Post on 28-Jan-2022
ANTISENSE-MEDIATED RESISTANCE
TO Agrobacterium vitis
by
MOHAMED FOKAR, B.S.Ag., M.S.
A DISSERTATION
IN
AGRONOMY
Submitted to the Graduate Faculty of Texas Tech University in
Partial Fulfillment of the Requirements for
the Degree of
DOCTOR OF PHILOSOPHY
Approved
Accepted
December, 1998
ACKNOWLEDGMENTS
I wish to express my sincere gratitude to my major professor Dr. Richard
E. Durham for giving me the opportunity to work in his laboratory, his invaluable
support, guidance and encouragement throughout these years. I am also
grateful to Dr. Randy Allen for hosting me in his laboratory and providing me with
his technical expertise.
I would like to express my appreciation to Dr. Michael San Prancisco, Dr.
randall Jeter and Dr. Terry Wheeler for serving in my committee and for their
critical reading and editing for this dissertation. My thanks to Dr. Roy Michelle for
his advice and support.
Many thanks to post-doctorates, fellow graduate students and student
assistants for their help and interaction during this period including: Kim Pittcock,
David Boone, Ashley Baisanger, Pokar Ali, Eli Boroda, Tahhan Jaradat, Teresa
Burns, Dr. WonHee Kang, Dr. Ousama Zaghmout, Sundus Lodhi, Sheryl Schake
and Dr. Virginia Roxas.
I would like to thank my friend saeed Obaid, Saeed Pathallah, Dr. Alkul
and Dr. Kaddour for their sincere friendship and unending support. Their
friendship and generosity was a source of support and peace for me.
I will never be able to express the full extent of my gratitude and love to
my mother Alami Izza and my father Pokar Bouchaib. They provided so much
moral and financial support to me and to my family, that I could never be able to
11
pay back. I especially thank my father for instilling in me the love for science, the
relativity in thinking and the respect of nature. I have always looked to his
immense dedication to the family and to his strength of character, and I hope I can
fellow in his footsteps.
Special thanks to my brothers and sisters: Mustafa, saida, Yassir, Aziza,
and Ali for their love and support. I extend my sincere appreciation to my wife
Khadija for her understanding, sacrifices, and support. I would also like to thank
my daughter Aicha and son Hamza for their love.
Pinnaly, I would like to dedicate this dissertation to the one that got me
interested in science at an early age, and remains my source of inspiration and
support since. To my father, I dedicate this work and to him I pledge my sincere
respect and love.
Ill
TABLE OF CONTENTS
ACKNOWLEDGMENTS ii
ABSTRACT vii
LIST OP TABLES ix
LIST OP PIGURES x
CHAPTERS
I. LITERATURE REVIEW 1
1.1 Historical overview of Agrobacfer/tym-plant interaction 1
1.2 Agrobacterium vitis 4
1.3 A. vitis is a grapevine pathogen 6
1.4 The plant-Agrobacter/(7/77 interaction 10
1.4.1 Attachment and signal perception 10
1.4.2 Activation of virulence genes 12
1.4.3 T-DNA processing 16
1.4.4 T-DNA transfer 19
1.4.5 Integration of T-DNA 23
1.4.6 T-DNA expression and tumor formation 25
1.4.6.1 Auxins 26
1.4.6.2 Cytokinins 30
1.5 Objectives and Rationale 32
1.6 References 34
IV
I. BIOCHEMICAL AND MOLECULAR CHARACTERIZATION O?AGROBACTERIUM VITIS STRAINS COLLECTED NEAR LUBBOCK, TEXAS 55
2.1 Introduction 55
2.2 Materials and Methods 58
2.2.1 Isolation of A. vitis. bacteria 58
2.2.2 Biochemical characterization 58
2.2.3 Pathogenicity assay 59
2.2.4 Molecular characterization 60
2.2.4.1 Isolation of Total DNA 60
2.2.4.2 Isolation of Ti plasmid 61
2.2.4.3 Homology study 62
2.2.4.4 PCR analysis 63
2.3 Results and Discussion 64
2.3.1 Isolation and biochemical characterization of A. vitis 64
2.3.3 Pathogenicity test 68
2.2.4. Molecular characterization of A. vitis 71
2.4 References 75
III. ANTISENSE RNA MEDIATED RESISTANCE EXPRESSION TO GROWN GALL IN TOBACCO 92
3.1 Introduction 92
3.2 Materials and Methods 95
3.2.2 Construction of chimeric iaaM and iaaH antisense 95
3.2.2.1 Isolation of iaaM and iaaH genes 95
3.2.2.2 TA Cloning 95
3.2.2.3 Construction of iaaM and /aaH antisense constructs 96
3.2.3 Development of Transgenic Tobacco 97
3.2.3.1 Transformation of Agrobacterium cells 97
3.2.3.2 Agrobacfer/t/m-mediated tobacco transformation 98
3.2.4 Characterization of Transgenic Tobacco Plant 99
3.2.4.ITobacco DNA and RNA Extraction 99
3.2.4.2 Reverse transcriptase polymerase chain reaction 101
3.2.4.3 Evaluation of tobacco plant expressing antisense iaaM
and /aaH genes 101
3.3 Results and Discussion 103
3.4 References 108
IV. CONCLUSIONS 120
APPENDICES
A:SELCTIVEMEDIAPORAGROBACTRIUMBIOTYPING 122
B: BIOCHEMICAL TESTS 124
C: LIST OP CROWN GALL SAMPLES, HOST AND LOCATION 126
D: TRANSFORMATION AND TISSUE CULTURE MEDIA 127
VI
ABSTRACT
Agrobacterium vitis is the causal organism of crown gall in grapevine.
Infection is particularly severe in areas that experience winter damage to the
vine. Improving resistance to A. vitis will require a detailed knowledge about this
organism.
In this study, 18 grapevine isolates of A. wY/s were obtained from different
vineyards around Lubbock, Texas. Isolates were subjected to a phenotypic
characterization using several biochemical tests. Isolates were also evaluated
for host range, tumor morphology and opine utilization and the oncogenic regions
of the T-DNA were compared at the molecular level by Southern hybridzation.
Although all isolates were able to metabolize tartarte and grow on Roy-sasser
media, there was high variability based on other biochemical tests. This
variability was also observed in terms of tumor morphology and opine utilization.
Southern hybridization analysis, however, showed that the oncogenic regions of
A. vitis isolates have strong homology with previously characterized
Agrobacterium T-DNA genes. This study suggests that the local isolates were
probably of clonal origin.
Tobacco was used as a model to test whether transgenic plants wit T-
DNA auxin biosynthetic genes in an antisense orientation would block tumor
morphology. The expression of iaaM antisense RNA resulted in an
approximately 45% reduction in the number of tumors. The iaaM antisense also
Vll
affected tumor morphology by reducing gall size. Plants expressing iaaH
antisense had fewer tumors than the control, but more than 60% of samples
formed roots when infected with Agrobacterium. The incomplete suppression of
tumor formation may be due to the presence of other loci on the T-DNA that are
also involved in auxin biosynthesis. Although a complete inhibition of
tumorgenesis was not achieved, the fact that both tumor frequency and
morphology changed, indicated that further manipulation of phytohormone genes
using antisense technology may result in complete resistance to Agrobacterium
tumefaciens species in transgenic plants.
Vlll
LIST OP TABLES
2.1 List of Agrobacterium isolates 81
2.2 Responses of Agrobacfer/tym strains to biochemical tests 82
2.3 Virulence of Agrobacfer/iy/r? strains on selected host 83
3.1 Tumor size, number, and frequency of tumor in transgenic and wild type tobacco plants after infection by Agrobacterium tumefaciens I l l
3.2 Reduction in tumor size and number due to the expression of the antisense iaaM and iaaH genes in tobacco 112
IX
LIST OP PIGURES
1.1. Overview of the Agrobacter/ivm-plant interaction 11
1.2. Auxin biosynthesis pathway in Agrobacterium tumefaciens xi9
2.1. Tumor induced by Agrobacter/um strains on tobacco 84
2.2. Tumor induced by Agrobacterium strains on tomato 85
2.3. Tumor induced by Agrobacterium strains on tobacco 86
2.4. Tumor induced by Agrobacterium strains on grape 87
2.5. Agarose gel electrophoresis showing Ti plasmids of Agrobacter/i//T7 strains 88
2.6. Southern hybridization analysis of Eco Rl digest of Ti plasmid using pGV201 probe 89
2.7. Southern hybridization analysis of Eco Rl digest of Ti plasmid
using pGV153 probe 90
2.8. PCR amplification of 260 bp fragment from A. tumefaciens 91
3.1. Strategy for the development of the antisense iaaM construct 113
3.2. Strategy for the development of the antisense /aaH construct 114
3.3. PCR amplification of phytohormone genes from the Ti plasmid of Agrobacterium tumefaciens 115
3.4. Total RNA and Northern blot analysis of iaaM and iaaH
antisense in tobacco 116
3.5. RT-PCR analysis of/aa/W and /aaH antisense transcripts 117
3.6. Tumor morphology induced by Agrobacterium tumefaciens on tobacco leaf tissue 118
3.7. Tumor morphology induced by Agrobacterium tumefaciens on trangenic tobacco leaf tissue 119
CHAPTER I
LITERATURE REVIEW
1.1 Historical overview of Aarobacter/tvm-plant interaction
Crown gall is a plant disease characterized by a tumor growth. The term
gall refers to tumorous neoplastic growth of plant tissue occurring at a wound site
on the plant and crown signifies that galls were often observed at the base of the
plant stem. The first reported occurrence of crown gall was in Europe in the mid
1800's (Owens, 1928). The causative agent of the disease remained unknown
untill Cavara (1897) showed that crown gall in grape is induced by a bacterium.
However, some other reports implicated fungi as the cause of the disease
(Toumy, 1900). It was in 1907, that Smith and Townsend presented evidence
that the causative agent of crown gall was a bacterium. This bacterium was
called Agrobacterium tumefaciens (Smith and Townsend) Conn. It is a soil-
inhabiting. Gram-negative rod-shaped bacterium with a wide range of hosts
among higher plants including many dicotyledonous plants and some non-
graminaceous monocots (Suseelan et al., 1987; Grimsley, 1990). One study
estimated that at least 600 plant species from 331 genera are susceptible to
infection by A. tumefaciens (DeCleene and DeLey, 1976). Because of its broad
host range, crown gall is a world-wide problem.
This disease attacks nursery stocks, young plantings, and mature trees,
shrubs and lianas leading to serious economic losses. The annual financial
losses due to crown gall in the U.S. were last estimated to be $23 million on fruits
and nuts alone (Kennedy and Alcron, 1980). With the increased acreages of fruit
and nuts crops during last two decades, the economical losses due to crown gall
are probably higher than the previous estimation.
Agrobacterium tumefaciens induces tumorous growth after attachment
and invasion at the wound site of a sensitive host. Once formed, tumor tissue
retains its phenotype even in the absence of the inciting bacteria. Tumor can be
maintained indefinitely in an axenic culture (White and Braun, 1941; Braun,
1958). Biochemical studies revealed the existence of a unique nitrogenous
substance in the tumor tissue (Liorel, 1956; Morel, 1956). Later, these
compounds were identified as unusual amino acids and named "opines" (Petit et
al., 1970). In 1969, Kerr isolated a virulent biovar 1 strain from galls that were
induced by a mixed culture of an avirulent biovar 1 strain and virulent biovar 2
strain. This finding not only eliminated virulence as a basis for Agrobacterium
classification but also clearly implicated the virulence factor as a mobile entity. In
a search to determine the genetic basis of Agrobacterium virulence, Braun
(1959) suggested that a cytoplasmic entity or particle could be responsible for the
virulence and that this entity may or may not be under chromosomal control.
Later on, researchers from different laboratories found that a large plasmid was
required for virulence and this plasmid was denoted Ti plasmid for tumor-
inducing plasmid (Van larebeke et al., 1974; Watson et al., 1975; Zaenen et al.,
1974;).
The discovery of the TI plasmid was a very important event in determining
the mechanisms of Agrobacterium infection. It also triggered a cascade of
questions and hence more advances. In 1977, Chilton and co-workers provided
evidence that the Ti plasmid is the virulence factor. In their experiments, they
detected hybridization between Ti palsmid DNA and DNA isolated from axenic
gall tissue. Later studies showed that tumorous tissue contains a fragment of the
Ti plasmid, called the transferred DNA (T-DNA) (Chilton et al., 1980; Yadav et al.,
1980). Among the genes that reside on the T-DNA are genes coding for auxin
and cytokinin biosynthesis (Akiyoshi et al., 1984; Thomashow et al., 1984). The
expression of these genes induces a hormonal unbalance, which causes
uncontrolled cell growth. The other major T-DNA genes code for opines (Guyon
et al., 1980). The catabolism of opines is limited to the inciting bacteria, giving it
a survival advantage.
The Agrobacterium -plant interaction is a very unique system. It provides
the opportunity to manipulate the genome of many plants. These advances
contributed tremendously in the birth of a new field, plant genetic engineering,
which relies upon transgenic plants. One of the remarkable implications of this
field is the birth of a new industry, plant biotechnology. This industry is
revolutionizing the way crop improvement is achieved.
Agrobacterium also provides a model system for other plant host-
pathogen interactions. Por example, iaaM and iaaH genes of Pseudomonas
syringae pv. Savastanoi are highly similar to the auxin biosynthesis genes of
Agrobacterium (Yamada et al., 1985). Agrobacterium tumefaciens and human
rickettsial pathogen Rochalimaea quintana share 93% sequence identity in their
16S ribosomal RNA's. They also share a striking similarities in the way they
interact with their hosts (Weisburg et al., 1985).
1.2 Agrobacterium vitis
The genus Agrobacterium belongs to the alpha subdivision of the class
Proteobacteria. It is a member of the Rhizobiaceae family and it is closely
related to the Rhizobium, Phyllobacterium and rickettsiae (Holmes and Robert,
1981; Moore at al., 1988; Young and Citosvsky, 1991). Ochman and Wilson
(1987) reported that the divergence between Agrobactrerium and Rhizobium took
place approximately 250 million years ago. Strains of A. tumefaciens have been
divided into three biovars based on selected physiological and biochemical
characteristics. Biovar 3 was originally identified when Panagoupoulos isolated
Agrobacterium strains responsible for crown gall on grapevines in Greece
(Panagoupoulos and Psallidas, 1973). Some of the isolates were identified as
neither biotype 1 or 2. Later the new isolates were called biovar 3 (Kerr and
Panagoupoulos, 1977). Because of the strong association between biovar 3 and
grapevines, Ophel and Kerr (1990) renamed biovar 3 as Agrobacterium vitis.
Agrobacterium is divided into five species based on their Ti plasmid
characteristics, A. tumefaciens, A. radiobacter, A. rhizogenes, A. rubi, and A. vitis
(Often et al., 1992). One of the unique characteristics of A. vitis is its ability to
produce endo-polygalacturonase and p-1,4-endoglucanase enzymes (Bishop et
al., 1988; Ophel and Kerr, 1990) and its limited host range (Burr and Khatz,
1983). Kerr and Pangopoulos (1977) first described A. vitis from grapevine and
reported that these strains could only infect a limited number of hosts. Most A.
vitis strains are naturally limited to grapevines, whereas most of the other strains
have a wide host range (Anderson and Moore, 1979). There are several
biochemical tests used to separate between various biotypes. These are
chromosomally encoded traits. A. vitis can be distinguished by its ability to use
tartrate, citrate and malonate; the inability to use erythritol, melezitose, propionic
acid, and mucic acid; a negative 3-ketolactose reaction and ability to grow in 2%
NaCI (Moore et al., 1988). A. vitis can also be effectively distinguished from
biovar 2 strains because of its growth on potato medium supplied with 0.08%
calcium carbonate (Bouzar and Jones, 1992).
