Post on 25-Feb-2016
description
BLOOD $ URINE COLLECTIONSet of blood collection tubes
2 x 9 ml. EDTA vacutainer
DNA isolation and EDTA-plasma
2 x 9 ml. Heparin vacutainer
RNA isolation
1 x 9 ml. Heparin vacutainer
Isolation of Leucocytes and heparin plasma
1 x 4.5 ml. Citrate vacutainer
Citrated plasma
1 x 2 ml. EDTA vacutainer
Measurement of HbA1c, hemoglobin and hematocrit
Urine collection set
2 x vacutainers, 1 x adaptorCollection of urine
BLOOD & URINE COLLECTION
2 x 9 ml. EDTA
vacutainer
2 x 9 ml. Heparin
vacutainer
1 x 9 ml. Heparin
vacutainer
1 x 4.5 ml.Citrate
vacutainer
1 x 2 ml.EDTA
vacutainer
Store in meltingice during transport
Store in meltingice during transport
Store at roomtemperature
during transport
Tube A:Freeze within 1 hr.Store in dry-ice during transport
Tube B:Add challenger within 1 hr.Store at 37°C duringtransport
2 x 10 ml.Urine
BLOOD HANDLING 2 x 9 ml. EDTA vacutainer
Store in melting iceduring transport
Within 6 hr.
Centrifuge:20 min. 2000 G and 4°C
Collect plasma inplastic tube
Vortexshortly
Division of plasma
18 Subsamples of ~500 µl
Snap-freezen
Methanol / Dry-ice
<1 hr RT
Store at <-30 °C
Vacutainer with
red cells, buffy-
coat and rest plasma
<1 hr RT
Store at -20 °C
EDTA: DNA & PLASMA
BLOOD HANDLING 2 x 9 ml. Heparine vacutainer
TUBE A
Snap-freezen
Methanol / Dry-ice
Add challenger
<1 hr RT
Store in dry-iceduring transport
After arrival at TNOStore at<-60 °C
TUBE B<1 hr RT
Store at 37°Cduring transport
Snap-freezen
Methanol / Dry-ice
After 6 hr. (exactly)
Store at<-60 °C
3 subsamples of ~ 3 ml
3 subsamples of ~ 3 ml
Heparine: RNA (rest & challenge)
The Queensland Institute of Medical ResearchThe Queensland Institute of Medical Research
The Total Number of Bloods Processed Each Year
4362
3439
73007566
3842
4318
3364
71747379
0
1000
2000
3000
4000
5000
6000
7000
8000
Year 2000 Year 2001 Year 2002 Year 2003 Year 2004**
Year
Num
ber o
f Blo
ods
Total LMReturned
Bloods/BuccalsProcessed
** Year 2004 to Nov only
The Sentrix Whole-Genome Genotyping BeadChip 100,000 SNPs25,000 in transcripts70,000 within 10kb of exons
Array Based GenotypingArray Based GenotypingCosts must reduce furtherCosts must reduce further
Affymetrix 100K SNP Chips
AGRF Affymetrix Chip Genotyping
Concordance and fail rates
Concord Discord Fail58423 3 53499.09% 0.01% 0.91%57948 38 97498.28% 0.06% 1.65%58345 13 60298.96% 0.02% 1.02%58252 16 69298.80% 0.03% 1.17%58345 9 60698.96% 0.02% 1.03%58247 10 70398.79% 0.02% 1.19%58239 26 69598.78% 0.04% 1.18%58249 41 67098.79% 0.07% 1.14%466048 156 547698.81% 0.03% 1.16%
S3 Genomic – S3 Genomic MDA
S4 Genomic – S4 Genomic MDA
Combined Totals
MZ 1 Genomic – MZ 2 Genomic
MZ 1 Genomic – MZ 1 Buccal
MZ 1 Genomic – MZ 2 Buccal1
MZ 1 Genomic – MZ 2 Buccal2
MZ 2 Genomic – MZ 2 Buccal1
MZ 2 Genomic – MZ 2 Buccal2
Concordance comparison of samples with SNP fail rate of < 3%
Samples tested were an MZ twin pair, plus parents (S3 and S4).
Genomic, Buccal and MDA Genomic replicates were tested for each individual.
Sample MZ 2 Buccal was tested twice.
Fail - no call for one or both samples
Association AnalysisAssociation Analysis
Sharing between Sharing between unrelatedunrelated individuals individuals Disease alleles originate in common ancestorDisease alleles originate in common ancestor High resolutionHigh resolution
Recombination since common ancestorRecombination since common ancestor Large number of independent testsLarge number of independent tests
Powerful if assumptions are metPowerful if assumptions are met Same disease haplotype shared by many Same disease haplotype shared by many
patientspatients Sensitive to population structureSensitive to population structure
Single Nucleotide Single Nucleotide Polymorphisms Polymorphisms
(SNP)(SNP)
• Single base changes• Human SNPs = 9,856,125
- Validated SNPs 4,540,241 • Frequency ~ 1 every 400 bp • Can cause functional changes
GGCTTCAGAATGGCCGGCTTCAAAATGGCC
QIMR’s Sequenom MassARRAY Installation(CCRC-E floor)
Multiplex AnalysisMultiplex Analysis
* A G
* A G
* T C
* A G
* C T
SNP GenotypingSNP Genotyping Minimum Finished Genotypes Minimum Finished Genotypes
(>99%)(>99%) Quality of DNAQuality of DNA
Measure concentrationsMeasure concentrations Dispense in large volumesDispense in large volumes
Quality of AssaysQuality of Assays Even peak heightsEven peak heights Test for Hardy-Weinberg Test for Hardy-Weinberg
equilibriumequilibrium Analysis of SNP data is Analysis of SNP data is
particularly sensitive to assay particularly sensitive to assay problems problems
Genotype failures are not random Genotype failures are not random Heterozygous individuals fail most Heterozygous individuals fail most
oftenoften all SNP typing platformsall SNP typing platforms
Error frequency of 0.11%Error frequency of 0.11% 3268 DNA samples typed twice3268 DNA samples typed twice 159 pairs of MZ twins - No 159 pairs of MZ twins - No
discordant genotypesdiscordant genotypes
Twelve-Plex GenotypingTwelve-Plex Genotyping
Whole Genome AssociationWhole Genome Association Use DNA pooling to greatly reduce Use DNA pooling to greatly reduce
amount of genotypingamount of genotyping Possible now but reduced power Possible now but reduced power
Use haplotypes to reduce number of Use haplotypes to reduce number of SNPs that have to be genotypedSNPs that have to be genotyped Haplotype blocks – HapMap projectHaplotype blocks – HapMap project
Massive parallel genotypingMassive parallel genotyping Costs must reduce furtherCosts must reduce further