Post on 19-Dec-2015
A state model for alignment
-AGGCTATCACCTGACCTCCAGGCCGA--TGCCC---TAG-CTATCAC--GACCGC-GGTCGATTTGCCCGACCIMMJMMMMMMMJJMMMMMMJMMMMMMMIIMMMMMIII
M(+1,+1)
I(+1, 0)
J(0, +1)
Alignments correspond 1-to-1 with sequences of states M, I, J
Let’s score the transitions
-AGGCTATCACCTGACCTCCAGGCCGA--TGCCC---TAG-CTATCAC--GACCGC-GGTCGATTTGCCCGACCIMMJMMMMMMMJJMMMMMMJMMMMMMMIIMMMMMIII
M(+1,+1)
I(+1, 0)
J(0, +1)
Alignments correspond 1-to-1 with sequences of states M, I, J
s(xi, yj)
s(xi, yj) s(xi, yj)
-d -d
-e -e
-e
-e
How do we find optimal alignment according to this model?
Dynamic Programming:
M(i, j): Optimal alignment of x1…xi to y1…yj ending in M
I(i, j): Optimal alignment of x1…xi to y1…yj ending in I
J(i, j): Optimal alignment of x1…xi to y1…yj ending in J
The score is additive, therefore we can apply DP recurrence formulas
Needleman Wunsch with affine gaps – state version
Initialization:M(0,0) = 0; M(i,0) = M(0,j) = -, for i, j > 0I(i,0) = d + ie; J(0,j) = d + je
Iteration:
M(i – 1, j – 1)M(i, j) = s(xi, yj) + max I(i – 1, j – 1)
J(i – 1, j – 1)
e + I(i – 1, j)I(i, j) = max e + J(i, j – 1)
d + M(i – 1, j – 1)
e + I(i – 1, j)J(i, j) = max e + J(i, j – 1)
d + M(i – 1, j – 1)
Termination:Optimal alignment given by max { M(m, n), I(m, n), J(m, n) }
Probabilistic interpretation of an alignment
An alignment is a hypothesis that the two sequences are related by evolution
Goal:
Produce the most likely alignment
Assert the likelihood that the sequences are indeed related
A Pair HMM for not aligned sequences
BEGIN IP(xi)
ENDBEGIN
JP(yj)
END1 -
1 -
1 -
1 -
P(x, y | R) = (1 – )m P(x1)…P(xm) (1 – )n P(y1)…P(yn)
= 2(1 – )m+n i P(xi) j P(yj)
Model R
To compare ALIGNMENT vs. RANDOM hypothesis
Every pair of letters contributes:
• (1 – 2 – ) P(xi, yj) when matched
P(xi) P(yj) when gapped
• (1 – )2 P(xi) P(yj) in random model
Focus on comparison of
P(xi, yj) vs. P(xi) P(yj)
BEGINI
P(xi)END
BEGINJ
P(yj)END
1 -
1 -
1 -
1 -
MP(xi, yj)
IP(xi)
JP(yj)
1 – 2 –
1 – 2 –
1 – 2 –
To compare ALIGNMENT vs. RANDOM hypothesis
Idea:We will divide alignment score by the random score, and take logarithms
Let P(xi, yj) (1 – 2 – )
s(xi, yj) = log ––––––––––– + log ––––––––––– P(xi) P(yj) (1 – )2
(1 – 2 – ) P(xi) d = – log ––––––––––––––––––––
(1 – ) (1 – 2 – ) P(xi)
P(xi) e = – log –––––––––––
(1 – ) P(xi)
Every letter b in random model contributes (1 – ) P(b)
The meaning of alignment scores
Because , , are small, and , are very small,
P(xi, yj) (1 – 2 – ) P(xi, yj)
s(xi, yj) = log ––––––––– + log –––––––––– log –––––––– + log(1 – 2)
P(xi) P(yj) (1 – )2 P(xi) P(yj)
(1 – – ) 1 – d = – log –––––––––––––––––– – log ––––––
(1 – ) (1 – 2 – ) 1 – 2
e = – log ––––––– – log
(1 – )
The meaning of alignment scores
• The Viterbi algorithm for Pair HMMs corresponds exactly to the Needleman-Wunsch algorithm with affine gaps
• However, now we need to score alignment with parameters that add up to probability distributions
1/mean arrival time of next gap 1/mean length of next gap
affine gaps decouple arrival time with length
1/mean length of conserved segments (set to ~0) 1/mean length of sequences of interest (set to ~0)
The meaning of alignment scores
Match/mismatch scores: P(xi, yj)
s(a, b) log ––––––––––– (let’s ignore log(1 – 2) for the moment – assume no gaps)
P(xi) P(yj)
Example:Say DNA regions between human and mouse have average conservation of 50%
Then P(A,A) = P(C,C) = P(G,G) = P(T,T) = 1/8 (so they sum to ½) P(A,C) = P(A,G) =……= P(T,G) = 1/24 (24 mismatches, sum to ½)
Say P(A) = P(C) = P(G) = P(T) = ¼
log [ (1/8) / (1/4 * 1/4) ] = log 2 = 1, for matchThen, s(a, b) = log [ (1/24) / (1/4 * 1/4) ] = log 16/24 = -0.585
Note: 0.585 / 1.585 = 37.5
According to this model, a 37.5%-conserved sequence with no gaps would score on average 0.375 * 1 – 0.725 * 0.585 = 0
Why? 37.5% is between the 50% conservation model, and the random 25% conservation model !
