A Quiet Life - The Eye Worlds/Accursed... · CONSUL MACTAVISH 2 The Intruders 2 The Watchers 3...

Post on 04-Aug-2020

2 views 0 download

Transcript of A Quiet Life - The Eye Worlds/Accursed... · CONSUL MACTAVISH 2 The Intruders 2 The Watchers 3...

A Quiet Life

John Dunn

1111111111111111111111111111111111111111111111111111111Credits

Copyright © Melior Via, LLC 2016Accursed, Melior Via, and their associated logos are trademarks of Melior Via, LLC in Cleveland, Ohio.Contact us: info@meliorvia.com or visit us at www.meliorvia.com

This game references the Savage Worlds game system, available from Pinnacle Entertainment Group at www.peginc.com. Savage Worlds and all associated logos and trademarks are copyrights of Pinnacle Entertainment Group. Used with permission. Pinnacle makes no representation or warranty as to the quality, viability, or suitability for purpose of this product.

Lead DeveloperRoss Watson

WriterJohn Dunn

Additional DesignRoss Bishop

Cover ArtworkKevin Childress

Interior ArtworkAlberto Bontempi

Graphic DesignKevin Childress

ContentsThe Setup 2Morrowdale 2CONSUL MACTAVISH 2

The Intruders 2The Watchers 3ANGUS DONAHUE 3

A Quiet Life2222222222222222222222222222222222222222222222222222222222222

The SetupThis scenario takes place in the Outlands. It can be

inserted as an interlude between other adventures set in that region. Alternatively, the heroes could begin these encounters a ter co pleting another ission.

Late in the day, they come across the small town of Morrowdale. Based on their maps or past knowledge of the region, they might have targeted it as a place to stop for the night. It is a small, isolated village, but it does have a tavern with rooms to let, due to prospectors who visit to resupply.

When they reach Morrowdale, they can see that it is a bit ragged around the edges, bearing hallmarks of recent construction, including carts loaded with supplies and tools visible. Guards greet the heroes at the edge of the town with weapons drawn. They assume that the heroes are a liated with a group of Accursed who have been trying to chase the settlers away from their village.

MorrowdaleThe town is a small community of humans, who

ed from the catastrophes of the Bane War. It has only been in place for a few years, as the original inhabitants were slain and the buildings demolished when the Witch Armies con uered the Outlands. About ty people now live here, and they were all refugees from Cairn Kainen. Since the end of the Bane War, these people ed the Morrigan s rule of their home nations, running into the shadow of the Darkwall Peaks, hoping to nd a safe place. They took up residence in valley, rebuilding from the ruins of a town that had once been here. While the town is hardly thriving, it is in far better shape than it was when they found it. They have established a few farms in the surrounding area and continue to build up the town.

The residents maintain little more than subsistence level agriculture. The land is not particularly fertile, and there are hardly vast other resources in the area. The tavern is also Morrowdale s largest building. It serves as a meeting hall for town business and a chapel for Enochian worship on holy days. Occasional prospectors, who scour the surrounding hills for gold and other minerals, visit the tarvern to resupply. Such visits represent the ma ority of Morrowdale s commerce. There are no Enochian clergy in the town. In fact, the closest thing Morrowdale has to a gure of authority is Consul Maggie MacTavish—whom the town has appointed as its leader. If the Accursed wish to nd out more about the troubles the guards direct them to speak to her.

CONSUL MACTAVISH

Maggie is a determined woman, who is used to getting her own way. She wants the best for her neighbors and herself, and she is con dent in her abilities to obtain it. Maggie never backs down from a

ght or an argument but is willing to listen to reason. Her appointment as Consul is in part due to her strong intuitive sense of justice and fairness. If her neighbors are forced to make a sacri ce, she e pects them to be reasonably compensated for the inconvenience. If that cannot happen, she is willing to make necessary sacri ces, even resorting to violence.

The IntrudersA group of Witchmarked, who are Adherents

of Aliyah, recently came to the small valley where Morrowdale is located. They e plained to the residents that the land was theirs, and re uested that the current s uatters depart. The group of Adherents includes Outlanders who lived in this vale before the Bane War. The current town was built upon the homes they lost when the Witches cursed them. Not surprisingly, these newly returned Accursed believe that they have more right to live here than the residents who built Morrowdale. Consequently, their demand that they leave does have merit. They have already o ered the settlers fair compensation for the improvements in the form of money, but the settlers do not want that. This is their home now, and they fear that they might not be able to nd another location so well sheltered from the Witches.