Unlike other Agrobacterium species A. vitis can grow on tartrate.
Grapevines are known to contain high levels of tartrate (Ruffner, 1982). Szegedi
(1985) was able to distinguish A. vitis from other Agrobacterium strains by their
tartrate utilization properties. Tartrate utilization may represent an adaptation to
grow in grape tissue. This gives a survival advantage to A. vitis over other
strains. This can also implicate tartrate's role in the narrow natural host range of
A. vitis. Early work has demonstrated that the tartrate-utilizing capacity is
encoded by a plasmid (Gallie et al., 1984). In 1992 Szegedi and co-workers
found that several A. vitis strains contain a large plasmid encoding tartrate
utilization, as shown by transfer to A. tumefaciens recipient strain UBAPP2 by
conjugation. However, a recent study showed that in limited-host-range strains
with a small T-DNA A region (small TA) of A. vitis such as AB3, the tartrate
utilization is under two functional tartrate utilization (TAR) regions. One is on a
cryptic plasmid (pTr) and the other is on the pTi plasmid (Often et al., 1995).
Recently. Dr. Otten's group in Strasbourg, Prance, has functionally characterized
the TAR regions. They found that each TAR region codes for the following
factors: a regulatory LysR-like protein, a tartrate permease, a tartrate
dehydrogenase (TDH), a potential reducatase which may catalyze the second
tartrate degradation step, and a pyruvate kinase required for optimal grov^h on
tartrate. Another TDH copy is present to the right of the TAR region, for which
the function is still unknown (Often, 1997).
1.3 A. vitis is a grapevine pathogen
Crown gall is a common disease on grape and is mainly caused by A. vitis
(Tarbah and Goodman, 1986). Burr and Katz (1983) were able to isolate virulent
A. vitis and other avirulent Agrobacterium strains from the rhizosphere of
grapevine plants. The predominance of A. vitis in grape was demonstrated long
ago when Cavara (1897) isolated crown-gall-inducing bacteria from diseased
grapevine canes. Also, reports from Greece (Panagopoulous and Psallis, 1973),
Hungary (Sule,1978) and the united states (Burr and Hurwitz,1981; Burr and
Katz, 1983) have identified A. vitis as the predominant strain associated with
grapevines.
Reports of the presence of crown gall associated with grapes are
numerous (Galloway, 1889; Hedgcock, 1910). Historically, crown gall disease
contributed to the destruction of many vineyards in Europe (Owens, 1928) and is
widely distributed in temperate zones. A. vitis caused great losses in New York
vineyards, especially on cold-sensitive cultivars (Burr, 1978). Ophel et al. (1988)
reported that A. vitis was present in grapevines grown in South Australia. Later
reports indicated that A. vitis bacteria were present at different levels in rootstock
and scion material from New South Wales, Victoria, and Western Australia
(Gillings and Ophel-Keller, 1995). In general, Agrobacterium overwinters in soil,
where it can exist for many years as a saprophyte (Agrios, 1988). Once a
susceptible plant is wounded due to frost or cultural practices, Agrobacterium
takes advantage of this condition to invade the plant cells and eventually cause
tumor growth. Structurally, crown galls first appear as small, spongy and watery
overgrowths on the stem or roots, which is formed mainly of parenchymatous
tissue. As the tumor grows, it develops into curled and distorted masses of
woody cells, and as the peripheral material tissue decay, the tumor tissue turns
dark brown or black (Hedgcock, 1910; Agrios, 1988). There are two forms of
galls that are associated with grapevines. The first and most frequent is root
galls. This form of galls is predominantly found during early stages of plant
development. It is characterized by a spherical, fleshy overgrowth from the roots
of young plants propagated from cuttings or at the intersection of scion and
rootstock in grafted plants (Burr, 1978). The other form is called cane galls, also
known as aerial galls. This form is frequently found on mature vines along the
line of the point of a wound injury. Aerial galls are more associated with freezing
injury (Lewitt, 1972) and can extend from the crown area to the main and lateral
canes (Burr, 1978). They are also associated with bad management practices,
such as internal injuries due to improper trellising and pruning (Lehoczky, 1978).
Crown gall on grapevine is a serious disease. It can hinder vine growth
and cause cane death if the vine is severely galled. Vines with galls are less
vigorous than non-infected plants and are susceptible to freezing and desiccation
(Chamberlain, 1962).
In addition to crown gall disease, A. vitis induces electrolyte leakage and
strong necrotic lesions on the roots of grapevine (Burr et al., 1988 ; Strover et al.,
1997). This is because A. vitis produces the extracellular enzymes
polygalacturonase (PG) and endoglucanase that degrade root epidermal tissue
(Ophel and Kerr, 1990; Rodriguez-Palenzula et al., 1991). Certain A. vitis strains
induce only a necrotic response in grape stems (Yanofsky et al., 1985a, 1985b;
Pu and Godman, 1992). This response is not related to the PG enzyme but to
the sensitivity of grapevine to high levels of auxin. These enzymes are normally
produced by pectolytic plant pathogens (Collmer and Keen, 1986). McGuire et
al. (1991) was able to isolate PG from necrotic lesions on grape roots induced by
A. vitis. They also reported that PG was produced by Ti-plasmid-carrying strains
8
as well as TMucking strains (McGuire et al., 1991). This suggested that the PG
is encoded by a chromosomal located locus. Mutational analysis revealed that
the pheA locus is involved in PG production (Brisset et al., 1991; Rodriguez-
Palenzula et al., 1991). An A. vitis mutant carrying a Tn5 insertion in the pheA
gene failed to form necrotic lesions, poorly attached to the plant cell and
produced small abnormal tumors. These observations suggest a broader role of
the pheA gene in tumorgenesis. Herlache et al. (1997) sequenced the A. vitis
pheA gene and found that the predicted protein is significantly similar to the
polygalacturonases of Erwinia caractovora and Ralstonia solanacearum. In the
same study, they reported that PheA protein is accumulated mainly in the
periplasm of the bacterium and it is able to produce dimers, trimers and
monomers from polygalacturonic acid (Herlache et al., 1997). Such compounds
are probably used to stimulate the virulence system of A. vitis, since galacturonic
acid has been reported to activate virulence gene of Agrobacterium tumefaciens
(Ankenbauer and Nester, 1990).
The necrotic lesions induced by A. vitis on the roots of grapevine were
shown to be hormonally mediated. Deng et al. (1995) generated mutants by
transposon mutagenesis from a necrosis inducing strain A281 and found that at
least two genes, tms1 and 6b, are responsible for the necrogenesis (Deng et al.,
1995). Both genes are known for their involvement in biosynthesis and
modulation of auxin (Thomashow et al., 1984; Hooykass et al., 1988). The ability
of A. vitis to live in the vascular system of symptomless plants make its control
very difficult to achieve (Tarbah and Goodman, 1986), and vegetative
propagation without proper indexing can result in great loss of vine.
1.4 The o\an{-Aarobacterium interaction
The molecular basis of the Agrobacterium interaction with its host can be
divided into six separate stages: Attachment and signal perception, activation of
virulence genes, T-DNA processing, T-DNA transfer, integration of T-DNA, and
finally T-DNA expression and tumor formation. Figure 1.1 shows an overall
summary of these stages.
1.4.1 Attachment and signal perception
In general, the attachment step is a prerequisite for many host-pathogen-
interactions. Animal viruses and bacterial pathogens, for example, require
specific binding sites on the host cell surface to initiate infection. Agrobacterium
is similar to other microbes in this aspect. The infection process starts when
bacteria are attracted to a wound site and bind to the plant cell (Douglas et al.,
1985; Matthysse, 1987; Thomashow et al., 1987). The attachment process is a
very important step in achieving a compatible interaction. Competition over the
plant cell binding sites between virulent and avirulent strains of bacteria inhibits
tumor formation (Lippincott and Lippincott, 1969).
Using scanning electron microscopy, Matthysse et al. (1981) and
Matthysse (1983) showed that A. tumefaciens binds to carrot suspension cells
10
3. T-DNA processing
5. Nuclear Targeting
VitCl
2b. Transcription/Translation of Vir proteins
4. Transport to plant
6. integration into Genome and Expression of" Oncogenes
AGROBACTERIUM DICOT PLANT CELL
Pig. 1.1. Overview of the Agrodactent/m-plant Interaction. Modified from Heath etal., (1995)
11
within 30 minutes and that the number of attached bacteria increase over an
eight-hour period. In the same experiment, long curving cellulose fibrils
projecting from the bacterial cell surfaces were detected. Their role is not a
major one in the attachment step, since cellulose-deficient mutants can attach to
plant cells. It appears that they help the bacteria attach tightly to the plant host
cell after the initial attachment takes place (Binns and Thomashow, 1988).
Several chromosomally located genes have been implicated in attachment
of the bacteria. Mutation analysis showed that cyclic-p-1,2-glucan plays a major
role in the attachment process. Mutations at the chvA and chvB loci render the
bacteria avirulent due to their inability to attach to the plant cells (Douglas et al.,
1982, 1985). Biochemical analysis showed that these mutants could not
synthesize cyclic-p-1,2-glucan (Puwanesarajh et al., 1985). Another
chromosomally encoded gene is exoC which codes for proteins involved in the
synthesis and transport of cyclic-p-1,2-glucan and extracellular polysaccharide
(Puwanesarajh et al., 1985; Cangelosi et al., 1987).
1.4.2 Activation of virulence genes
Pollowing the attachment of the bacterial cell on the plant cell, the
virulence genes are activated through a well-defined signal transduction
pathway. The wrgenes on the Ti plasmid are present as a virulence regulon.
The virA, B, C, D, E, F, G, H, and J operons are required for successful plant
12
transformation (Stachel and Nester, 1986). Although the roles of most operons
have been determined, no jnfomiatlon on the function of virF, virH and virJ is
known.
The wounded plant cells divide faster than normal cells in an attempt to
repair the wound. Accompanying this process is a release of phenolic
compounds, such as acetosyringone, sinaplnic acid and simple sugars which act
as signal molecules that activate the two-component regulatory system under the
control of virA and virG (Cangelosi et al.. 1990; Stachel et al., 1985; Charles et
al.. 1992). The wrgenes are expressed at very low levels until induced by plant
phenolic compounds (Stachel et al., 1986a). VirA and VirG are essential for
plant transformation and they are similar to other bacterial two-component
regulatory proteins that sense environmental conditions (Parkinson and Kofoid,
1992). VirA Is the environmental sensor and VirG is the response regulator or
transcriptional activator (Stachel and Nester, 1986).
The VirA protein Is a histidine protein kinase with two transmembrane
spanning regions identified as TM1 and TM2 (Winans et al., 1989). However, it
is present as a homodimer In the Inner membrane (Pan et al., 1993). The simple
sugars bind to the periplasmic galactose binding protein ChvE (Cangelosi et al.,
1990; Huang et al., 1990) which In turn interacts with VirA at the periplasmic
domain that is held intact by TM1 and TM2 (Cangelosi et al., 1990). The
periplasmic domains of VirA and the Tar protein in Escherichia coli, which senses
and promotes chemotaxis toward sugars, share high sequence homology
13
(Melchers et al., 1989). This observation led to the hypothesis that the
periplasmic domain of VirA binds directly to acetosyringone (Melchers et al.,
1989). However, the deletion of the VirA periplasmic domain did not result in a
loss of wrgene induction by acetosyringone (Melchers et al., 1989; Shimoda et
al., 1990). This shows that the VirA periplasmic domain is not necessary for
induction by acetosyringone, but is very important to enhance induction by
certain sugars in cooperation with ChvE (Shimoda et al., 1990; Cangelosi et al.,
1990). Phenolic compounds, however, bind VirA directly via the linker domain
adjacent to the second transmembrane domain (Lee et al., 1995). The binding of
inducer molecules stimulates VirA to autophosphorylate at a conserved histidine
residue (His-474). The phosphate is then transferred to an aspartate residue
(Asp-52) on VirG . The compounds secreted by the plant increase the
expression of VirA five- to ten-fold (Winans et al., 1988; Rogowsky et al., 1987).
In 1947, Braun reported that A. tumefaciens would induce tumors only at
temperatures below 32 °C. To explain this observation, Jin and co-workers
(1993) noted that VirA is inactive at temperatures higher than 32 °C due to the
fact that the autophosphorylation of VirA does not occur (Jin et al., 1993). In the
same study, Jin noted that a virG mutant strain, which induce wrgenes without
VirA, is also unable to transform host plants at temperatures above 32 °C,
indicating that other Vir proteins may also be temperature-sensitive.
VirG contains two domains, a DNA-binding domain and a receiver domain
(Winans et al., 1994). At the C-terminus, is a helix-turn-helix DNA-binding
14
domain which binds to the 12-bp conserved sequences, known as wr boxes,
located upstream of each of the wr operons (Jin et al., 1990; Powell et al., 1990;
Powell and Kado, 1989). The N-terminal domain is the phosphorylated site. The
phosphate is transferred to an aspartate residue (Asp-52). This residue is very
important in the process of phosphorylation and hence in the activation of vir
genes. A mutation that changes an aspargine at position 54 to an aspartic acid
resulted in wrG constitutive expression (Jin et al., 1993; Sheeren-Groot et al.,
1994).
In addition to VirA and VirG regulating virulence, there are also several
chromosomal genes involved in wrgene regulation. One of them is the ros gene
that encodes a repressor of the promoter region of the wrC and virD operons
(D'Souza-Ault et al., 1993), which are transcribed in opposite directions. In the
absence of Ros, wrC and virD are constitutively expressed (Close et al., 1987).
Unlike VirG, Ros protein binds to the targeted sequences using its zinc-finger
DNA-binding domain (Cooley et al., 1991 and D'Souza-Ault et al., 1993). The
VirG and Ros binding sites overlap in the promoter region. Once activated, VirG
overcomes the repression by Ros. Another important chromosomal locus is
miaA, which encodes t-RNA: isopentenyl transferase activity. Mutations at miaA
decrease expression of wrgenes by two- to ten-fold (Gray et al., 1992). In
addition, ivr, acvB , and chvG/chvl chromosomal genes have also been
implicated in wr activation (Mantis and Winans, 1993; Metts et al., 1991).
15
However, their specific role in the process of transformation remaines unknown.
Prom the present data, it appears that chromosomally encoded virulence genes
are important and may play a major role in the process of signaling, transducing,
and activating the Ti wrgenes.
1.4.3 T-DNA processing
The T-DNA is flanked by 25-bp imperfect repeat called the T-DNA border
regions (Yadav et al., 1982; Baker et al., 1983). Different Ti plasmids have T-
DNA with different compositions. Por example, the T-DNA in the nopaline-Ti
plasmids is a single stretch flanked by a left border (LB) and right border (RB)
(Willmitzer et al., 1983; Wang et al., 1984). On the octopine-type Ti plasmid, the
T-DNA has multiple border sequences, which split the T-DNA into right region
(TR), central region (TC) and left region (TL) (Stachel and Nester, 1986). The
TR region is 7.8 kb and encodes genes involved in opine synthesis; the TC is 1.5
kb of unknown function and the TL is 13 kb and encodes auxin and cytokinin
biosynthesis (Hooykaas and Schilperoort, 1992). Mutational analysis showed
that the right border is required for virulence, while the left border was not
essential. When the right border was inverted, virulence was reduced
dramatically and nearly all the Ti plasmid was transferred instead of the T-DNA
(Citovsky et al., 1992a; Zambryski, 1992).