Substitution matrices
A more meaningful way to assign match/mismatch scores
For protein sequences, different substitutions have dramatically different frequencies!
BLOSUM matrices:
1. Start from BLOCKS database (curated, gap-free alignments)
2. Cluster sequences according to > X% identity
3. Calculate Aab: # of aligned a-b in distinct clusters, correcting by 1/mn, where m, n are the two cluster sizes
4. Estimate
P(a) = (b Aab)/(c≤d Acd); P(a, b) = Aab/(c≤d Acd)
Next few topics
• DNA Sequencing Sequencing strategies
• Hierarchical• Online (Walking)• Whole Genome Shotgun
Sequencing Assembly
• Gene Recognition The GENSCAN hidden Markov model Comparative Gene Recognition – Twinscan, SLAM
• Large-scale and multiple sequence alignment
• Microarrays, Regulation, and Motif-finding
• Evolution and Phylogeny
• RNA Structure and Modeling
New topic: DNA sequencing
How we obtain the sequence of nucleotides of a species
…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…
Which representative of the species?
Which human?
Answer one:
Answer two: it doesn’t matter
Polymorphism rate: number of letter changes between two different members of a species
Humans: ~1/1,000
Other organisms have much higher polymorphism rates
Why humans are so similar
A small population that interbred reduced the genetic variation
Out of Africa ~ 100,000 years ago
Out of Africa
DNA Sequencing
Goal:
Find the complete sequence of A, C, G, T’s in DNA
Challenge:
There is no machine that takes long DNA as an input, and gives the complete sequence as output
Can only sequence ~500 letters at a time
DNA sequencing – vectors
+ =
DNA
Shake
DNA fragments
VectorCircular genome(bacterium, plasmid)
Knownlocation
(restrictionsite)
Different types of vectors
VECTOR Size of insert
Plasmid2,000-10,000
Can control the size
Cosmid 40,000
BAC (Bacterial Artificial Chromosome)
70,000-300,000
YAC (Yeast Artificial Chromosome)
> 300,000
Not used much recently
DNA sequencing – gel electrophoresis
1. Start at primer(restriction site)
2. Grow DNA chain
3. Include dideoxynucleoside (modified a, c, g, t)
4. Stops reaction at all possible points
5. Separate products with length, using gel electrophoresis
Reading an electropherogram
1. Filtering
2. Smoothening
3. Correction for length compressions
4. A method for calling the letters – PHRED
PHRED – PHil’s Read EDitor (by Phil Green)Based on dynamic programming
Several better methods exist, but labs are reluctant to change
Output of PHRAP: a read
A read: 500-700 nucleotides
A C G A A T C A G …A
16 18 21 23 25 15 28 30 32 …21
Quality scores: -10log10Prob(Error)
Reads can be obtained from leftmost, rightmost ends of the insert
Double-barreled sequencing:
Both leftmost & rightmost ends are sequenced
Method to sequence segments longer than 500
cut many times at random (Shotgun)
genomic segment
Get one or two reads from each segment
~500 bp ~500 bp
Reconstructing the Sequence (Fragment Assembly)
Cover region with ~7-fold redundancy (7X)
Overlap reads and extend to reconstruct the original genomic region
reads
Definition of Coverage
Length of genomic segment: LNumber of reads: nLength of each read: l
Definition: Coverage C = n l / L
How much coverage is enough?
