Post on 30-Dec-2015
description
Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins,
remains to be discovered.
This seems highly unlikely.
—F. Crick (1958)
ContentsContentsBasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
CellCell
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Biology” by Campbell & Reece
Cellular macromoleculesCellular macromolecules
Source: “Molecular Cell Biology” by Lodish et al.
All nucleotides have a common All nucleotides have a common structurestructure
Source: “Molecular Cell Biology” by Lodish et al.
There are five principal bases in nucleic There are five principal bases in nucleic acidsacids
A, G, T, C are present in DNAA, G, U, C are present in RNA
Source: “Molecular Cell Biology” by Lodish et al.
Nucleotide subunits are linked togethNucleotide subunits are linked together by phosphodiester bonds er by phosphodiester bonds
Source: “Molecular Cell Biology” by Lodish et al.
Nucleotide terminologyNucleotide terminology
Source: “Molecular Cell Biology” by Lodish et al.
Native DNA is a double helix of Native DNA is a double helix of complementary anti-parallel chains complementary anti-parallel chains
Hydrogen bonding between complementary base pairs (A-T or G-C) holds the two strands together
Source: “Molecular Cell Biology” by Lodish et al.
DNADNA can undergo reversible strand can undergo reversible strand separationseparation
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Biology” by Campbell & Reece
Source: “Molecular Cell Biology” by Lodish et al.
ContentsContents
BasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA 2RNA 2ndnd structure in biology structure in biology
RNA efferencingRNA efferencing
Complementary sequences in RNA molecules Complementary sequences in RNA molecules maintain RNA secondary structure.maintain RNA secondary structure.
Source: “Bioinformatics” by David W. Mount
Features of RNA Secondary StructureFeatures of RNA Secondary Structure
In DNA, G≡CIn DNA, G≡C AA == TT
In RNA, G≡CIn RNA, G≡C AA == UU GG == UU
Features of RNA Secondary StructureFeatures of RNA Secondary Structure
Primary structurePrimary structure
↓↓
Secondary StructureSecondary Structure
↓↓
Tertiary StructureTertiary Structure
Types of single- & double-stranded regions in Types of single- & double-stranded regions in RNA secondary structures.RNA secondary structures.
Source: “Bioinformatics” by David W. Mount
Interaction of RNA secondary structural Interaction of RNA secondary structural elements.elements.
Source: “Bioinformatics” by David W. Mount
Display of base pairs in an RNA secondary Display of base pairs in an RNA secondary structure by a circle plot.structure by a circle plot.
Source: “Bioinformatics” by David W. Mount
ContentsContentsBasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
PredictionPrediction
Minimum Free-Energy Method
Sequence Co-variation
Global alignmentL G P S S K Q T G K G S – S R I W D N| | | | | | |L N – I T K S A G K G A I M R L G D A
Local alignment- - - - - - - - T G K G - - - - - - - | | |- - - - - - - - A G K G - - - - - - -
Adapted from “Bioinformatics” by D W Mount
DOROTHY--------HODGKINDOROTHYCROWFOOTHODGKIN
Dotplot
Adapted from “Introduction to Bioinformatics“ by A M Lesk
Drosophila melanogaster SLIT protein against itself
http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html
A G C T A G G A | | | | |C A C T A G G C
Dotplot
5’ A C G U - - - - G C G U 3’
| | | |
3’ U G C G - - - - U G C A 5’
Source: “Bioinformatics” by David W. Mount
Source: “Bioinformatics” by David W. Mount
RNA 2RNA 2ndnd Structure Website Structure Website
http://www.bioinfo.rpi.edu/~zukerm/rna/http://www.bioinfo.rpi.edu/~zukerm/rna/
PredictionPrediction
Minimum Free-Energy Method
Sequence Co-variation
Source: “Bioinformatics” by David W. Mount
Source: “Bioinformatics” by David W. Mount
RNA 2RNA 2ndnd Structure Website Structure Website
http://www.genebee.msu.su/services/rna2_reduced.htmlhttp://www.genebee.msu.su/services/rna2_reduced.html
1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA
1 C1 CGGCGGGGTAGCGGGGTAGAAGCGCAAGCCTGGTAGCGCCTGGTAGCTTCGTCGGGCTCATAATCCTCCGTCGGGCTCATAATCCTCTTCCCCGCCCCGCCC----C----2 G2 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAAAATCCGCCAGAGGACTGAAAATCCGCCCTCCCGTCCCGGGCACCACACCA3 G3 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAATATCCGCCAGAGGACTGAATATCCGCCCTCCCGTCCCGGGCACCACACCA
Limitations of Prediction-AssumptionLimitations of Prediction-Assumption
The most likely structure is similar to the The most likely structure is similar to the energetically most stable structure.energetically most stable structure.