Pollowing wrgene induction, T-DNA borders are recognized by the
VirD1A/irD2 complex. VirDI and VirD2 are endonucleases that introduce a site-
16
and strand-specific nick in the bottom strand of the right border between the third
and fourth base pairs (Yanofsky et al., 1986; Jasper et al., 1994). In vitro studies
have shown that VirD2 is able to introduce a nick in the bottom strand of the right
border (Jayaswal et al., 1987; Jasper et al., 1994), and VirDI has type I
topoisomerase activity and is able to relax a supercoiled DNA (Ghai and Das,
1989). At least in vitro, the nicking reaction needs only VirD2 to process single-
stranded templates (Pansegrau et al., 1993; Jasper et al., 1994) but requires the
addition of VirDI to process double-stranded templates (Vogel and Das, 1994;
Scheiffele et al., 1995). Over-expression of VirDI and VirD2 in A. tumefaciens
increased plant transformation efficiency and tumor size on Kalanchoe
daigremontiana and Daucus carota L. (Wang et al., 1990).
Nicks occur within four hours after wrgene activation (Jayaswal et al.
1987). These nicks serve as the initiation and termination sites for T-strand
production (Albright et al., 1987; Veluthambi et al., 1988). The nicked strand of
the right border provides the 3' hydroxyl group for replication initiation, and the
top strand provides a template. The release of the T-strand has been
hypothesized to take place by DNA replication and strand displacement (Stachel
et al.,1986b; Albright et al., 1987). Pollowing the nicking, the tyrosine-29 residue
of VirD2 covalently binds to the 5' end of the T-strand giving the T-DNA complex
a polar character (Pilichkin and Gelvin, 1993; Zupan and Zambryski, 1995).
Site-directed mutagenesis manipulation in which each tyrosine in VirD2 was
changed to a glycine showed that the tyrosine-29 residue is required for
17
endonuclease activity and it Is very important in the DNA-protein complex (Vogel
and Das, 1992a).
The VirCI is another virulence factor thought to interact with VirD2.
During T- strand processing, VirCI binds to an upstream site adjacent to the right
T-DNA borders called "overdrive" which increases tumorigenicity (Peralta and
Ream, 1985; Peralta et al., 1986; Toro et al.,1989). Mutants with insertion
mutations in VirCI and VirC2 have weak virulence, which is also a characteristic
of strains with deleted overdrive sequences (Ji et al., 1988). Toro et al., (1989)
showed that VirCI binds with very high affinity to overdrive in a gel retardation
assay. The same group also suggested a possible interaction between VirD2,
VirCI and other bacterial factors during T-strand transfer (Toro et al., 1989).
VirCI was found to increase T-strand production from the octopine Ti plasmid in
E. CO//when VirDI and VirD2 are limiting (De Vos and Zambryski, 1989). There
are also speculations that bacterial housekeeping proteins of DNA repair, like
helicases, may be involved in the T-strand production (Jinsong and Citovsky,
1996).
It is important to note the striking similarities between VirDI A/irD2 with the
TraJ and Tral proteins encoded by lncPRP4 plasmid found in a pathogenic
Pseudomonas strain (Kado, 1994; LessI and lanka, 1994). IncP RP4 is a
conjugative broad-host-range plasmid that can be transferred to Gram-negative
bacteria, Gram-positive bacteria and to yeast (LessI and Lanka, 1994). Similar to
VirDI A/irD2, Tral/TraJ are required for site-and strand-specific cleavage of the
18
origin of transfer (ohT) of RP4 (Pansegrau and Lanka, 1991). Surprisingly. VirD2
can process the IncP plasmid oriT in vitro, but Tral is unable to process a T-DNA,
which suggests a higher specificity of Tral to Its sequences (Pansegrau et al.,
1993). Another report indicated that VirD4 and VirB proteins can complement
TraG and Tra2 proteins during conjugation between Agrobacterium cells of
another plasmid called IncQ RSP1010, (LessI and Lanka, 1994). All of these
results show significant similarities between T-DNA transfer and bacterial
conjugation.
1.4.4 T-DNA transfer
The process of T-DNA transfer involves many membranes and cellular
spaces before the T-DNA enters the plant nucleus. The role of virB, virE and
virD in T-DNA transfer has been well documented. The gene products of virB
and virD form a putative channel, while wrE encodes a single-stranded binding
protein that coats the T-DNA strand preventing nucleolytic degradation.
The VirB is the largest wroperon (10.2 Kb) with 11 open reading frames
(Thompson et al., 1988; Kuldau et al., 1990; Shirasu et al., 1990). Beijersbergen
et al. (1994) studied the localization and topology of virB proteins and found that
most contain cleavable signal sequences or hydorophobic domains. Several
other studies have focused on individual VirB proteins using phoA fusions,
immunoblots and sequence analysis (Manoil et al., 1990; Shirau and Kado, 1993;
Pernandez et al., 1996a). VirBI and VirB2 are localized to both the inner and
19
outer membranes (Shirasu and Kado, 1993; Thorstenson et al., 1993). VirB3 are
mainly localized to the outer membrane (Shirasu and Kado, 1993). VirB4 and
VirB11 are localized to the inner bacterial membrane and are thought to provide
energy for T-DNA strand transfer. VirB4 has a nucleotide-binding site (Shirasu
and Kado, 1993), and VirB11 is both an ATPase and a protein kinase (Christie et
al., 1989). Mutation in wrBII eliminating the nucleotide- binding site caused an
avirulent phenotype (Stephens et al., 1995), suggesting a major role of VirB11 in
T-DNA transport. VirB5 is a periplasmic protein, and VirB6 is an inner membrane
protein with five transmembrane loops (Beijersbergen et al., 1994). VirB7 is a
membrane-associated lipoprotein with its amino terminus anchored to the outer
membrane and its carboxyl domain in the periplasmic space (Pernandez et al.,
1996a). VirB8, VirB9 and VirBI 0 have been localized to the inner and outer
membrane or both depending upon the fractionation method used (Shirasu and
Kado, 1993;Thorstenson et al., 1993; Thorstenson and Zambryski, 1994). Other
studies have shown that there are a lot of interactions between different VirB
proteins. Por example, VirB9 is required for VirBI 0 complex formation and
stability (Beaupre et al., 1996), and VirB9 accumulation requires the production
of VirB8, the stability of which depends on a disulfide cross-link to VirB7 (Berger
and Christie, 1994; Pernandez et al., 1996b; Spudich et al., 1996). It is important
to note that VirB proteins function as a complex that forms a multiproteln channel
structure. This is very similar to other protein-protein interactions involved in the
20
formation of virulence-associated P pili in Gram-negative bacteria (Kuehn et al.,
1993). In a series of elegant experiments, Pullner and collaborators (1996)
showed that pili were present on Agrobacterium cells when grown at low
temperature, and that these pili required the presence of virB2-11 and virD4
genes. The virB1 gene was required for pilus assembly and conjugative transfer.
These results add more evidence that the T-DNA transfer from bacteria to the
plant cell may mimic the naturally occurring conjugative plasmid transfer between
bacteria.
Zupan and Zambryski (1995) suggested that the transfer of the T-DNA
strand is likely to be as a single-stranded DNA-protein complex in order to
preserve its integrity. Besides VirB operon proteins, the other proteins most
important at this phase are encoded by the wrE operon. The wrE operon
encodes two proteins, VirEI and VirE2. Both VirE proteins are required for
tumorigenesis (Winans et al., 1987; McBride and Knauf, 1988). VirE2 is located
mainly in the cytoplasm, but may exist in the inner or outer membrane and
periplasm (Christie et al. 1988). This protein is a single-stranded DNA binding
(SSB) protein without sequence specificity (Christie et al., 1988; Citovsky et al.,
1989) but with high affinity to only single-stranded DNA (Sen et al., 1989). It
completely coats the T-DNA strand preventing nucleolytic degradation and is
believed to extend the ssDNA to a narrow diameter thus facilitating its transfer
via membrane channels. Using electron microscopy and in vitro VirE2-ssDNA
binding kinetics, Citovsky et al. (1989) estimated that the molecular mass of the
21
T-DNA complex is around 50,000 kD, with a length of 3600 nm and a width of 2
nm, and that it contains approximately 600 molecules of VirE2. These data
suggest that the T-DNA complex is a very stable structure and it is likely to be
unaccessible to external nucleolytic activity. Whether SSB proteins bind to
ssDNA inside the bacterial cell or inside the plant cell is still not clear. However,
recent data suggest that both T-strand and VirE2 proteins are transported
independently into the plant cell. Pirst, Citovsky reported that transgenic plants
expressing VirE2 restore virulence of a VirE2-mutant (Citovsky et al., 1992b).
Second VirEI is implied to have a functional role in transporting VirE2 from the
bacterial cell into the plant cell. In this study a VirEI-deficient mutant with normal
VirE2 expression and T-DNA strand was avirulent; however, when coinoculated
with a strain having normal amounts of VirEI and VirE2 but lacking a T-DNA
strand, it became virulent (Sundberg et al., 1996).
Once the T-DNA strand enters the plant cell, it is targeted to the cell
nucleus. The VirD2 protein contains three putative nuclear localization signals
(NLSs) of the protein sequence K-R/K-X-R/K (Herrera-Estrella et al., 1990). One
NLS is located at the N-terminus and the other two in the C-terminus of VirD2.
The deletion of the N-terminal NLS did not affect the transfer of the T-DNA to the
nucleus, which indicates its minor role in this process. However, deletion of both
C-terminal NLSs inhibited the transfer of the T-DNA and subsequently blocked
the tumor formation (Howard et al., 1992; Shurvinton et al., 1992; Rossi et al.,
1993; Narasimhulu et al., 1996). These data suggest that the VirD2 protein,
22
which is covalently linked to the 5' end of T-DNA strand is a major player in
targeting the T-DNA strand to the nucleus. Other studies have also implicated
VirE2 in the process of nuclear targeting. Using VirE2-GUS fusions, VirE2 was
localized in the plant nucleus (Citovsky et al., 1992b). The same experiment also
identified two functional NLSs within the VirE2 molecule. Citovsky et al. (1994)
found that transgenic plants expressing a mutant VirE2 that is unable to bind
ssDNA but retains both NLSs were relatively resistant to wild-type
Agrobacterium. This shows that the mutant VirE2 competed with the incoming T-
strand complex for nuclear transport. Direct evidence that the VirE2 protein is
involved in nuclear uptake was provided by Zupan et al. (1996). They
microinjected a complex of VirE2 and fluorescently labeled ssDNA and labeled
ssDNA alone into stamen hair cells of Tradescantia virginiana and monitored the
localization of the complex by epifluorescence microscopy. They found that
ssDNA alone remained in the cytoplasm, while the VirE2-ssDNA complex was
localized in the plant cell nucleus.
1.4.5 Integration of T-DNA
Once inside the nucleus, the T-DNA is dissociated from the T-complex
and is integrated into the plant genome. The mechanism by which the physical
integration takes place is not well understood. Also, It is not clearly known yet
whether the integration requires a double-stranded DNA intermediate.
23
Mapping studies have shown that T-DNA can be inserted into any site on
the plant chromosome (Ambros et al., 1986; Chyi et al., 1986). Although several
studies have suggested that integration preferentially occurs at transcriptionally
active sites (Herman et al. 1990; Koncz et al. 1989), no specific sequences have
been identified as a preferential site of T-DNA integration.
Since T-DNA does not encode proteins allowing its integration like
retroviruses and transposons, it is likely that either transported proteins from the
bacterium or plant factors enable integration. Recent data suggest that VirD2
and VirE2 may be involved in the integration process (Tinland et al., 1995). In
this study, an Agrobacterium strain with a wrD2 mutation was used to infect
tobacco seedlings. T-DNA strand integration by the mutant was less than 1% of
the wild type. This difference was attributed to the fact that the 5' end of the
integrated DNA was truncated and highly rearranged.
VirD2 has a motif very common to many recombinases (Argos et al.,
1986). The mutant used in the Tinland et al. (1995) study had a mutation at this
motif Rossi et al. (1996) investigated the role of VirE2 on T-DNA integration
using the same procedure as Tinland et al. (1995). They found that VirE2
influenced the T-DNA integration and was required for integration fidelity at the 3'
but not the 5' end of the T-strand molecule (Rossi et al., 1996). Shurvinton et al.
(1992) studied in detail the early transcription of T-DNA in plant nuclei and found
a short amino acid sequence downstream of the VirD2 NLS which they
designated the co domain. This domain was later found to be necessary for T-
24
DNA integration (Narasimhulu et al., 1996). Whatever the case, the integration
of T-DNA is thought to be achieved by illegitimate recombination (Gheysen et al.,
1991). However, homologous recombination can occur when large sequences of
homology exist between the T-DNA and integration site (Offringa et al., 1990).
Homologous recombination was also the mode of T-DNA integration following
infection of yeast (Bundock et al., 1995). These results suggest that the way T-
DNA integrates into the host DNA is dependent on the host genome structure
and organization.
1.4.6 T-DNA expression and tumor formation
The observation that axenic crown gall tumors could be cultured in vitro
without exogenous phytohormones, led to the speculation that Agrobacterium
altered the hormonal balance of the infected plant tissue (Braun, 1958). In his
pioneering work, Braun (1958) showed that tumors exhibited auxin-like growth
effects. Subsequent studies confirmed Braun's work and provided more
evidence on the role of auxin and cytokinin and their metabolism in tumor
formation (Morris, 1986, 1987).
Unlike other steps, tumor formation is controlled and regulated by genes
encoded by T-DNA. The T-DNA genes are expressed using plant cell's
polymoreses. However, the expression levels vary among the different T-DNA
genes (Langridge et al., 1989; Leisner and Gelvin, 1989; Mitra and Ann, 1989).
Beside phytohormone genes, the T-DNA also contains a set of genes required
25
for the production of opines. Opines are modified amino acids and sugar
derivatives, used as carbon and nitrogen sources by Agrobacterium. This gives
a survival advantage to the inciting Agrobacterium over all other soil microbes
(Guyon et al., 1980; Tempe and Goldmon, 1982; Petit et al., 1983).
Using transposon mutagenesis, Garfinkel et al. (1981) identified two
important loci within T-DNA that control tumor morphology: tms (tumor
morphology shooty) and fmr (tumor morphology rooty). Mutations in the tms
locus induced tumors with shoot-like teratomas, while mutation in the tmr locus
induced tumors with roots. The comparison of these observations with the
pioneering work of Skoog and Miller (1957) suggested the role of auxin and
cytokinin. Skoog and Miller (1957) showed that a high cytokinin/auxin ratio will
promote shoot formation, a low ratio will promote root formation and intermediate
ratio induces an unorganized callus. Later, Akiyoshi et al. (1983) showed that
the levels of auxin and cytokinin were much higher in tumors caused by wild type
compared to tumors induced by tms mutants or fmr mutants. These results
provided evidences that crown gall tumors are the result of hormonal unbalance.
1.4.6.1 Auxins
The T-DNA of the octopine Ti plasmid is divided into separate TR-DNA
and TL-DNA regions (Thomashow et al., 1980). Transcriptional and genetic
analysis of T-DNA from various octopine plasmids revealed that eight
polyadenylated mRNA's are transcribed from the TR-DNA region and five from
26
TL-DNA (Gelvin et al., 1982; Willmitzer et al.,1982 ,1983). Baker et al. (1983)
sequenced the entire T-DNA from an octopine Ti plasmid and showed that there
are two open reading frames (ORP) within the tms (tms1 and tms2) locus and
one within the fmr locus. It was also found that tms1 encodes a large ORP and
tms2 encodes a smaller ORP. These ORP's are oriented in opposite directions
(Baker etal., 1983).
