Transporter (SLC6A4)Promoter Variant (5-HTTLPR)
• Common polymorphism in promoter region regulates gene expression
• Target for SSRI’s (e.g. Paxil)
• Long variant = increased serotonin expression and function• Short variant = reduced serotonin expression and function• Genotypes: l/l or l/s or s/s
TGACCGCACACACACACACA…..CACACACACACACAGTAAGCTT
2004 Florida Hurricane Study
4 Hurricanes hit Florida coast between August & September 2004
70 people died
Property damage estimated > $40 billion
2004 Florida Hurricane Study
• Random digit dialing of ~600 older adults in 33 FL counties affected by the 2004 hurricanes
• PTSD assessed via National Women’s Study module
• Individual-level environment: social support, hurricane exposure, other traumatic events
• Social environment: county-level crime (1999 FBI) and unemployment rate (2000 Census)
• Buccal DNA collection via mail
• Genotyping for ancestry informative markers & 5HTTLPR
Kilpatrick et al., American Journal of Psychiatry, 2007
Kilpatrick et al., American Journal of Psychiatry, 2007
Prevalence of Post-HurricanePTSD by 5-HTTLPR genotype and
Stress Exposure
0
2
4
6
8
10
12
14
16
l/ l (n=154) l/ s (n=346) s/ s (n=120)
Low stress exposure High stress exposure
%
Kilpatrick et al. (2007) American Journal of Psychiatry
Prevalence of PTSD by 5-HTTLPR genotype and county-level crime rate
0
1
2
3
4
5
6
l/ l (n=154) l/ s (n=346) s/ s (n=120)
Low crime rate High crime rate
%
Prevalence of PTSD by 5-HTTLPR genotype and county-level
unemployment rate
0
1
2
3
4
5
6
7
l/ l (n=154) l/ s (n=346) s/ s (n=120)
Low unemployment rate High unemploment rate
%
Conclusions
• Emerging evidence that variation in inherited genetic code influences response to traumatic events
• Effect of inherited genetic variation on risk for PTSD appears to be conditional on severity of individual-level trauma exposure and features of the broader social environment
• Variation in inherited genetic code partially explains why - even at high levels of exposure -only some individuals develop PTSD
Implications
PTSD is not caused by genes
Trauma exposure reveals an underlying inherited genetic vulnerability to PTSD
Gene-environment interaction studies provide information on the environmental conditions under which genetic variants increase risk of PTSD
Further studies are needed to understand the function of these variants andimplications for the underlying neurobiology of PTSD
AcknowledgementsHurricane Study
Dean KilpatrickRon Acierno
Ken RuggieroSandro GaleaHeidi ResnickJohn Roitzsch
John BoyleErin BackshisAllison Aiello
Injury Study
Glenn SaxeJordan Smoller
Julie KaplowMichelle Bosquet
Erin Hall & Alisa MillerDavid Bartholomew
Robert CaseySteve MoultonClinton Baldwin
Genetics
Shaun PurcellJordan SmollerJoel Gelernter
Funded by NIMH K08MH070627 & R01MH078928
Vietnam Era Twin Registry
Q. John FuMichael Lyons
Karen ErtelJack Goldberg
Seth EisenWilliam TrueMing Tsuang
References• Binder, E. B., Bradley, R. G., Liu, W., Epstein, M. P., Deveau, T. C., Mercer, K. B., et
al. (2008). Association of FKBP5 polymorphisms and childhood abuse with risk of posttraumatic stress disorder symptoms in adults. JAMA, 299(11), 1291-1305.
• Kilpatrick, D. G., Koenen, K. C., Ruggiero, K. J., Acierno, R., Galea, S., Resnick, H. S., et al. (2007). The serotonin transporter genotype and social support and moderation of posttraumatic stress disorder and depression in hurricane-exposed adults. Am J Psychiatry, 164(11), 1693-1699.
• Koenen, K. C., Aiello, A. E., Bakshis, E., Amstadter, A. B., Ruggiero, K., Acierno, R., et al. (in press). County-level social environment modifies the association between serotonin transporter genotype and risk of post-traumatic stress disorder in adults. American Journal of Epidemiology.
• Koenen, K. C., Nugent, N. R., & Amstadter, A. B. (2008). Gene-environment interaction in posttraumatic stress disorder: review, strategy and new directions for future research. European Archives of Psychiatry and Clinical Neuroscience, 258(2), 82-96.
• Koenen, K. C., Saxe, G., Purcell, S., Smoller, J. W., Bartholomew, D., Miller, A., et al. (2005). Polymorphisms in FKBP5 are associated with peritraumatic dissociation in medically injured children. Mol Psychiatry, 10(12), 1058-1059.
• Moffitt, T. E., Caspi, A., & Rutter, M. (2005). Strategy for investigating interactions between measured genes and measured environments. Arch Gen Psychiatry, 62(5), 473-481.