Post on 17-Mar-2016
description
Chapter 12
Text book Notes
12-1
• TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288)
• How did we find out that this happens…?
1928 Griffith: British scientist
• Prob? How do bacteria make people sick?– Specifically the bacteria pneumonia…
• Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B)
• Results : (what do you think will happen- which bcateria will kill the mice?)
Harmless bacteria?
Mice lived
Bacteria A Mice dies
Flamed Bacteria A
Mice lived Why?
Flamed Bacteria A and Bacteria B
Mice died Why? The good bacteria picked up the DNA, from the dead disease causing bacteria, and it became disease causing too
12-3 RNA & Protein Synthesis• Synthesis?
– DNA instruction is in code • ATCCGGTTAAAGGTCCCTCTCTGATCC
CGTATTAAAGTCGATTGACGATGCAGTGACGATGAAGTCGAAAACCGGTTGTGTGCCAGTGGCAGTGATG
– Code controls the making of proteins (which control traits: ex blood type, flower color )
– QUESTION OF THE DAY: • How can we decode that message?
Decode Message• Message needs to go from nucleus to
ribosomes….
DNA vs RNA DNA- deoxy, ribo, nucleic, acid
RNA – ribo, nucleic, acid
Double strand Single strand
Deoxyribose (sugar) Ribose (sugar)
Nitogen Bases: ATCG Nitrogen Bases: AUCG
JOB- instructions for all cells JOB: protein synthesis (needed by body for growth and repair)
Meet the RNA family …
• mRNA travels to ribosomes• rRNA is present at the ribosomes• tRNA- transfers the amino acids to the
ribosomes
Transcription
• Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand
• Step 2: mRNA looks only for the section that it needs to copy
• Step 3: mRNA finds the section and copies it but in its own complementary language
• Step 4: mRNA goes to Ribosome with message
Translation • Step 1: mRNA arrives at the ribosome,
and rRNA is already there waiting….• Step 2: mRNA and rRNA show the section
of the code in codons in (mRNA language) to all the present tRNA’s
• Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid.
• Step 4: After a bunch of amino acids line up- proteins are made….
• http://www.youtube.com/watch?v=983lhh20rGY
• Video transcription and translation
• Video replication• http://www.youtube.com/watch?
v=hfZ8o9D1tus&feature=related
12-4
• Mutations: change in the genetic material • …. Now and again cells make mistakes in
copying DNA
2 types of Mutations
• Gene mutations • Chromosomal mutations
Gene Mutations
• Occur on a single gene • TAC GCA TGG AAT • Code is read in 3 base
codons• Thefatcatandratran- say?
3 types of gene mutations
• Point Mutations occur at 1 spot• TAC GCA TGG AAT – original • Substitution?• Insertion?• Deletion ?
• TAC GCA TGG AAT – original• Substitution
– TAC GGA TGG AAT • Insertion
– TAC GGC ATG GAA T • Deletion
– TAC GAT GGA AT
Which are the 2 worst kinds of point mutations? Why?
• THE FAT CAT RAN – original • Substitution
– THH FAT CAT RAN • Insertion
– THE FAA TCA TRA N • Deletion
– HEF ATC ATR AN
Which are the 2 worst kinds of point mutations? Why?
• Changes message which changes the amino acid that is made- wrong protein made …
Chromosomal Mutations • Changes in the …
– Number of chromosomes• Down’s Syndrome
– Or structure of chromosome• Deletion• Duplication• Inversion• Translocation
See chrom. Mut. Chart
• http://www.pearsonsuccessnet.com/snpapp/iText/products/0-13-181118-5/ch12/sb7015a04.html
• Deletion- 1 section is deleted• Duplication- 1 section is doubled• Inversion- 1 section is reversed• Translocation -part of one
chromosome breaks off and attaches to another.
Mutations are good, bad or neutral
• Neutral• Bad: cause dramatic changes in protein
structure… body cannot function properly• Good.. Can create variability in species,
can be beneficial, if environment– Ex- AIDS resistant gene– Polyploidy (extra chromosomes)
• Banana and citrus fruits are larger and stronger