In 1984, Inze et al. suggested that the tms1 and tms2 (also referred to as
iaaM and iaaH, respectively) products are involved in a pathway-like process,
which may involve a diffusable intermediate. Basically, they coinfected a plant
host with two A. tumefaciens strains, one with a mutation in iaaM and the other
with a mutation in the iaaH gene. The resulting tumors were similar to a-wild-
type induced tumor (Inze et al., 1984). To identify the diffusable intermediate,
Thomashow and coworkers expressed the iaaH and iaaM genes in E.coli and
found that iaaH encodes an enzyme that converts indole-3-acetamide (lAM) to
indole-3-acetic acid (lAA) (Thomashow et al., 1984), while iaaM encodes an
enzyme that converts L-tryptophan to lAM (Thomashow et al.,1986). The gene
product of /aa/W was called tryptophan 2-monooxygenase, and the iaaH product
was called indoleacetamide hydrolase.
Later on, other researchers confirmed these findings independently
(Schroder et al.,1984; Van Onckelen et al., 1986), and the auxin biosynthesis
pathway was established as a two-step process in which the iaaM and iaaH
genes act sequentially to convert tryptophan to lAM and then to indole-3-acetic
27
acid (Thomashow et al. 1986). The first step, which is catalyzed by tryptophan 2-
monooxygenase, involves oxidative decarboxylation of tryptophan; then lAM is
hydrolyzed by indoleacetamide hydrolase to produce lAA (Kosuge et al., 1983).
Pigure 1.3 shows the chemical pathway of auxin synthesis by Agrobacterium.
It is important to note that auxin biosynthesis and its role in pathogenesis
is not unique to Agrobacterium strains. Another pathogen, Pseudomonas
savastanoi, induces tumorous overgrowths on oleander and olive plant.
Pseudomonas savastano has the same auxin biosynthesis pathway (Hutcheson
and Kosuge, 1985). Contrary to Agrobacterium, auxin production in
Pseudomonas savastanoi occurs in the bacterium, but the genes involved are
highly homologous to the iaaM and iaaH from T-DNA (Yamada et al., 1985).
Agrobacterium rhizogenes is known to induce hairy roots in transformed tissue.
This is due to the presence of a pathogenic Ri plasmid that carries genes
homologous to the auxin biosynthetic loci of the Ti plasmid (Huffman et al., 1984;
Cardarelli et al., 1987). Auxin production is also involved in the symbiotic
interaction between Rhizobium species and their hosts (Morris 1986). However,
its biological activity is still unclear. The genetic conservation of auxin
biosynthetic genes among different species may suggest how the T-DNA and
auxin-mediated pathogenicity of Agrobacterium tumefaciens have evolved.
28
Tryptophan H NH
CHCHCOOH H
lndole-3-acetamide
Tryptophan 2-monooxygenase
CHC // \
O
NH H
lndole-3-acetic acid
Indoleacetamide hydrolase
CHC // \
O
OH
Pig. 1. 3. Auxin biosynthesis pathway in Agrobacterium tumefaciens.
29
1.4.6.2 Cytokinins
Biochemical and genetic analysis has revealed that the tmr gene (also
called ipt) is responsible of cytokinin production (Akiyoshi et al., 1984; Barry et
al., 1984; Buchmann et al., 1985). The tmrgene encodes an
isopentenyltransferase enzyme which catalyzes the addition of an isopentenyl
side chain to the N position of 5'-adenosine monophosphate to yield iso-
pentenyladenosine monophosphate. This product is a precursor for cytokinin
biosynthesis (Taya et al., 1978; Chen and Melitz, 1979).
Many studies have shown the importance of cytokinin in pathogenesis.
Cytokinin may maintain a healthy plant tissue (Miller, 1971) and increase nutrient
mobilization in the host (Angra-Sharma and Mandahar, 1993), which in turn
allows favorable conditions for pathogen proliferation (Mahadevan, 1984; Angra-
Sharma and Mandahar, 1993). Paini et al. (1985) reported that crown gall
tissues have an unusually high and very diverse endogenous cytokinin level.
The same group identified over 15 cytokinins in crown gall (PaIni et al., 1985). It
is not yet clear whether these cytokinins are similar to those produced by normal
tissues. When /pf was inactivated, the isopentenyl transferase activity was lost
and tumor production required an exogenous supply of cytokinin for growth in
vitro (Ooms et al., 1981; Morris et al., 1982; Binns, 1983; Akiyoshi et al., 1984).
Similar to auxins, cytokinins are also involved in other microbe-plant
interactions. Por example they are produced by Pseudomonas savastanoi during
the pathogenic interactions with their host. Surico et al. (1984) reported that in
30
addition to lAA, cytokinins were also produced by P. savastanoi pv. savastanoi io
induce galls on olive and oleander. In 1986, Morris et al. isolated a plasmid
localized gene from P. savastanoi pv. savastanoi denoted (ptz) that encodes for
cytokinin biosynthesis. The ptz gene has a high functional homology with ipt
from Agrobacterium tumefaciens. Cytokinin is also involved in club root
(root gall) disease caused by Plasmodiophora brassicae. These types of galls
have been shown to contain extremely high amounts of auxin and cytokinins
(Dekhujzen and Overeem, 1971; Butcher et al., 1974). Galls in maize caused by
Ustilago maydis contain abnormally high level of cytokinin compare to healthy
plants (Mills and van Staden, 1978).
Beside the iaaM, iaaH and ipt genes, two other T-DNA genes, gene 6b
and gene5 are believed to be involved in accentuating the activity of auxin and
cytokinin (Leemans et al., 1982). Agrobacterium mutants at 6b gene induce
abnormal tumors on certain plants (Ream et al., 1983). Hooykaas et al. 1988
reported that 6b gene can affect the activity of both auxin and cytokinin, and
therefore, they suggested that it can be considered as an one gene. Tinland et
al. (1989, 1990) found an auxin activity associated with 6b gene. However,
others have shown that it reduces cytokinin activity (Spanier et al., 1989).
Although a mutation at gene5 have no significant effect on tumor morphology, it
appears to underscore the effect of mutations at iaaH or iaaM genes (Leemans
etal., 1982). In 1991, Korber et al. suggested that gene5 modulates the auxin
response by the autoregulated production of an auxin antagonist.
31
1.5 Obiectives and Rationale
The grape industry in Texas is important to the state economy. In 1996,
the total economic impact generated by grape industries was estimated to be
$104.6 million. It also supported over 2,220 Texas jobs (Dodd etal., 1996). One
of the active and growing viticultural areas is the Texas High Plains. It
represents 42% of the total Texas grape production (Dodd et al., 1996). It is also
expected that grape acreage will significantly increase during next decade
(Mitchell, 1998).
One of the economically important pathogen associated with grape is
Agrobacterium vitis. Among all fruit and nut crops, grapes showed the highest
economic losses due to Agrobacterium (Kennedy and Alcron, 1980). A. vitis is
also a problem in the Texas High Plains region, especially after severe freezing
temperatures. A total destruction of several vineyards was accredited to A. vitis
in the Texas High Plains (Mitchell, 1998). Due to its systemic nature, A. vitis is
very difficult to control. Usually, replanting is the only solution when infestation is
severe, and since the disease is soil-borne, abundant inoculum exists for
infestation of the new transplants. Therefore, an effective approach to control A.
vitis is needed.
The objectives of this study were:
1. To characterize the predominant pathogenic A. vitis strains associated with
grapes in the Texas High Plains region.
32
2. To use tobacco as a model system to test whether transgenic plants with T-
DNA auxin biosynthetic genes in an antisense orientation would block tumor
formation.
33
1.6 References
Agrios, G. 1988. Plant Pathology. 3rd edition. Academic Press. New York, pp.558-564.
Akiyoshi, D., Morris, R., Hinz, R., Mischke, B., Kosuge, T., Garfinkel, D., Gordon M., and Nester, E. 1983. Cytokinin/auxin balance in crown gall tumors is regulated by specific loci in the T-DNA. Proc. Natl. Acad. Sci. 80:407-411
Akiyoshi, D., Klee, H., Amasino, R., Nester, E., and Gordon, M. 1984. T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proc. Natl. Acad. Sci. USA 81:5994-5998.
Albright, L.M., Yanofsky, M.P., Leroux, B., Ma, D., and Nester, E. 1987. Processing of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear, single-stranded T-DNA. J. Bacteriol. 169:1046-1055
Ambros, P., Matzke A., and Matzke M.1986. Localization of Agrobacterium rhizogenes T-DNA in plant chromosomes by in situ hybridization. EMBO J. 5:2073-2077.
Anderson A . and Moore L. 1979. Host specificity in the genus Agrobacterium. Phytopathology 69:320-323
Angra-sharma, R., and Mandahar, C. 1993. Involvement of carbohydrates and cytokinins in pathogenicity of Helminthosporium carbonum. Mycopathologia 121:91-98.
Ankenbauer, R.G., and Nester, E.W. 1990. Sugar mediated induction of Agrobacterium tumefaciens virulence genes: Structural specificity and activities of monosaccharides. J. Bacteriol. 172:6442-6446.
Argos, P., Landy, A., Abremski, K., Egan, J., Haggard-Ljungquist, E., Hoess, R., Khan, M., Kalionis, B., Narayana, S., Pierson III, L., Sternberg, N., and Leong, J. 1986. The integrase family of site-specific recombinases: regional similarities and global diversity. EMBO J. 5:433-440.
Baker, R.P., Idler, K.B., Thompson, D.V., and Kemp, J.D. 1983. Nucleotidesequence of the T-DNA region from Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2: 335-350
Barry, G., Rogers, S., Praley, R., and Brand, L. 1984. Identification of a cloned cytokinin biosynthetic gene. Proc. Natl. Acad. Sci. USA 81: 4776-4780.
34
Beaupre, C , Dale, E., and Binns, A. 1996. Interaction between VirB membrane proteins involved in the movement of DNA from Agrobacterium tumefaciens into plant cells. J. Bacteriol.
Beijersbergen, A., Smith, S., and Hooykaas, P. 1994. Localization and topology of VirB proteins of Agrobacterium tumefaciens. Plasmid 32:212-218.
Berger, B. and Christie P. 1994. Genetic complementation analysis of the Agrobacterium tumefaciens virB operon: wr82 through virB11 are essential virulence genes. J. Bacteriol. 176:3646-3660.
Binns, A.N., and Thomashow, M.P. 1988. Cell biology of Agrobacterium infection and transformation of plants. Annu. Rev. Microbiol. 42:575-606
Binns, A. 1983. Host and T-DNA determinants of cytokinin autonomy in tobacco cells transformed by Agrobacterium tumefaciens. Planta 158:272-279
Bishop, A., Katz, B., Burr, T., Kerr, A., and Ophel, K. 1988. Pectolytic activity in Agrobacterium tumefaciens. (Abstr.) Phytopathology 78:1551.
Bouzar, H., and Jones, J. 1992. Distinction of biovar 2 strains of Agrobacterium from other chromosomal groups by differential acid production. Letters in Applied Microbiology 15:83-85.
Braun, A. 1947. Thermal studies on the factors responsible for tumor initiation in crown gall. Am. J. Bot. 34:234-240
Braun, A. 1958. A physiological basis for autonomous growth of the crown-gall tumor cell. Proc. Natl. Acad. Sci. USA 44: 344-349
Braun, A. 1959. A demonstration of the recovery of the crown-gall tumor cell with the use of complex tumors of single-cell origin. Proc. Natl. Acad. Sci. USA 45:932-938.
Brisset, M. N., Rodriguez-Palenzula, P., Burr, T.J. and Collmer, A. 1991. Attachment, chemotaxis, and multiplication of Agrobacterium tumefaciens biovar 1 and biovar 3 on grapevine and pea. Appl. Environ. Microbiol. 57:3178-3182.
Buchmann, I., Marner, P., Schroder, G., waffenschmidt, S., and Schroder, J. 1985. Tumor genes in plants: T-DNA encoded cytokinin biosynthesis. EMBO J. 4:853-859
35
Bundock, P., den Dulk-Ras, A., Beijersbergen. A., and Hooykass, P. 1995. Trans Kingdom T-DNA transfer from Agrobcaterium tumefaciens to Sacchromyces cen/isae. EMBO. J. 14:3206-3214.
Burr, T. J., Bishop, A. L., Katz. B. H., Blanchard, L. M., and Bazzi, C. 1988. A root-specific decay of grapevine caused by Agrobacterium tumefaciens and A. racf/obacfer biovar 3. Phytopathology 77: 1424-1427.
Burr, T. and Katz, B.I 983. Isolation of Agrobacterium tumefaciens biovar 3 from grape gall and sap, and from vineyard soil. Phytopathology 73:163-165
Burr, T., and Hurwitz, B. 1981. Occurrence of Agrobacterium radiobacter pv. tumefaciens (Smith and Townsend) Conn, biotype 3 on grapevine on New York State. Phytopathology 71:206. (Abstr.)
Burr, T. 1978. Crown gall of grapevine. Vinifera Wine Growers J. 5:131-133
Butcher, D., El-Tigani, S., and Ingram, D. 1974. The role of indole glucosinolates in the club root disease of the cruciferae. Physiol. Plant Pathol. 4:127-140.
Cangelosi, G., Ankenbauer, R. and Nester E.1990. Sugars induce the Agrobacterium virulence genes through a perplasmic binding protein and a transmembrane signal protein. Proc. Natl. Acad. Sci USA 87:6708-6712
Cangelosi, G., Hung L., Puvanesarajah, V., Stacey, G., Ozga, D., Leigh, J. and Nester, E.I987. Common loci for Agrobacterium tumefaciens and Rhizobium meliloti exopolusaccharide synthesis and their roles in plant infections. J. Bacteriol. 169:2086-2091.
Cardarelli, M., Spano, L., Mariotti, D., Mauro, M., Van Sluys, M., and Costantino, P. 1987. The role of auxin in hairy root induction. Mol. Gen. Genet. 208:457-463.
Cavara, P. 1897. Tuberculosis of vine. Staz. Sprim. Agrar. Ital. Modena 30:483-487.
Chamberlain, G. 1962. The occurrence of areal crown gall of grape vines in Niagara Peninsula of Ontario, Canada. Can. Plant Dis. Surv. 42:208-211
Charles, T., Jin, S., and Nester E., 1992. Two component sensory transduction synthesis in phytobacteria. Ann. Rev. Phytopathol. 30:463-484.
Chen, C, and Melitz, D. 1979. Cytokinin biosynthesis in a cell-free system from cytokinin autotrophic tobacco tissue cultures. PEBS lett. 107:15-20.
36
Chilton, M., Drummond, M., Merlo, D., Sciaky, D., Montoya, A., Gordon, M., and Nester, E. 1977. Stable incorporation of plasmid DNA into higher plant cell: the molecular basis of crown gall tumorigenesis. Cell 11: 263-271
Chilton, M., Saiki, R., Yadav, N., Gordon, M., and Quetier, P. 1980. T-DNA from Agrobacterium Ti plasmid is in the nuclear DNA fraction of crown gall tumor cells. Proc. Natl. Acad. Sci. USA 77: 4060-4064.
Christie P., Ward, J., Gordon, M., and Nester, E. 1989. A gene required for transfer of T-DNA to plants encodes an ATPase with autophosphorylating activity. Proc. Natl. Acad. Sci. USA 86: 9677-9681.
Christie, P., Ward, J., Winans, S. and Nester, E. 1988. The Agrobacterium tumfaceins virE2 gene product is a single-stranded DNA-binding protein that associates with T-DNA. J. Bacteriol. 170: 2659-2667
Chyi, Y., Jorgensen, R., Goldstein, S., Tanksely S., and Loaizafigueroa, F. 1986. Locations and stability of Agrobacter/tym-mediated T-DNA insertions in the Lycopersicon genome. Mol. Gen. Genet. 204:64-69.
Citovsky, V., Wong, M., and Zambryski, P. 1989. Cooperative interaction of Agrobacterium VirE2 protein with single stranded DNA: Implications for the T-DNA transfer process. Proc. Natl. Acad. Sci. USA 86: 1193-1197.