Lander-Waterman model:Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides
C
Challenges with Fragment Assembly
• Sequencing errors
~1-2% of bases are wrong
• Repeats
• Computation: ~ O( N2 ) where N = # reads
false overlap due to repeat
Repeats
Bacterial genomes: 5%Mammals: 50%
Repeat types:
• Low-Complexity DNA (e.g. ATATATATACATA…)
• Microsatellite repeats (a1…ak)N where k ~ 3-6(e.g. CAGCAGTAGCAGCACCAG)
• Transposons SINE (Short Interspersed Nuclear Elements)
e.g., ALU: ~300-long, 106 copies LINE (Long Interspersed Nuclear Elements)
~500-5,000-long, 200,000 copies LTR retroposons (Long Terminal Repeats (~700 bp) at each end)
cousins of HIV
• Gene Families genes duplicate & then diverge (paralogs)
• Recent duplications ~100,000-long, very similar copies
Strategies for whole-genome sequencing
1. Hierarchical – Clone-by-clone yeast, worm, humani. Break genome into many long fragmentsii. Map each long fragment onto the genomeiii. Sequence each fragment with shotgun
2. Online version of (1) – Walking rice genomei. Break genome into many long fragmentsii. Start sequencing each fragment with shotguniii. Construct map as you go
3. Whole Genome Shotgun fly, human, mouse, rat, fugu
One large shotgun pass on the whole genome
Hierarchical Sequencing Strategy
1. Obtain a large collection of BAC clones2. Map them onto the genome (Physical Mapping)3. Select a minimum tiling path4. Sequence each clone in the path with shotgun5. Assemble6. Put everything together
a BAC clone
mapgenome
Methods of physical mapping
Goal:
• Map the clones relative to one another • Use the map to select a minimal tiling set of clones to sequence
Methods:
• Hybridization• Digestion
1. Hybridization
Short words, the probes, attach to complementary words
1. Construct many probes p1, p2, …, pn
2. Treat each clone Ci with all probes
3. Record all attachments (Ci, pj)
4. Same words attaching to clones X, Y overlap
p1 pn
Hybridization – Computational Challenge
Matrix:m probes n clones
(i, j): 1, if pi hybridizes to Cj
0, otherwise
Definition: Consecutive ones matrix1s are consecutive in each row & col
Computational problem:Reorder the probes so that matrix is in consecutive-ones form
Can be solved in O(m3) time (m > n)
p1 p2 …………………….pm
C1
C2 …
……
……
….C
n
1 0 1…………………...01 1 0 …………………..0
0 0 1 …………………..1
pi1pi2…………………….pim
Cj1C
j2 …
……
……
….C
jn
1 1 1 0 0 0……………..00 1 1 1 1 1……………..00 0 1 1 1 0……………..0
0 0 0 0 0 0………1 1 1 00 0 0 0 0 0………0 1 1 1
Hybridization – Computational Challenge
If we put the matrix in consecutive-ones form,
then we can deduce the order of the clones
& which pairs of clones overlap
pi1pi2…………………….pim
Cj1C
j2 …
……
……
….C
jn
1 1 1 0 0 0……………..00 1 1 1 1 1……………..00 0 1 1 1 0……………..0
0 0 0 0 0 0………1 1 1 00 0 0 0 0 0………0 1 1 1 C
j1C
j2 …
……
……
….C
jn
pi1pi2………………………………….pim
Hybridization – Computational Challenge
Additional challenge:
A probe (short word) can hybridize in many places in the genome
Computational Problem:
Find the order of probes that implies the minimal probe repetition
Equivalent: find the shortest string of probes such that each clone appears as a substring
APX-hard
Solutions:Greedy, Probabilistic, Lots of manual curation
p1 p2 …………………….pm
C1
C2 …
……
……
….C
n
1 0 1…………………...01 1 0 …………………..0
0 0 1 …………………..1
2. Digestion
Restriction enzymes cut DNA where specific words appear
1. Cut each clone separately with an enzyme2. Run fragments on a gel and measure length3. Clones Ca, Cb have fragments of length { li, lj, lk } overlap
Double digestion:Cut with enzyme A, enzyme B, then enzymes A + B
The Walking Method
1. Build a very redundant library of BACs with sequenced clone-ends (cheap to build)
2. Sequence some seed clones
3. Walk from seeds using clone-ends to pick library clones that extend left & right
Advantages & Disadvantages of Hierarchical Sequencing
• Hierarchical Sequencing ADV. Easy assembly DIS. Build library & physical map; redundant sequencing
• Whole Genome Shotgun (WGS) ADV. No mapping, no redundant sequencing DIS. Difficult to assemble and resolve repeats
The Walking method – motivation
Sequence the genome clone-by-clone without a physical mapThe only costs involved are:
Library of end-sequenced clones (CHEAP) Sequencing