Before the heroes arrive, the human residents and the Witchmarked have fought skirmishes over the disagreement. Humans and Accursed have su ered injuries—though not fatally. Unless the player characters can do something to negotiate a settlement, it is clear that the con ict is going to be resolved through violence. If the heroes want to see a more amicable resolution, they need to help the two parties reach a mutually acceptable agreement.

The Adherents of Aliyah desire privacy and feel that they are entitled to the valley s seculded locale through their prior ownership. The settlers believe that they have earned the relative safety that the valley o ers through their hard work. The best hope for agreement is to persuade the Adherents to instead settle in a nearby valley. In e change, the settlers could be persuaded to cede a portion of their harvest from the valley s fruiting trees for the ne t few years. Such an agreement gives the Adherents less privacy than they might desire, but also provides some additional security and a nearby ally for their settlement. While the settlers can ill a ord to surrender such a portion of their harvest, it is a better compromise than losing their homes.

A Quiet Life 33333333333333333333333333333333333333333333333333333333333333333333

The Watchersthat the refugees had escaped from her domain and taken up residence in this valley. If a physical c o n f r o n t a t i o n begins between

ngus s followers and the residents of Morrowdale—a contingent of forty cauldron born led by a grave knight (see Accursed pp. 135–136) descend upon the city, attacking both factions indiscriminately. They have been observing the town and waiting for the perfect moment to strike. GMs who like the mass combat rules may wish to resolve this battle using that system. The defenders include a group of twenty ve Adherents and a comparable number of human settlers. Alternatively, the GM could play out this as a three way con ict, with the player characters trying to persuade the settlers and Adherents to ally, while they confront the grave knight directly.

If the heroes manage to di use the situation in town, they could instead discover the cauldron born independently and confront them directly. In this situation, the townsfolk or Adherents might assist the heroes in the con ict. ithout assistance, this many cauldron born might easily overwhelm the heroes.

If heroes abandon the discussion, leaving the settlers and Adherents to fend for themselves, the Morrigan s banes destroy the village and take its inhabitants hostage—including any contacts the Accursed might have in Morrowdale. The heroes only discover this when they ne t visit the village. At the GM s discretion, relationships with the town s residents could provide motivation to nd and punish the grave knight responsible.

ANGUS DONAHUE

Angus is an Ophidian and the reluctant leader of a band of Accursed. The group is highly motivated to nd a new place to live in peaceful isolation from the rest of humanity. All of the just over two dozen members are Adherents of Aliyah. They believe that the valley near the foothills of the Darkwall Peaks could be a perfect place to found a lasting community

of Accursed. All of the members were

once Outlanders, many of whom came from this

region, just East of Cairn Kainen. In fact, Angus lived in the town that Morrowdale was built over prior to becoming Witchmarked. His family dwelt in the valley for generations, while the humans who live here now are refugees from Cairn Kainen. He believes that it is his right to resume residence of the area, regardless of the e ort the townsfolk have put forth. Angus and his compatriots feel that they have the stronger claim to the site, and that the people who now dwell here must leave.

Angus speaks methodically, and carefully, considering his words. He also speaks with a stereotypical hiss, which clearly bothers him. He has little loyalty to the Order of the Penitent, or even the Enochian faith as a whole. Instead, he is devoted to his allies and his cause of nding a peaceful homeland. While he blames

his losses on the Witches, he believes that a life of peace is a better answer

than any e ort to achieve redemption.Witchbreed: Ophidian (see

Accursed p. 59 for Witchbreed package)

Attributes: Agility d12, Smarts d6, Spirit: d6, Strength

d6, Vigor d4Skills: Athletics d4, Fighting d10, Guts d4, Notice

d6, Repair d6, Shooting d12 , Subterfuge d10Charisma: 0, Pace: 6, Parry: 7, Toughness: 7 (3)Hindrances: Heroic, Loyal, Obligation (Minor,

Adherents of Aliyah) Edges: Dead Shot, QuickGear: Reinforced great coat (+3), musket (Range

10/20/40, Damage 2d8, ROF 1, AP –), bayonet (Str + d4), bedroll, int steel, a blessed medallion of St. Vitus.