Citovsky, V., Mclean, G., Greene, E., Howard, E., Kuldau, G., Thorstenson, Y., Zupan, J., and Zambryski, P. 1992a. Agrobacfer/t/m-plant cell interaction: Induction of wrgenes and T-DNA transfer: In Molecular Signals in Plant microbe Communications, D.P.S. Verma, ed ( Boca Raton, PL: CRC Press), pp. 169-198.
Citovsky, V., Zupan, J., and Zambryski, P. 1992b. Nuclear localization of Agrobacterium Vir E2 protein in plant cells. Science 256, 1803-1805.
Citovsky, V., Zupan, J., and Zambryski, P. 1994. Nuclear import of Agrobacterium VirD2 and VirE2 proteins in maize and tobacco. Proc. Natl. Acad. Sci. USA 91: 3210-3214.
Close, T., Rogowsky, P., Kado, C, Winans, M., Yanofsky and Nester, E.I987. Dual control of Agrobacterium tumefaciens Ti plasmid virulence genes. J. Bacteriol. 169:5113-5118
Collmer, A., and Keen, N. T., 1986. The role of pectic enzymes in plant pathogenesis. Ann. Rev. Phytopathology 24:383-409.
37
Cooley, M., D'souza, M. and Kado, C. 1991. The wrC and virD operons of the Agrobacterium Ti plasmid are regulated by the ros chromosomal gene: analysis of the cloned ros gene. J. Bacteriol. 173:2608-2616
DeCleene, M., and DeLey J. 1976. The host range of crown gall. Bot. Rev. 42:389-466.
Dekhujzen, H., and Overeem, T. 1971. the role of cytokinin in clubroot formation. Physiol. Plant Pathol. 1:151-161.
Deng, W.; Pu, X., Goodman, R.N., Gordon, M.P., and Nester, E.W. 1995. T-DNA genes responsible for inducing a necrotic response on grapevines. MPMI. 4:538-548.
De Vos, G. and Zambryski, P. 1989. Expression of Agrobacterium nopaline specific VirDI, VirD2 and VirCI proteins and their requirment for T-strand production in E. coli. Mol. Plant-Microbe Interactions 2:43-52
Dodd, T., Michaud, M and Hood, D. 1996. A profile of the Texsa wine and wine grape industry. Research report No. 96-11, December, 1996. Texas Wine Marketing Research Institute. Texas Tech University.
Douglas, C , Staneloni, R., Rubin, R., and Nester, E. 1985. Identification and genetic analysis of an Agrobacterium tumefaciens chromosomal virulence region. J. Bacteriol. 161:850-860.
Douglas, C , Halperin, W. and Nester, E. 1982. Agrobacterium tumefaciens mutants affected in attachment to plant cells. J. Bacteriol. 152:1265-1275.
Douglas, C , Ataneloni, R., Rubin, R. and Nester, E.I985. Identification and genetic analysis of an Agrobacterium tumefaciens chromosomal virulence region. J. Bacteriol. 161:850-860.
D'Souza-Ault, M., Cooley, M. and Kado, C. 1993. Analysis of Ros repressor of Agrobacterium virC and virD operons: molecular intercommunication between plasmid and chromosomal genes. J. Bacteriol. 175:3486-3490.
Pernandez, D., Dang, T., Spudich, G., Zhou, X., Berger, B., and Christie, J. 1996a. The Agrobacterium tumefaciens. virBT gene product, a proposed component of the T-complex transport apparatus, is a membrane associated lipoprotein exposed at the periplasmic surface. L. Bacteriol. 178:3156-3167.
38
Pernandez, D., Spudich, G., Zhou, X., and Christie, P. 1996b. The Agrobacterium tumefaciens V\rB7 lipoprotein is required for stabilization of VirB proteins during assembly of the T-DNA complex transport apparatus. J. Bacteriol. 178, 3168-3176
Pilichkin, S. and Gelvin. 1993. Pormation of a putative relaxation intermediate during T-DNA processing directed by the Agrobacterium tumefaciens VirDI, D2 endonuclease. Mol. Microbiol. 8:915-926.
Pullner, K., Lara, J., and Nester, E. 1996. Pilus assembly by Agrobacterium T-DNA transfer genes. Science 273:1107-1109.
Gallie, D., Hagiya, M., and Kado, C. 1984. Analysis of Agrobacterium tumefaciens plasmid pTiC58 replication region with a novel high-copy number deravative. J. Bacteriol.
Galloway, B. 1889. Black-knot of the grape. USDA Bot. Div. Bull. 8:63.
Garfinkel, D., Simpson, R., Ream L., White, P., Gordon, M.n and Nester E. 1981. Genetic analysis of Crown gall: a fine structure map of the T-DNA by site directed mutagenesis. Cell 27: 143-153.
Gelvin, S., Thomashow, M., McPherson, J., Gordon, M., and Nester, E. 1982. Sizes and map positions of several plasmid-DNA-encoded transcripts in octopine-type crown gall tumors. Proc. Natl. Acad. Sci. USA 79: 76-80.
Ghai, J., and Das, A. 1989. The virD operon of Agrobacterium tumefaciens Ti plasmid encodes a DNA-relaxing enzyme. Proc.Natl. Acad. Sci. USA
Gheysen, G., Villarroel, R. and Van Montagu, M. 1991. Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5:287-297.
Gillings, M., and Ophel-Keller, K. 1995. Comparison of strains of Agrobacterium vitis from grapevine source areas in Australia. Australian Plant Pathology 24:29-37.
Gray, J., Wang, J., and Gelvin, S. 1992. Mutation of the miaA gene of Agrobacterium tumefaciens results in reduced wrgene expression. J. Bacteriol. 174: 1086-1098.
Grimsley, N.1990. Agreinfection. Physiol. Plant. 79:147-153.
39
Guyon, P., Chilton, M., Petit, A., and Tempe, J. 1980. Agropine in "null-type" crown gall tumors: Evidence for generality of the opine concept. Proc. Natl. Acad. Sci. USA 77: 2693-2697.
Heath, J.D., Charles, T.C., and Nester, W.E. 1995. Ti plasmid and chromosomally Encoded Two-component Systems Important in Plant Cell Transformation by Agrobacterium Species. In Two component Signal Transduction, Edited by James A. Horch and Thomas J. Silhavy. pp 367 385. American Society for Microbiology, Washington, D.C.
Hedgcock, G.I 910. Pield studies of the crown gall of the grape. Bur. of plant Ind., USDA Bull. 131:21-23
Herlache, T. C , Hotchkiss, JR. A T., Burr, T. J., and Collmer, A., 1997. Charcterization of the Agrobacterium vitis pheA gene and comparison of the encoded polygalacturonase with homologous enzymes from Erwinia carotovora and Ralstonia solancearum. Applied and Envir. Microbiol. 63:338-346.
Herman, L., Jacobs. A., Van Montagu M. and Depicker, A. 1990. Plant chromosome/marker gene fusion assay for study of normal and truncated T-DNA integration events. Mol. Gen. Genet. 224:248-256.
Herrera-Estrella, A., Van Montagu, M., and Wang, K. 1990. A bacterial peptide acting as a plant nuclear targeting signal: the amino-terminal portion of Agrobacterium VirD2 protein directs a p fusion protein into tobacco nuclei. Proc. Natl. Acad. Sci. USA 87: 9534-9537
Holmes, B., and Roberts, P. 1981. The classification and nomenclature of Agrobacteria. J. Appl. Bacteriol. 50:443-467.
Hooykaas, P., den Dulk-Ras, H., and Schilperoort, R. 1988. The Agrobacterium tumefaciens T-DNA gene 6b is an one gene. Plant Mol. Biol. 11: 791
Hooykaas, P. and Schilperoort. 1992. Agrobacterium and plant genetic engineering [published erratum appears in Plant Mol. Bio. 1992]. Plant Mol. Biol. 19:15-38
Howard, E., Zupan, J., Citovsky, V. and Zambryski, P. 1992. The VirD2 protein of A. tumefaciens contains a C-terminal bipartie nuclear localization signal: implications for nuclear uptake of DNA in plant cells. Cell 68:109-118
40
Huang, Y., Morel, P., Powell, B. and Kado, C . 1990. VirA, a coregulator of Ti specific virulence genes, is phosphorylated in vitro. J. Bacteriol. 172:1142-1144.
Huffman, G., White, P., Gordon, M., and Nester, E. 1984. Hairy root inducing plasmid: Physical map and homology to tumor-inducing plasmids. J. Bacteriol. 157:269-276.
Hutcheson, S., and Kosuge, T. 1985. Regulation of 3-indoleacetic acid production in Pseudomonas syringae pv. savastonoi. Purification and properties of tryptophan -2- monooxygenase. J. Biol. Chem. 260:6281-6287.
Inze, D., Pollin, D., Van Lijsebettens M., Simoens, C, Genetello, C, Van Montagu M., and Schell, J. 1984. Genetic analysis of the individual T-DNA genes of Agrobacterium tumefaciens; further evidence that two genes are involved in indole-3-acetic acid synthesis. Mol. Gen. Genet. 194:265-274.
Jasper, P., Koncz, C, Schell, J, and Steinbiss, H. 1994. Agrobacterium T-strand production in vitro: Sequence-specific cleavage and 5' protection of single stranded DNA templates by purified VirD2 protein. Proc. Natl. Acad. Sci. USA 91: 694-698.
Jayaswal, R., Veluthambi, K., Gelvin, S. and Slightom, J. 1987. Double-stranded cleavage of T-DNA and generation of single-stranded T-DNA molecules in E. coli by a wrD-encoded border-specific endonuclease from Agrobacterium tumefaciens. J. Bacteriol. 169:5035-5045.
Ji, J., Martinez, A., Dabrowski, M., Veluthambi, K., Gelvin S., and Ream, W. 1988. The overdrive enhancer sequence stimulates production of T strands from the Agrobacterium tumefaciens tumor-inducing plasmid. In : Staskawicz, B. Ahlquist, P. and Yoder, O. (ed.). Molecular biology of plant pathogen interactions. UCLA Symposium Mol. Cell. Biol. Alan R. Liss, New York
Jin, S., Sond, Y., Deng, W., Gordon, M. and Nester, E. 1993. the regulatory VirA protein of Agrobacterium tumefaciens does not function at elevated temperatures. J. Bacteriol. 175:6830-6835
Jin, S., Roltsch, T., Ankenbauer, R., Gordon, M. and Nester, E. 1990. The VirA protein of Agrobacterium tumefaciens is autophosphorylated and is essential for the vir gene regulation. J. Bacteriol. 172:525-530.
41
Jinsong, S. and Citovsky, V. 1996. Agrobacterium-Plant cell DNA transport:: have virulence Proteins, will travel. Plant cell. 8:1699-1710.
Kado, C. 1.1994. Promiscuous DNA transfer system of Agrobacterium tumefaciens: role of the virB operon in sex pilus assembly and synthesis. Molec. Microbiol. 12:17-22.
Kennedy, B. and Alcron, S. 1980. Estimates of U.S. crop loses to prokaryotic plant pathogens. PI. Disease 64:674-676.
Kerr, A. 1969. Transfer of virulence between strains of Agrobacterium. Nature 208: 1175-1176.
Kerr, A., and Pangopoulos C. 1977. Biotypes of Agrobacterium radiobacter var tumefaciens and their biological control. Phytopath. Z. 90:172-179.
Koncz, C , Martini, N., Mayerhofer, R., Koncz-Kalman, Z., Korber, H., Redei, G., and Schell, J. 1989. High frequency T-DNA-mediated gene tagging in plants. Proc. Natl. Acad. Sci.USA 86: 8467-8471.
Korber, H., Strizhov, N., Staiger, D., Peldwish, J., Olsson, O., Sandberg, G., Palme, K., Schell, J., and Koncz, C. 1991. T-DNA gene 5 of Agrobacterium modulates auxin response by autoregulated synthesis of a growth hormone anatagonist in plants. EMBO J. 10:3983-3991.
Kosuge, T., Comai, L., and Glass, N. 1983. Virulence determinants in plant pathogen interactions. In Plant Molecular Biology. (R.B. Goldbert, ed), pp.167-177. Alan R. Liss, New York.
Kuehn, M., Ogg, D., Kihiberg, J., Slonim, L., Plemmer, K., Bergfors, T., and Hultgern, S. 1993. Structural basis of pilus subunit recognition by the PapD chaperone. Science 262: 1234-1241.
Kuldau, G., DeVos, G., Owen, J., McCaffrey, G., and Zambrtski, P. 1990. The virB operon of Agrobacterium tumefaciens pTiC58 encodes 11 open reading frames. Mol. Gen. Genet. 221:256-266.
Langridge, W., Pitzgerald, K., Koncz, C, Schell, J., and Szalay, A. 1989. Dual promoter of Agrobacterium tumefaciens mannopie synthase genes is regulated by plant growth hormones. Proc. Natl. Acad. Sci. USA 86:3219-3223.
42
Lee, Y., Jin, S., Sim, W. and Nester, E. 1995. Genetic evidence for direct sensing of phenolic cpmpounds by the VirA protein of Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 92: 12245-12249.
Leemans, J., Deblaere, R., Willmitzer, R., DeGreve, H. Hernalsteens, J., Van Montagu, M., and Schell, J. 1982. Genetic identification of functions of TL DNA transcripts in octopine crown galls. EMBO J. 1:147-152.
Lehoczky, J. 1978. Root system of the grapevine as a reservoir of Agrobacterium tumefaciens cells, pp. 239-243. In Proc. 4**" Int. Conf Plant Path. Bact., Anger.
Leisner, S., and Gelvin, S. 1989. Multiple domains within the upstream activator sequence of the octopine synthase gene. Plant cell 1:925-936.
LessI, M. and lanka, E. 1994. Common mechanisms in bacterial conjugation and Ti-mediated T-DNA transfer to plant cells. Cell 77:321-324
Lewitt, J. 1972. Responses of plants to Environmental Stress, (ed) Academic Press. 697pp New York.
Liorel, C. 1956. Sur la mise en evidence d'un acide amine nonidentifie particulier aux tissues de crown-gall. Bull Soc. Pr. Physiol. Veg. 2:76.
Lippincott, J., and Lippincott, B. 1969. Bacterial attachment to a specific wound site is an essential stage in tumor induction by Agrobacterium tumefaciens. J. Bacteriol. 97:620-628.
Mahadevan, A., 1984. Growth regulators. Microorganisms and diseased plants. Oxford and IBA Publishing, New Delhi, India pp. 465-466.
Manoil, C , Mekalanos, J., and Beckwith, J. 1990. Alkaline phosphatase fusions: sensors of subcellular location. J. Bacteriol. 172:515-518.
Mantis, N. and Winans, S. 1993. The chromosomal response regulatory gene chvl of Agrobacterium tumefaciens complements an E. coli phoB mutation and is required for virulence. J. Bacteriol. 175:6626-6636.
Matthysse, A. 1983. Role of bacterial cellulose fibrils in Agrobacterium tumefaciens infection. J. Bacteriol. 154:906-915.
Matthysse. A. 1987. Characterization of nonattaching mutants of Agrobacterium tumefaciens. J. Bacteriol. 169:313-323.
43
Matthysse, A., Holmes, K., and Gurliz, R. 1981. Elaboration of cellulose fibrils by Agrobacterium tumefaciens during attachment to carrot cells. J. Bacteriol. 145:583-595.
McBride, K. and Knauf, V. 1988. Genetic analysis of the wrE operon of the Agrobacterium Ti plasmid pTiA6. J. Bacteriol. 170:1430-1437.
McGuire, R.G., Rodriguez-Palenzula, P., Collmer, A., and Burr, T.J. 1991. Polygalacturonase production by Agrobacterium tumefaciens biovar 3. Appl. Environ. Microbiol. 57:660-664.