The energy associated with any position in The energy associated with any position in the structure is only influenced by local the structure is only influenced by local sequence and structure.sequence and structure.
The structure is assumed to be formed by The structure is assumed to be formed by folding of the chain back on itself in a folding of the chain back on itself in a manner that does not produce any knots.manner that does not produce any knots.
Source: “Bioinformatics” by David W. Mount
ContentsContents
BasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
Processing of eukaryotic mRNA Processing of eukaryotic mRNA
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Gene VII” by Lewin
Interaction of the RNP motif from U1A Interaction of the RNP motif from U1A protein and RNAprotein and RNA
Figure 11-10
Source: “Molecular Cell Biology” by Lodish et al.
hnRNP proteins may assist in processinhnRNP proteins may assist in processing and transport of mRNAsg and transport of mRNAs
Figure 11-11
Source: “Molecular Cell Biology” by Lodish et al.
Splicing occurs at short, conserved Splicing occurs at short, conserved sequencessequences
Figure 11-14
Consensus sequences around 5 and 3 splice sites in vertebrate pre-mRNA
Source: “Molecular Cell Biology” by Lodish et al.
Splicing proceeds via two sequential Splicing proceeds via two sequential transesterfication reactionstransesterfication reactions
Figure 11-16
Source: “Molecular Cell Biology” by Lodish et al.
Small nuclear RNAs (snRNAs) assist in Small nuclear RNAs (snRNAs) assist in the splicing reaction the splicing reaction
Figure 11-17
Source: “Molecular Cell Biology” by Lodish et al.
Spliceosomal splicing cycleSpliceosomal splicing cycle
Figure 11-19
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Gene VII” by Lewin
Self-splicing group II introns provide Self-splicing group II introns provide clues to the evolution of snRNPsclues to the evolution of snRNPs
Figure 11-20
Source: “Molecular Cell Biology” by Lodish et al.
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
Self-splicing group I introns were the firSelf-splicing group I introns were the first examples of catalytic RNAst examples of catalytic RNA
Figure 11-51
Source: “Molecular Cell Biology” by Lodish et al.
A Preorganized Active Site in the Crystal Structure of the TA Preorganized Active Site in the Crystal Structure of the Tetrahymena etrahymena RibRibozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R. ozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R.
Cech*Cech*Science 282, 259~264 (1998)Science 282, 259~264 (1998)
The ribozyme core is formed by the junThe ribozyme core is formed by the junction of four helicesction of four helices
The model for P1’s interaction with the ribozyme juThe model for P1’s interaction with the ribozyme juxtaposes the guanosine-binding sitextaposes the guanosine-binding site
Source: “Molecular Cell Biology” by Lodish et al.
Source: “Gene VII” by Lewin
Source: “Gene VII” by Lewin
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
Source: “Gene VII” by Lewin
Source: “Gene VII” by Lewin
Source: “Gene VII” by Lewin
The Structural Basis of Ribosome The Structural Basis of Ribosome Activity in Peptide Bond SynthesisActivity in Peptide Bond Synthesis
Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter B. Moore and Thomas A. SteitzB. Moore and Thomas A. Steitz
Nature (2000) 289, 920~930Nature (2000) 289, 920~930
The ribosome is a ribozymThe ribosome is a ribozyme.e.
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
Thiamine derivatives bind messengerThiamine derivatives bind messengerRNAs directly to regulate bacterialRNAs directly to regulate bacterial
gene expressiongene expression
Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*
Nature (2002) 419, 952~956.Nature (2002) 419, 952~956.
http://rfam.wustl.edu/http://rfam.wustl.edu/
Sequence Alignment Scoring versus Structural Alignment Scoring Cell, 109, 137–140, 2002
http://www.imb-jena.de/RNA.htmlhttp://www.imb-jena.de/RNA.html
ContentsContentsBasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
2,431 pairs of sense–antisense transcripts overlapping in the exons of the sense gene by at least 20 bases.NATURE VOL 420 (2002) p563
Science 296:p1263, 2002Science 296:p1263, 2002
A model for the molecular steps in RNA silencing.
Science 296:p1260, 2002Science 296:p1260, 2002
Science 296:p1260, 2002Science 296:p1260, 2002
EMBO Report 2:p986, 2001EMBO Report 2:p986, 2001