agagagagagagagagagagagagagaaaagagaggaaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnn s s s ss ssssss ssss sss rararararararararrarararararrrararrraraaaaveveveveveveveveveveveveveveveveveveeveeevevvvvvvvvvvev nsnsnsnsnsnsnsnsnnsnsnssnsnnsnns d d d dddddddd ddd ddddddddddddddddisisisisisissisisisiisiissiiisisiscocococcococococcocococococococcooocococoveveveveveveveeveveveveveevevevevv rererererereerrerererereeerreeer d d d dddd dd dd dddddddddddaaaaaaaaaad d d ddddddd dddddddddddddddddddddddd esesesesesesesesesesesseeseeeeeee cacacacacacacacacacacacaacaccaaaaaaaaaacac peppeppepepepepepepepepepepepepepepepepeepp d ddddddd ddd dd d ddddd frfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrfrrrfrfromomomomomomomomomomomomommomomommomomommmm hhhh h h hhhhhhhhhhh hhhhhhhhhherererererererererrererrererereerererere uuuuuuuuuuuuup p pp pppp p p p ppppp rererererererererererererererereererereeeerrerr sisisisisisisisisisisisisisisiiiissiiiiiidedededededededededededededededededdeddeded ncncncncncncncncncncncncncncncnncncncnccnce eeee eeeee eeee ininininininininininininnnnnninn t t t t t t t tttttttttttttttthihihihihihihihihihihhihihhihhhhihh s sss ssssssssscacacacacacacacaaaccacacaaaall l ll lllllllllll lll llllln n n nnnnnnnnnnnnnn

enenennneennnnn ererererrrrererrrrrrs s s s sssss ssssntntntntntntntnts ss s ssssssse—e—e—e—e—eee—a aaaacacacacacacacacacaaacaaaulululululululululululululululuu drdrdrdrdrdrdrdrdrdrrdrdrdrononononononononononooonononnon b b b b b b b b bbb b borororororororororororororn n nn n nnnnnnnnt t ttttttt (s(s(s(s(s(s(s(s(s(s(s(s(s(seeeeeeeeeeeeeeeee AcAcAAAAcAcAAcAcAcAcAcAcAcAAAAAcAA cucucuccucucursrsrsrsrsrsrsrsrsededededededededdededdd p p p ppppp p ppppppp.p.ppp.pp.pp.p.p. n n nnnnnnnnnnnn ththththththththtththtthe e eeeeeeeee ciciciciicicicciccc tytytytytytytytyy, , , ,, , atatatataattattta tatatatatackckckckckkkkkkinininininng g g g ggggggriririririiimimimimimimimimimimimimimiminanannnanannanan tetetetetettetetttt lylylylylylyyyy. . ThThThThhThThT eyeyeyeyeyeeee h h h hhhhhavavavavavave e eewwwwwn n nnnnn anananand d dddd wawawawawawawaaawaw ititititititi ininininininnngg gg ggggg foffofofooooofoor r rrrr ththththhe e eeeeeeiiiikekekekekek . . GMGMGMMMGMMMss ss ssssssss whwhwhwhwhwhwhhho o ooo lililiillikekekekekkekeekee t ttttttthehhehehehehheh y y yy wiwiwiwiwishshshshsh t t tttto o ooooo rererererererrrerrereresosososossos lvlvlvvlvllll e e ee e thththththththttt isisisisiss eememememememmm. . .. ThThThThThThe e eee dedededdededeeedefefefefefefefefefefendndndndndndnn ererererereree s s s ss ofofofoofofofofoo t ttttttttwewewewewew ntntnnttnttnn yyyyyyyyy vvvvvvve e eeeeeeee

pppppppararararrararaararabababababababababbbleleleeleleleele n nnnnnnnnumummumumumumbebebebebebebebebebber r r rrrrrrrrrerereeeerernanaananaatitiiiivevevevevevevelylylylyyyy, , ,, thththththe e eee

ss a aas s s a a a ththththtttt rererr e e eee wawawawaay y yyy yyyyyyyyyyyyyererereereeeeeer c c hahahahahaahaararararararrar ctctctctctctcttctctcterererererrerererereerers s s sssssssssheheeheehehe s s ssssssss seteteteteteteeeee tltltltlttttttt ererererers s ssssssss ananananananannnnnd d dddiileleleleee t tttthehehehehey y yyy cocococococ nfnfnfnfnfnfnfnnnnnn rororororororororoontntntntntnt tltltltltltltttt y.y.y.y.y

nanananaaaanaaaan ggegegegegegegeggegegg t tttto o o o didididid uuuuuuuuuuuseseseseee t t tt tthehehehehee heheeeeheh y y yyyyyyyyyy cocococococccc ululululululuuuu d d dd d inininini ststststs eaeaeaeaeae ddd d dddddrororrorr n n nnnn bobobobobooobobooornrnrnrnrrnrnnnnr ooooonfnfnnfnnfroroororooontntntntt ththththththtthhhisisisisis fofofofoolklklklkkk o ooor r rrrrsisisisiststststtss tt tthehehehehehehhh .... W WWWWWWitiititittithohohohohhhhohohohoututututututuut