Melchers, L., regensburg, T., Bourret, R., Sedee, N., Schilperoort, R., and Hooykaas. 1989. Menbrane topology and functional analysis of the sensory protein VirA of Agrobacterium tumefaciens. EMBO J. 8:1919 1925.
Metts, J., West, J., Doares, S., and Matthysse, A. 1991. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes. J. Bacteriol. 173: 1080-1087.
Miller, C. 1971. Cytokinin production by mycorrhizal fungi. In Ectomycorrhizae (E.Hacskagho, ed.) pp. 168-174. U.S. Porest Service. North America Conference on Mycorrhizae (1969) Proceedings. Wasgington, DC.
Mills, L., and van Staden, J. 1978. Extraction of cytokinins from maise smut tumors form maize and Ustilago maydis cultures. Physiol. Plant Pathol. 13:73-80.
Mitchell, R. Texas Tech University. 1998. Personal Communication
Mitra. A., and An, G. 1989. Three regulatory elements comprise the upstream promoter region of the octopine synthase gene. Mol. Gen. Gent. 215:294-299.
Moore, L., Kado, C, and Bouzar, H. 1988. Gram-negative bacteria. A. Agrobacterium. pp 16-36. In: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 2"^ ed. N.W. Schaad, ed. American Phytopathological Society, St. Paul, MN.
Morel, G. 1956. Metabolism de L'arginine par les tissus de crown gall de topinambour. Bull. Soc. Pr. Physiol. Veg. 2:75.
Morris, R. 1986. Genes specifying auxin and cytokinin biosynthesis in phytopathology. Ann. Rev. Plant Physiol. 37:509-538.
44
Morris, R. 1987. Genes specifying auxin and cytokinin biosynthesis in prokaryotes. in: Plant Hormones and their role in plant growth and development (P.J. Davis, ed) pp. 636-655.
Morris, R., Powell, G., Beaty, J., Durely, R., Homes, N., Liea, L., and MacDonald, S. 1986. Cytokinin biosynthetic genes and enzymes form Agrobacterium tumefaciens and other plant-associated prokryotes. In: Plant Grov^h Substances (M. Bopp, ed.) pp. 185-186. Springer-Verlag, Berlin.
Morris, R., Akiyoshi, D., MacDonald, E., Morris, J., Regier, D., and Zaerr, B. 1982. Cytokinin metabolism in relation to tumor induction by Agrobacterium tumefaciens. In: plant Growth substances (P.P. wareing,ed) pp. 175-183. Academic Press. London.
Narasimhulu, S., Deng, X., Sarria, R., and Gelvin. 1996. Early transcription of Agrobacterium T-DNA genes in tobacco and maize. Plant cell 8:22701 22704.
Ochman, H., and Wilson, A. 1987. Evolution in bacteria: Evidence for a universal substitution rate in cellular genomes. J. Mol. Evol. 26:74-86.
Offringa, R., DeGroot, M., Haagsman, H., Does, M., Van den Elzen. P., and Hooykaas, P. 1990. Extrachromosomal homologous recombination and gene targeting in plant cells af[er Agrobacterium mediated transformation. EMBO. J. 9:3077-3084.
Ooms, G., Hooykaas, J., Moolenaar, G., and Schilperoort, R, 1981. Crown gall plant tumors of abnormal morphology induced by Agrobacterium tumefaciens carrying mutated octopine Ti plasmids; analysis of T-region DNA function. Gene 14:33-50.
Ophel, K., and Kerr, A. 1990. Agrobacterium vitis - new species for strains of Agrobacterium biovar 3 from grapevines. Int. J. Syst. Bacteriol. 40:236-241.
Ophel, K., Burr, T., Magarey, P., and Kerr, A., 1988. Detection of Agrobacterium tumefaceins biovar 3 in south Australian grapevine propagation material. Australian Plant Pathology 17:61066.
Often, L. 1997. http://ibmp.u-strasbq.fr/dep4/equ1/d4 equi res9195.html. pp. 1-3. May 10^^ 1997.
45
Otten, L., Crouzet, P., Salomone, J., DeRuffray, P., and Szegedi, E. 1995. Agrobacterium vitis strain AB3 harbors two independent tartrate utilization systems, one of which is encoded by the Ti plasmid. Mol. Plant-microb Interact 1: 138-146.
Otten, L., Canaday, J., Gerard, J., Pournier, P., Crouzet, P., Paulus, P. 1992. Evolution of Agrobacteriua and their Ti plasmids - A Review. Mol. Plant-Microb Interact. 4: 279-287.
Owens, C. 1928. Principles of Plant Pathology, pp. 182-189. John Wiley and Sons, New York.
PaIni, L., Tay, S., Nandi, S., Pianca, D., deKlerk, G., Wong, O., Letham, D., and Macleod, J. 1985. Cytokinin biosynthesis in plant tumor tissues. Biol, plant 27:195-203.
Pan, S., Charles, T., Jin, S., Wu, Z., and Nester, E. 1993. Performed dimeric state of the sensor protein VirA is involved in plant-Agrobacter/tvm signal transduction. Proc. Natl. Acad. Sci. USA 90: 9939-9943.
Panagopoulous, C, and Psallidas, P. 1973. Characteristics of Greek isolates of Agrobacterium tumefaciens (E.P. Smith and Townsend) Conn. J. appl. Bacteriol. 36: 233-240.
Pansegrau, W., and Lanka, E. 1991. Common sequence motifs in DNA relaxases and nick regions from a variety of DNA-transfer systems. Nucleic Acids Res. 19:3455.
Pansegrau, W., Schoumacher, W., Hohn, B., and lanka, E. 1993. Site-specific aleavage and joining of single stranded DNA by VirD2 protein of Agrobacterium tumefaciens Ti plasmid: analogy to bacterial conjugation. Proc. Natl. Acad. Sci. USA 90: 11538-11542.
Parkinson, J., and Kofoid, E. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71-112.
Peralta, E., and Ream, W. 1985. T-DNA border sequences required for crown gall tumorigenesis. Proc. Natl. Acad. Sci. USA 82: 5112-5116.
Peralta, E. Hellmiss, E., and Ream, W. 1986. Overdrive, a T-DNA transmission enhancer on the Agrobacterium tumor-inducing plasmid EMBO J. 5:1137-1142.
46
Petit, A., David, C , Dahl, G., Ellis, J., and Guyon, P. 1983. Purther extention of the opine concept: plasmids in Agrobacterium rhizogenes cooperate for opine degradation. Mol. Gen. Genet. 190:204-
Petit, A., Delhaye, S., Tempe, J., and Morel, G. 1970. Recherches sur les guanidines des tissus de crown gall. Mise en evidence d'une relation biochemique specifique entre les souches d'argobacterium tumefaciens. C.R. Acad. Sci. Paris 281:467-469.
Powell, B., Rogowsky, P., and Kado, C. 1989. VirG of Agrobacterium tumefaciens plasmid pTiC58 encodes a DNA-binding protein, Mol. Microbiol, 3:411:
Powell, B., and Kado, C. 1990. Specific binding of VirG to the wr box requires a C-terminal domain and exhibits a minimum concentration threshold, Mol. Microbiol., 4: 2159:
Pu, X. A., and Goodman, R. N. 1992. Induction of necrogenesis by Agrobacterium tumefaciens on grape explants. Physiol. Mol. Plant Pathol. 41:241-254.
Puwanesarajh, V., Schell, P., Stacy, G., Douglas, C, and Nester, E. 1985. Role for 2-linked-beta-D-glucan in the virulence of Agrobacterium tumefaciens. J. Bacteriol. 164:102-106.
Ream, L., Gordon, M., and Nester, W. 1983. Multiple mutations in the T-regions of the Agrobacterium tumefaciens tumor inducing plasmid. Proc. Natl. Acad. Sci. USA 80: 1660-1664.
Rodriguez-Palenzula, P., Burr, T.J., and Collmer, P. 1991. Polygalcturonase is a virulence factor in Agrobacterium tumefaciens biovar 3. J. Bacteriol. 173: 6547-6552.
Rogowsky, P., Close, T., Chimera, J., Shaw, J., and Kado, C. 1987. regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiC58. J. Bacteriol. 169:5101-5102.
Rossi, L., Holn, B., and Tinland, B. 1993. The VirD2 protein of Agrobacterium tumefaciens carries nuclear localization signals important for transfer of T DNA to plants. Mol. Gen. Gent 239:345-353.
Rossi, L., Hohn, B., and Tinland, B. 1996. Integration of complete transferred DNA units is dependent on the activity of virulence E2 protein of Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 93: 126-130.
47
Ruffner, H.P. 1982. Metabolism of tartaric and malic acids in Vitis. vitis 21:247-259.
Scheiffele, P., Pansegrau, W., and Lanka, E. 1995. Initiation of Agrobacterium tumefaciens T-DNA processing. Purified proteins VirDI and VirD2 catalyze site- and strand-specific cleavage of superhelical T-DNA border in vitro. J. Biol. Chem. 270:1269-1276.
Schroder, G., waffenschmidt, S., weiler, E., and Shroder, J. 1984. The T-region of the Ti plasmids codes for an enzyme synthesizing indole-3-acetic acid. Eur. J. Biochem. 138:387-391.
Sen, P., Pazour, G., Anderson, D., and Das, A. 1989. Cooperative binding of Agrobacterium tumefaciens V\rE2 protein to single-stranded DNA. J. Bacteriol. 171:2573-2580.
Sheeren-Groot, E., Rodenberg, K., Dulk-Ras, A., Turk, S., and Hooykaas, P. 1994. Mutational analysis of the transcriptional activator VirG of Agrobacterium tumefaciens. J. Bacteriol. 176:6418-6426.
Shimoda, N., Toyoda -Yamamoto, A., Nagamine, J., Usami, S., Katayama, M., Sakagami, Y., and Machida, Y. 1990. Control of expression of Agrobacterium wr-genes by synergistic actions of phenolic signal molecules and monosaccharides. Proc. Natl. Acad. Sci. USA 87: 6684 6688.
Shirasu, K., and Kado, C. 1993. Membrane localization of the Ti plasmid VirB proteins involved in the biosynthesis of pilin-like conjugative structure on Agrobacterium tumefaciens. PEMS Microbiol, let. 111:287-294.
Shirasu, K., Morel, P., and Kado, C. 1990. Characterization of the wrB operon of an Agrobacterium tumefaciens Ti plasmid nucleotide sequence and protein analysis. Mol. Microbiol. 4:1153-1163.
Shurvinton, C, Hodges, E., and Ream, W. 1992. A nuclear localization signal and the C-terminal omega sequence in the Agrobacterium tumefaciens VirD2 endonuclease are important for tumor formation. Proc. Natl. Acad. Sci. USA 89: 11837-11841.
Skoog, P., and Miller, C. 1957. Chemical regulation of growth and organ formation in plant tissue cultured in vitro. Symp. Soc. Exp. Biol. 11:118 131.
48
Smith, E., and Townsend, C. 1907. A plant-tumor of bacterial origin. Science 25:671-673.
Spanier, K., Schell, J., and Schreier, P. 1989. Afunctional analysis of T-DNA gene 6b: the fine tuning of cytokinin effects on shoot development. Mol. Gen. Genet 219:209-216.
Spudich, G., Pernandez, D., Zhou, X., and Christie. 1996. Intermolecular disulfide bonds stabilize VirB7 homodimers and VirB7/VirB9 heterodimers during biosynthesis of the Agrobacterium tumefaciens T-complex transport apparatus. Proc. Natl. Acad. Sci.USA 93: 7512-7517.
Stachel, S., and Nester, E. 1986. The genetic and transcriptional organization of the wr region of the A6 Ti plasmid of Agrobacterium tumefaciens. EMBO J. 5:1445-1454.
Stachel, S., Messens, E., Van Montagu, M., and Zambryski, P., 1985. Identification of the signal molecules produced by wounded plant cells that activate T-DNA transfer in Agrobacterium tumefaciens. Nature 318:624-629.
Stachel, S., Nester, E., and Zambryski, P. 1986a. A plant cell factor induces Agrobacterium tumefaciens vir gene expression. Proc. Natl. Acad. Sci. USA 83: 379-383.
Stachel, S., Timmerman, B., and Zambryski, P. 1986b. Generation of single stranded T-DNA molecules during the initial stages of T-DNA transfer from Agrobacterium tumefaciens fo plant cells. Nature 322:706-712.
Stephens, K., Roush, C, and Nester, E. 1995. Agrobacterium tumefaciens VirB11 protein requires a consensus nucleotide-binding site for function in virulence. J. Bacteriol. 177:27-36.
Strover, E. W., Swatz, H., J., and Burr, T., J. 1997. Agrobacterium wY/s-lnduced electrolyte leakage in crown gall susceptible and resistant grape gentoypes. Am.J. Enol. Vitic, 2: 145-149.
Sule, S. 1978. Biotypes of Agrobacterium tumefaciens in Hungary. J. Appl. Bact. 44:207-213
Sundberg, C , Meek, L., Carroll, K., Das, A., and Ream, W. 1996. VirEI protein mediates export of the single-stranded DNA-binding protein VirE2 from Agrobacterium tumefaciens into plant cells. J. Bacteriol. 178:1207-1212.
49
Surico, G., Comal, L., and Kosuge T. 1984.Pathogenicity of strains of Pseudomonas syringae pv. savastanoi and their indoleacetic acid deficient mutants on olive and oleander. Phytopathology 74:490-493.
Suseelan. K., Bhagwat, A., Mathews, H., Bhatia, C, 1987. Agrobacterium tumefcaiens induces tumor formation on some tropical dicot and monocot plants. Curr. Sci. 56: 888-889.
Szegedi, E., Otten, L., and Czako, M. 1992. Diverse types of tartrate plasmids in Agrobacterium tumefaciens biotype III strains. Mol. Plant-Microbe Interact. 5:435-438.
Szegedi, E. 1985. Host range and specific L(+) tartrate-utilization of biotype 3 of Agrobacterium tumefaciens. Acta Phytopatholol. Acad. Sci. Hung. 20:17-22.
Tarbah, P., and Goodman, R. 1986. Rapid detection of Agrobacterium tumefaciens in grapevine propagating material and the basis for an efficient indexing system. Plant Dis. 75:634-637.
Taya, Y., Tanaka, Y., and Nishimura, S. 1978. 5'-AMP is a direct precursor of cytokinin in Dictystedium discoideum. Nature 271:545-547.
Tempe, J., and Goldmon, A. 1982. "Occurrence and biosynthesis of opines." in Molecular Biology of Plant Tumor (ed) G. Khal and Schell. 1982. New Work: Academic Press.
Thomashow, M., Nutter, R., Montoya, A., Gordon, M., and Nester, E. 1980. Integration and organization of Ti plasmid sequences in grown gall tumors. Cell 19: 729-733.
Thomashow. L., Reeves, S., and Thomashow, M. 1984. Crown gall oncogenesis: Evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid. Proc. Natl. Acad. Sci. USA 81:5071-5075.
Thomashow, M., Hugly. S., Buchholz, W., and Thomashow, L. 1986. Molecular basis for the auxin-independent phenotype of crown gall tumor tissue. Science 231-616-618.
Thomashow, M., Karlinsey, J., Marks, J., and Hurlbert, R. 1987. Identification of a new virulence locus in Agrobacterium tumefaciens that affects polysaccharide composition and plant cell attachment. J. Bacteriol 169:3209-3216.
50
Thompson, D., Melchers, L., Idler, K., Schilperoort, A., and Hooykaas, P. 1988. Analysis of the complete nucleotide sequence of the Agrobacterium tumefaciens virB operon. Nucleic Acids Res. 16:4621-4636.
Thorstenson, Y., and Zambryski, P. 1994. The essential virulence protein VirB8 localizes to the inner membrane of Agrobacterium tumefaciens J Bacteriol. 176:1711-1717.
Thorstenson, Y., Kuldau, G., and Zambryski, P. 1993. Subcellular localization of seven wrB proteins of Agrobacterium tumefaciens: implications for the formation of a T-DNA transport structure. J. Bacteriol. 175: 5233-5244.
Tinland, B., Huss, B., Paulus, P., Bonnard, G., and Otten, L. 1989. Agrobacterium tumefaciens 6b genes are strain-specific and affect the activity of auxin as well as cytokinin genes. Mol. Gen. Genet 219:217-224.
Tinland, B., Rohfritsh, O., Michler, P., and Otten, L. 1990. Agrobacterium tumefaciens T-DNA gene 6b stimulates rol-induced root formation, permits growth at high concentrations and increases root size. Mol. Gen. Genet 223:1-10.
Tinland, B., Schoumacher, P., Gloeckler, V , Bravo-Angel, A., and Hohn, B. 1995. the Agrobacterium tumefacins virulence D2 protein is responsible for precise integration of T-DNA into the plant genome. EMBO J. 14, 3585 3595.
Toro, N., Datta, A., Carmi, O., Young, C, PrustI, R., and Nester, E. 1989. The Agrobacterium tumefaciens VirCI gene product binds to overdrive, a T DNA transfer enhancer. J. Bacteriol. 171:6845-6849.
Toumy, J. 1900. An inquiry into the cause and nature of crown gall. Arizona Ag. Exp. Sta. Bui. 33:3-64.
Van larebeke, N., Engler, G., Holsters, M., Van den Elsacker, S., Zaenen, I., Schilperoort, R., and Schell, J. 1974. Large plasmid in Agrobacterium tumefaciens essential for crown gall inducing activity. Nature 252:169-170.
Van Onckelen, H., Prinsen, E., Inze, D., Rudelshein, P., Van Lijsebettens, M., Pollin, A., Schell, J., Van Montagu, M., and De Greef, J. 1986. Agrobacterium T-DNA gene codes for tryptophan 2-monooxygenase activity in tobacco crown gall cells. PEBS Lett. 198:357-360.
51
Veluthambi, K., Ream, W., and Gelvin, S. 1988. Virulence genes, borders and overdrive generate single-stranded T-DNA molecules from the A6 Ti plasmid of Agrobacterium tumefaciens. J. Bacteriol. 170:1523-1532.
Vogel, A., and Das, A. 1992. Mutational analysis of Agrobacterium tumefaciens virD2: tyrosine 29 is essential for endonuclease activity. J. Bacteriol 174:303-308.
Vogel, A., and Das, A. 1994. Mutational analysis of Agrobacterium tumefaciens pTiA6 virD1: identification of functionally important residues. Mol. Microbiol. 12:811-817.
Wang, K., Herrera-Estrella, A., and Van Montagu, M. et al. 1990. Overexpression of virD1 and wrD2 genes in Agrobacterium tumefaciens enhances T complex formation and plant transformation. J. Bacteriol. 172:4432-4440.
Wang, K., Herrera - Estrella, A., Van Montagu, M., and Zambryski, P. 1984. Right 25 terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to plant genome. Cell 38:455-462.
Watson, B., Currier, T., Gordon, M., Chilton, M., and Nester, E. 1975. Plasmid required for virulence of Agrobacterium tumefaciens. J. Bacteriol. 123:255-264.
Weisburg, W., Woese, C, Dobson, M., and Weiss, E. 1985. A common origin of rickettsiae and certain plant pathogens. Science 230:556-558.
White, P., and Braun, A. 1941. Grown gall production by bacteria-free tumor tissue. Science 94:239-241.
Willmitzer, L., Sanchez-Serrano, J., Bushchfeld, E., and Schell, J., 1982. DNA form Agrobacterium rhizogens is transferred to and expressed in axenic hairy root plant tissues. Mol. Gen. Genet. 186:16-22.
Willmitzer, L., Dhaese, P., Schreier, P., Schmalenbach, W., Van Montagu, M., and Schell, J. 1983. Size, location, and polarity of T-DNA encoded transcripts in nopaline crown gall tumors; common transcripts in octopine and nopaline tumors. Cell 32: 1045-1056.
Winans, S., Allenza, P., Stachel, E., McBride, K., and Nester, E. 1987. Characterization of the virE operon of the Agrobacterium tumefcaiens Ti plasmid pTIA6. Nucleic Acids. Res. 15:825-838.
52
Winans, S., Kerstetter, R., and Nester, E. 1988. Transcriptional regulation of the wrA and wrG genes of Agrobacterium tumefaciens. J. Bacteriol. 170:4047 4054.
Winans, S., Kerstetter, R., Ward, J., and Nester, E. 1989. A protein required for transcriptional regulation of Agrobacterium virulence genes spans the cytoplasmic membrane. J. Bacteriol. 171:1616-1622.
Winans, S., Mantis, N., Chen, C, Chang, C, and Han, D. 1994. Host recognition by the VirA, VirG two component regulatory proteins of Agrobacterium tumefaciens. Res. In Microbiol. 145:461-473.
Yadav, N., Postle, K., Saiki, R., Thomashow, M., and Chilton M. 1980. T-DNA of a crown gall teratoma is covalently joined to host plant DNA. Nature 287: 458-461.
Yadav, N., Vanderleyden, J., Bennett, D., Barnes, W., and Chilton, M. 1982. Short direct repeats flanks the T-DNA on a nopaline Ti plasmid. Proc. Natl. Acad. Sci. USA 79: 6322-6326.
Yamada, T., Palm, C, Brooks, B. and Kosuge, T. 1985. Nucleotide sequences of Pseudomonas savastanoi indole acetic acid genes show homology with Agrobacterium tumefaciens T-DHA. Proc.Natl. Acad. Sci. USA 82:6522-6526.
Yanofsky, M., Porter, S., Young, C, Albright, L., Gordon, M., and Nester, E. 1986. The wrD operon of Agrobacterium tumefaciens encodes a site specific endonuclease. Cell 47:471-477.
Yanofsky, M., Montoya, A., Knauf, V., Lowe, B., Gordon M.P., and Nester, E.W. 1985a. Limited-host-range plasmid of Agrobacterium tumefaciens: Molecular genetic analyses of transferred DNA. J. Bacteriol. 163:341-348.
Yanofsky, M., Lowe, B., Montoya, A., Rubin, R., Krul, W., Gordon, M., and Nester, E. W. 1985b. Molecular and genetic analysis of factors controlling host range in Agrobacterium tumefaciens. Mol. Gen. Genet. 201:237-246.
Young. S., and Citovsky, V. 1991. Phylogeny of the phototrophic Rhizobium strain BTAil by polymerase chain reaction-based sequencing of a 16S rRNA gene segment. J.Bacteriol. 173:2271-2277.
Zaenen, I., Van Larebeke, N., Teuchy, H., Van Montagu, M., and Schell, J. 1974. Supercoiled circular DNA in crown gall inducing Agrobacterium strains. J. Mol. Biol. 86: 109-127.
53
Zambryski, P. 1992. Chronicles from the Agrobacterium-plant cell DNA transfer story. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43, 465-490.
Zupan, J., and Zambryski, P. 1995. Transfer of T-DNA from Agrobacterium to the plant cell. Plant Physiol. 107, 1041-1047.
Zupan, J., Citovsky, V., and Zambryski, P. 1996. Agrobacterium VirE2 protein mediates nuclear uptake of ssDNA in plant cells. Proc. Natl. Acad. Sci. USA 93:2392-2397.
54
CHAPTER II
BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OP
AGROBACTERIUM VITIS STRAINS COLLECTED
NEAR LUBBOCK, TEXAS
2.1 Introduction
Agrobacterium vitis (Ophel and Kerr, 1990), formerly called Agrobacterium
tumefaciens biotype III (Kerr and Panagopoulous, 1977), is strongly associated
with grapevine (Burr et al., 1987; Burr and Katz, 1983; Sawada et al., 1990).
Agrobacterium vitis is the primary agent that causes crown gall in grape (Burr,
1988). Its ability to survive systemically in healthy grapevines (Burr and Katz,
1984; Tarbah and Goodman, 1986) makes it a very successful pathogen. It has
been reported that in the U.S. a large portion of grapevine nursery stock is
systemically infected with A. vitis (Goodman et al., 1987). Burr et al. (1995)
reported that A. vitis could survive in decaying grape roots and canes in soil.
This explains the significant damage caused by A. vitis to the grape industry
around the world.
In addition to crown gall disease, A. vitis induces electrolyte leakage and
strong necrotic lisons on the roots of grapevine (Strover et al., 1997; Burr et al.,
1988). This is because A. vitis produces extracellular enzymes
polygalacturonase (PG) and endoglucanase that degrade root epidermal tissue
(Rodriguez-Palenzula et al., 1991; Ophel and Kerr, 1990). Certain A. vitis strains
55
induce only a necrotic response in grape stems (Yanofsky et al., 1985a, 1985b;
Pu and Godman, 1992). This response is not related to the PG enzyme but to
the sensitivity of grapevine to high levels of auxin.
Agrobacterium vitis is distinguished from biotype I and biotype II based on
several chromosomally encoded factors (Kerr and Panagopoulos, 1977). This
includes the production of 3-ketolactose, ability to grow in 2% NaCI, growth at
35°C, acid production from sucrose, erythritol and melezitose, alkali production
from malonic acid, tartaric acid, propionic acid and mucic acid, growth on ferric
ammonium citrate and citrate utilization. One of the unique property of A. vitis is
tartrate utilization, which is preferred even over glucose (Szegedi, 1985).
A. vitis has been divided into four main subgroups: nopaline (N),
octopine/cucumopine (0/C) with small or large TA region (OS and OL plasmids)
and vitopine (V) (Paulus et al., 1989a). The o/c group accounts for half of the
isolated strains (Otten and Ruffray, 1994). Mapping analysis of several Ti
plasmids from the o/c group showed that virulence and T-DNA regions were
highly conserved (Knauf et al., 1984; Otten et al., 1992; Van Nuenen et al., 1993;
Pournier et al., 1994). Otten and Ruffray (1994) compared the Ti plasmid from A.
vitis nopaline strain AB4 to other Ti plasmids and found that the pTiAB4 iaaM,
iaaH and ipt regions were strongly homologous to pTi15955/pToAch5 (93.7%)
and pTiTM4 (94.7%). In an extensive review, Otten et al. (1992) reported that
iaaM and iaaH of octopine, O/C, N, and succinamopine Ti plasmids were highly
homologous. In the same review, they also reported that structure and function
56
of Ti plasmids from different Agrobacterium strains were highly conserved.
Although in certain cases the overall structure of different TI plasmids was only
30% (Engler et al., 1981), a detailed analysis showed that highly homologous
regions (80-85% conservation) were embedded in non-homologous sequences.
(Otten et al., 1992). This observation led to the hypothesis that Ti plasmids are
mosaic structures, constructed by horizontal gene transfer (Otten et al., 1992). In
general, the oncogenes of the T-DNA from different Ti plasmids are well
conserved in structure as well as in function ( Engler et al., 1981; Garfinkel et al.,
1981; Ooms etal., 1981; Leemans etal., 1982; Willmitzer etal., 1982,1983; Joos
et al., 1983; Binns and Thomashow, 1988).
The main objectives of this study were to isolate the predominant strains
of A. vitis associated with vineyards near Lubbock, TX, to characterize the
isolates using biochemical and molecular tests and to determine their host range
and tumorgenesis ability.
57
2.2 Materials and Methods
2.2.1 Isolation of A. vitis. bacteria
Grapevine galls were collected from several vineyards located in six
different counties. Agrobacterium isolates, host cultivar and locations are listed
in Appendix III. The gall tissue surface was sterilized for 20 minutes in 20%
bleach solution and rinsed three times in sterile water. After removing the dark
brown dead tissue, the gall was cut into three to five pieces of approximately two
cm^ and placed in 5 ml of distilled sterile water for 45 minutes to allow bacteria to
diffuse into the water. To isolate and determine the predominant strains, 1 ml of
the liquid was plated on three different solid media and incubated for 3 days at
28 °C. Medium 1A selects for Agrobacterium tumefaciens biotype I, medium 2E
selects for Agrobacterium tumefaciens biotype II (Brisbane and Kerr, 1983) and
Roy-Sasser medium selects for Agrobacterium vitis (Roy and Sasser, 1983).
The other 2 ml were plated on D-1 media (Kado and Heskett, 1970). D-1 media
was used to differentiate Agrobacterium from other Gram negative bacteria.
Colonies grown on D-1 were then replica plated on 1A, 2E and Roy-Sasser
media. Protocols of selective media are listed on Appendix I. Strains resembling
A. vitis were then streaked on YEB medium and examined for purity.
2.2.2 Biochemical characterization
Eighteen purified isolates were given a designation (Table 2.1), and two
previously characterized Agrobacterium isolates (ATCC 49767, A. vitis ; ATCC
58
15955, A. tumefaciens) were used as internal controls. This study included ten
A. vitis isolates with a broad genetic make-up obtained form Dr. Tomas J. Burr at
Cornell University. Purified isolates were subjected to the following determinative
biochemical assays according to Moore et al., (1988): 3-Ketolactose production;
growth in 2% NaCI; acid production from sucrose, erythritol and melezitose; alkali
production from malonic acid, L-tartaric acid, proponic acid and mucic acid;
citrate and ferric ammonium citrate utilization. Strains were grown on YEB liquid
media (Tarbah and Goodman, 1986) for 48 hours at 28 °C. Cultures were diluted
100-fold to get approximately 10^ CPU and 100 |al were used for each assay.
Agrobacterium strains were also screened for octopine and nopaline utilization.
Octopine and nopaline are the most common opines and are commercially
available. A 100 il bacterial culture was streaked on a basal medium containing
5 mM filter-sterilized opine. The controls were grown on the same basal medium
with 5 mM glucose and 5 mM ammonium sulfate. Protocols of biochemical tests
are listed on Appendix B.
2.2.3 Pathooenicitv assay
Seeds of tomato (Lycopersicon esculentum, 'Better Boy Hybrid'),
sunflower (Helianthus annus, 'Sunshine') and tobacco (Nicotina tabacum,
'rustica') plants were germinated in one 2 L pots and grown in the greenhouse.
Six weeks later, stems were wounded with a sterile needle and freshly cultured
Agrobacterium strains were applied to the plant wound. Grapevine (Vitis vinifera,
59
'Sauvignian Blanch') dormant canes were rooted and grown six weeks in the
greenhouse. Green, tender stems were wounded and inoculated as with other
hosts. Tumor formation and morphology was assessed three weeks after the
inoculation. This experiment were repeated three time to reduce any
environmental effects on tumor formation.
2.2.4 Molecular characterization
2.2.4.1 Isolation of Total DNA
Total DNA was isolated from ail Agrobacterium isolates using a modified
procedure of Slusarenko (1990). A volume of 3 ml of YEB medium was
inoculated and grown for 48 hours at 28 °C. Bacteria from a volume of 1.5 ml
were pelleted by centrifugation for 3 min at 4000 xg. The bacteria were then
suspended in 300 ^1 of TE buffer (10 mM, 1.0 mM EDTA), 100 |al of 5% sarkosyl
in TE buffer, and 150 [i\ of Pronase solution (4.0 mg/ml Pronase in TE buffer,
predigested for 30 min at 37 °C). The tubes were incubated at 37 °C for 1 hr.