onononononononononononnononooonnonnonoonoooooonnnoonofofofofofofofofofofofofofffoofof w wwww ww w www wwwwwwwwwwwwwwwhohohohohohohohhohohhohohohohhohhohohohohoohh mmmmmmmmm

rerererererereeererereeerererrrerreeereegigigigigigigigigigiggigiggigigigigigigigigigigigiggigig onononononnonononononononononnonononnnnonnononononnononononnn, , , , , , , , ,,,,,,,,, jujujujujujujujujujujujujujujujujuujujujujuujujujujujujjuuujjujujjjujjjjjujjjjj stststssststststststststststststssssstssstsssssssststsssssss E EE EEEEE E EEEEEEEEEEEaaaaaaaaaaaaInInInInInInInnInInInInnInInInInnInnnn ff f fffffff facacacacacacaccaacacaact,t,t,t,t,t,t,t,ttt,t,t AAAAAAA AAAAAA AAAAAAA A A AAAA A AAAAAngngngngngngngngngngngngnngngngngngngnnnnnnnngususususususususuusuususuusuususus lllllll llllMoMoMoMoMoMoMoMoMoMoMMoMMMoMMM rrrrrrrrrrrrrrrrrrrowowowowowowowowowowowowwwooo dadadadadadadadadaddadadddaddaddddddad lelelelelelelelleele w ww w w wwww wwwwwaaaaaaaaaaabebebebebebebebebeebb cocococococococococococococcomimimimimimimimmmimmimm ngngngngngngngngngnnnn W W WW WWWW WWWW WWWWititititititititiitttttcccccccccccdwdwdwdwdwdwdwdwdwwd elelelelelelelelelt t tttttttt ininininininininn t t t tt ttttheheheehehehhehehehe v v vv vvwhwhwhwhwhwhhhhililiile e eeee thththttttthe e huhuhuhuhhuuhuhuh mmmmmmararararararrra e e eeee rererererererefufufufufuufufufugegegeggeegegg eseseeese f fffrrrrbebebebebeebeeeeb lilililiililililiiievevevevevvveseseseesesess ttttthahahhahh t t iiirerererereereeesisisisisisisiiidededddededeencncncncce eeeeee ofofoo tttthththththhee eeeeee eeeeee ororororrro t t ttt ththhtt eefofofofoffff rtrtttrtrtr h.hhh.hhhh A AAAAAAAngngngnngususuuu fefefefefefeelelll t ttttthahahahahahat t ttttt ththhhhheyeyeeeclclcclllaiaiaaa m m mmm totototootott t ttttthehehehehehh s ssititwhwhho o nonononoow w wwwwww dwdwwdwd elelele l l

AnAnAnAnAA guguguguuguuuuuus s sssssssssssss spsspspspanand d cacacacacaarereeeereefufufufufufullllllll y,y,,, c cccccoooooooHeHeHHH a aaaaalslsllll o oooo o spspppppeaeaeaeaeeakkkskskss hihihihihissssssss , , ,, whwhhwhhhwhw icicicicicii hh hhhh clclclclcc eaeaehahahahah s s liliiiiiittttttttttttt lelelllllll l loyoyoyyalalaaaa tttttPePePePePePeePeniiniiniiiitetetettentntnn , ,,, ororororororr ee eeeevevevevevvvasasss a a w whohoh leleeee. . . InInInInsshihihihhhis s sss ss alalalalliliiesesesesesesese a aaaandndndndnd pepepepepepepeacacacacacacaa efefeffffefe ulululululuulul h hhhomomoomee

hihiihihhisss s loloosssssss esesssss o on n nn ththeeththtt atatatatata a aaa l llififififee eeee ofofofofofo pppeaeaaeaaa

ththththththththananananaa a aaaaanynynynynynynnyn e eeee e oooooooortrtrttttrtr t ttttto o o o oo aaaaaWiWiWiWWiWiW tctctctctcccchbhbhbhbhbhbhbhbhbrereeeeee

AcAcAcAcAAcAcAcAcAAcAcA cucucucucucucucucucuuccucursrsrsrsrsrsrsrrssededededededededede p p pp p pppp. ... papapapapapapapapapackckckkckckckckckckkkagagagagagaagaagagaaaa e)e)ee)e)ee)e)

AtAtAAtAAtAAAtAtAtAttrtrtrtrtrtrtrtrribibiiiiSmSmSmSmSmSSmSmmmmmmarararaaraarara tststtss ddddd666666