After complete lysis, the samples were passed through a #20 gauge needle and
centrifuged at 13,000 xg for 30 min. The supernatant was placed into clean
tubes and 0.5 volume of 7.5 M ammonium acetate was added. Tubes were then
placed on ice for 30 min and centrifuged for 30 min at 13,000 xg. The
supernatant was mixed with an equal volume of isopropanol and placed on ice
for 30 min. The DNA pellet was collected by centrifugation at 13,000 xg for 15
60
min, rinsed with 70 % ethanol and vacuum-dried. The pellet was resuspended in
50 \i\ of water. Total DNA was digested by incubating 10 [ig of DNA in 1 X
restriction reaction overnight at 37 °C. The digested DNA was separated using a
1% agarose gel.
2.2.4.2 Isolation of Ti plasmid
The TI plasmid was isolated and purified according to Kuang-Hua (1993).
Ten ml of overnight culture were centrifuged for 5 min at 11,000 xg at 4 °C.
pellets were resuspended in 1 ml of TE buffer, 100 \i\ of 5M NaCI and 20 |il of
10% Na sarkosyl, and equally transferred into two clean 1.5-ml tubes. The tubes
were then centrifuged at 13,000 xg for 2 min, and the pellets were resuspended
in 100 [i\ of solution I (50 mM glucose, 25 mM Tris-HCL pH 8.0, 10 mM EDTA pH
8.0 and 2 mg/ml lysozyme). The preparations were incubated for 10 min on ice,
200 III of Solution II (0.2N NaoH, 1% SDS) were added, and the tubes were then
incubated at 37 °C for 30-60 min. After complete lysis, 50 |al of 2 M Tris-Hcl (pH
7.0) were added and gently mixed. The solution was incubated at room
temperature for 30 min, after which 100 1 of 5 M NaCI were added. Samples
were then extracted twice with phenol/chloroform/isoamyl alcohol (25:24:1). The
supernatant was transferred into a clean, 1.5-ml tube and an equal volume of
isopropanol was added to precipitate the nucleic acid. Pellets were collected by
centrifugation for 15 min at 13,000 xg and rinsed with 70% ethanol. The dry
61
pellets were resuspended in 50 |il of solution I, 85 1 of sterile water and 5 |al of 2
M Tris-HCI (pH 7.0). Tubes were incubated at 50 °C for 5 min to dissolve the
pellet, 10 pi of 2 M NaOH were added, and the preparation was incubated at
room temperature for 5 min. To renature the plasmid DNA, 75 il of ice-cold
solution III [(5M KOAc (60 ml), acetic acid (11.5 ml) and water (28.5 ml))] were
added to samples and incubated on ice for 5 min. Next, 20 |il of 1% EtBr were
added and incubated on ice for 30 min. Tubes were centrifuged for 5 min at
13,000 xg. The plasmid DNA remained in the supernatant, and EtBr was
removed by two phenol extractions and one chloroform extraction. DNA was
precipitated with isoprpanol and washed with ethanol. Plasmids were collected
by centrifugation, the pellets were vacuum-dried and the pellets were
resuspended in 20 pi of TE buffer.
2.2.4.3 Homology study
Ten micrograms of purified total DNA per sample was resuspended in 10
ml of distilled deionized water. Ten units of the appropriate restriction enzyme
(EcoR I, BamH I and Hind III) were added to each sample with the appropriate
buffer supplied by the manufacturer. The DNA was digested overnight at 37 °C.
The digested DNA was loaded onto a 1.0% agarose gel containing 0.5 |ag/ml
EtBr. Electrophoresis was performed at 50 volts for about four hours in TBE
buffer (100 mM Tris borate, 2 mM EDTA, pH 8.3).
62
Restricted DNA fragments in the agarose gel were depurinated in 250 mM
HCI, neutralized in 500 mM NaOH and 400 mM NaCI, and transferred to a nylon
membrane using a vacuum blotting system. After transfer, the membranes were
washed with 2X SSC buffer (pH 7.0), air dried, wrapped in Saran wrap and
stored at 4 °C. Prehybridization was carried out for 24 hours in a solution
containing 6X SSPE, 5X Denhardt's solution (0.02% Picoll, 0.02%
polyvinylpyrolidine, 0.02% bovine serum albumin), 0.5% SDS, and 35%
formamide.
2.2.4.4 PCR analysis
To further investigate the relationship among the Agrobacterium isolates,
two sets of primers were used, primers specific to the 6a gene of A. tumefaciens
biotype I and primers specific to the chromosomally located pheA gene of all A.
vitis. The 6a primers (ACATCATCAATCCTGGCGG) and
(ACTCGTTGCTGGCCTGAAT) were used to amplify a region of approximately
260 bp unique to A. tumefaciens biotype 1 (Eastwell et al., 1995). The pheA
primers (CGATGGCGGCGAGGATTT) and (ATCGGGCGTGAAACAAGT) were
used to amplify a region of 199 bp from the pheA gene unique to A. vitis. Each
50 pi of PCR reaction contained 100 pmole of each opposing primer; 1 ig of
template genomic or plasmid DNA; 5 1 of 10X Taq buffer containing 500 mM
KCI, 100 mM Tris-HCI (pH 9.0 at 25 °C), and 1% Triton X-100; 4 mM of MgCb;
63
1.5 mM of each of 4 dNTP's; and 2.5 U of Taq polymerase (Promega). A volume
of 150 pi of mineral oil was layered on the top of the sample to prevent
evaporation during the PCR cycles. The PCR amplification were performed with
an initial incubation at 96 °C followed by 35 cycles as follows: denaturation (95
°C, 1 min), annealing ( 50 °C, 30 sec), and extention ( 72 °C, 5 min). At the
completion of the final cycle, the reactions were held at 72 °C for 5 min followed
by cooling to 19 °C.
2.3 Results and Discussion
2.3.1 Isolation and biochemical characterization of A. vitis.
Table 2.1 shows strains of Agrobacterium used in this study. Included
were 18 isolates collected locally designated by LT, ten strains with diverse
genetic make up (obtained from Dr. Thomas J. Burr, Cornell University) and two
previously characterized strains from the American Type Culture Collection,
ATCC 49767 and ATCC 15955, as internal controls. Out of the twenty-three
different galls collected, eighteen A. vitis strains were isolated. No
Agrobacterium strains were detected in galls from cultivar "Chardonnay"
collected from Bill Brown and Morris's vineyards (Appendix C). The simplest
explanation of this observation is that Agrobacterium strains may not be able to
ovenA/inter or survive systemically in the cultivar "Chardonnay" under specific
conditions. Gillings and Ophel-Keller, (1995) indexed grapevine cuttings from
different geographical areas and found that the levels of Agrobacterium vitis
64
varied between locations and cultivars. These results suggest that the
distribution of Agrobacterium population is affected by the interaction between
environment and host genotype. The levels of infestation also varied between
hosts. The genotype Sauvignian Blanc was the most frequently infected by A.
vitis. The level of infestation is estimated by the number of bacterial colonies
collected from the gall tissue. Sauvignian Blanc had three to five times more
colonies of A. vitis than other lines. This indicate that this line is more sensitive
and that propagated material from Sauvignian Blanc should be carefully indexed
to avoid the propagation of the bacterium to new vineyards. The level of
infestation of A. vitis is very important factors in tumorgenesis. Many techniques
used to reduce A. vitis damage to grape are effective only in reducing the level of
the bacteria rather than eradicating the pathogen (Burr et al., 1996).
The selective media and replica plating showed that all isolates were able
to grow only on Roy-Sasser media, which is selective for A. vitis. No other
Agrobacterium biotype was detected, indicating that the predominant strain
associated with grapevine was A. vitis. This observation was documented in
previous reports (Bien et al., 1990; Sawada et al., 1990). The strong and specific
association between A. vitis and grapevine is attributed to A. vitis' ability to use
tartrate as a carbon source (Szegedi, 1985) and the ability to induce necrosis in
grapevine roots due to the presence of a polygalacturonase gene pheA (McGuire
et al. 1991). It was found that PheA protein is accumulated mainly in the
periplasm of the bacterium and it is able to produce dimers, trimers and
65
monomers from polygalacturonic acid (Herlache et al., 1997). Such compounds
are probably used to stimulate the virulence system of A. vitis, since galacturonic
acid has been reported to enhance wrgene expression (Ankenbauer and Nester,
1990).
Purified strains were subjected to several determinative biochemical tests
listed in Table 2.2. Although all isolates were able to grow on Roy-Sasser media,
metabolized tartrate and tolerated 2% NaCI, there was a significant variability
based on other tests (Table 2.2). Two groups can be identified based on these
tests. The first group contains LT1-LT6, LT11, LT13, LT15, and LT17. This
group tended to share some biochemical characteristics with Agrobacterium
tumefaciens biotype I, such as 3-ketolactose production and acid production from
sucrose, erythritol and melizitose. The second group contains LT7-LT10, LT12,
LT14, LT16 and LT18. Group II had similar biochemical responses to A. vitis in
most assays. It was interesting to note that all isolates were able to grow and
produce pigment in ferric ammonium citrate, considered unique for
Agrobacterium tumefaciens biotype I (Moore et al., 1988). Similar variation was
also seen among the A. vitis strains previously characterized (CG series, see
Table 2.2). This variability suggests that the population structure of Lubbock
isolates may consist of at least two clonal lines. The original clonal strains may
not be locally evolved but rather introduced into the area with the original
propagating materials. The systemic survival of A. vitis in the plant host is well
established (Burr and Katz, 1984) and its persistence in surviving in decaying
66
grape and cane tissue for a long period of time provide a successful mean for
spreading (Burr et al., 1995).
The diagnostic tests are performed on chromosomally encoded genes that
are supposedly much more stable than plasmid-encoded factors, because they
are not subjected to horizontal gene exchange. However, in this study we have
seen that a significant variation exists among various strains in terms of
chromosomally encoded genes. Other studies have demonstrated that the
A. vitis chromosome and Rhizobium strains have a high degree of polymorphism
(Otten et al., 1992; Martinez et al., 1990). In a very informative study, Schuiz et
al. (1993) studied 42 A. vitis strains, using genomic fingerprinting and IS
elements, and identified six genomic groups with homologous restriction
patterns. They also noted that for every genomic group, a distinct IS elements
pattern was found. Since IS elements played a major and an important role in Ti
plasmid and Rhizobium chromosome diversity (Paulus et al., 1989b, Martinez et
al., 1990; Otten et al., 1992) one can speculate that similar events may be
associated with the Agrobacterium chromosome. Therefore, the assumption that
the bacterial chromosome is relatively more stable than plasmid may not be true
in all cases.
Screening for opine utilization revealed two groups. The first group
contained 15 out of the 18 isolates, and all were able to use octopine. However,
within this group, strains LT7, LT12 and LT9 were able to grow on octopine and
67
nopaline solid media but not on nopaline liquid media. This suggests that they
are probably true octopine types. All previously isolated octopine strains of A.
vitis were also cucumopine type (Pournier et al., 1994; Otten et al., 1992; Paulus
et al., 1989a). Therefore, group I can be classified as octopine/cucumopine (o/c).
It was not surprising that most of isolates in this study were o/c, since
approximately half of A. vitis isolated world-wide are o/c (Otten and Ruffray, 1994;
Van Nuenen et al., 1993). The second group contained LT3, LT10 and LT16 that
were unable to use either octopine or nopaline, indicating that these strains may
belong to vitopine group. It is important to note that o/c strains have been
divided into wide-host-range (WHR) that induce tumors on tobacco and tomato,
and limited-host-range (LHR) that are only virulent on grape (Paulus et al. 1989b,
Knauf et al.,1982). Actually the evolution and the predominance of this group
has been linked to the development of viticulture during last two centuries (Otten
et al., 1992). The pathogenicity test showed that all o/c strains isolated around
Lubbock were LHR (Section 2.3.3). This is additional evidence of the clonal
origin of Lubbock isolates.
2.3.3 Pathogenicity test
Agrobacterium isolates were tested for virulence on tomato, sunflower,
tobacco and grape plants. Strains were considered virulent only if they were able
to induce a tumor with an equal or greater diameter than the infected stem. This
was important to define, since sometimes a hypersensitive response or stem
68
swelling tends to look similar to the gall tissue. As was expected, the bacterial
strain with the broadest host range was the A. tumefaciens ATCC15955.
Because ali of the other strains were originally isolated from grape, those virulent
on other hosts were identified as WHR strains.
Local isolates were LHR being virulent only on grape, with the exception
of LT12 which was also virulent on tobacco (Table 2.3). The other grapevine
isolates (CG series) had different host ranges, with most of them virulent on
tomato, tobacco and grape. The LHR character of the local strains can be
attributed to the fact that all had o/c Ti plasmids and also that their sites of
isolation were geographically limited. Contrary to this, the CG strains had
diverse Ti plasmids and were isolated from a broader geographical area (Table
2.1 and Table 2.3). Although LHR and WHR o/c strains differ in their host range,
at the molecular level they share extensive DNA homology (Knauf et al., 1983).
It was reported that most A. vitis LHR strains have a deletion or a major
rearrangement on the cytokinin biosynthesis gene (ipt) which renders it inactive
(Hooykass and Schilperoort, 1992).
The morphology of the tumor tissue differs from strain to strain (Fig.2.1 to
Fig.2.8). For example, A. tumefaciens ATCC15955 was super-virulent on tomato
in terms of rate of appearance and larger size but less virulent on grape, inducing
small galls. Sunflower was highly resistant to all the Agrobacterium strains,
except for A. tumefaciens ATCC15955 and several A. vitis that caused a
69
hypersensitive response. Such a response is probably due to the ability of A.
vitis to produce polygalacturonase and endoglucanase that degrade epidermal
tissue (Rodriguez-Palenzula et al., 1991; Ophel and Kerr, 1990). Two super-
virulent strains on grape were identified, namely CG475 and LT9. Both strains
were o/c, highly virulent, and induced tumor formation faster than any other
bacterium (within two weeks of infection) (Pig.2.4), but most interestingly, the site
of isolation of both strains was relatively close. The LT9 was isolated from
Lubbock, TX and CG475 from New Mexico.
The fact that the same bacterium caused different responses on
different hosts suggests the involvement of plant factors in the process of
pathogenicity. The assumption that tumor formation is solely dictated by
the bacterium may not be true. It is rather a product of the Interaction
between plant and bacterial factors that determine the degree of virulence
and the morphology of the tumor. One way the plant interacts with the
bacteria is at the level of T-DNA integration and its expression. All
oncogenes located within the T-DNA have eukaryotic regulatory elements;
therefore, their expression requires plant transcription factors. The plant
may exploit this characteristic to restrain or inhibit tumor formation and
hence reduce the host range. This may be why Agrobacterium is unable
to infect most monocot plants. Grimsley et al. (1987) inoculated maize
seedlings with T-DNA carrying the maize streak virus genome and found
70
that most seedlings developed viral symptoms. Another experiment
showed that the limitation to transform maize is due to insufficient T-DNA
integration and/or expression of T-DNA genes (Narasimhulu et al., 1996).
The host plant can also affect the genetic make-up of the Inciting bacteria.
Belanger et al. (1995) reported that five different A. tumefaciens strains
originally isolated from apple tumors yielded 99% nonpathogenic mutants
after their reintroduction Into axenic apple plants. Such rearrangement on
the bacterial genome can be expected more frequently in
octopine/cucumopine A. vitis strains since, their Ti plasmid is highly
unstable due to the presence of an unusual duplication of a 2.3-kb DNA
fragment (Pournier et al., 1994). All of this evidence shows that the host
plant plays an important role in determining the host range of
Agrobacterium.
2.2.4. Molecular characterization of A. vitis
To make sure that all isolates harbor the pathogenic Ti plasmid, total DNA
was extracted and plasmids were visualized. All isolates contained large
plasmid (Pig. 2.5). The plasmid Intensity varied among strains but the size was
very similar except for LT9 and LT12 that had relatively larger-sized plasmids.
This may explain some of the uniqueness of the two strains. Unlike all other
local strains, LT9 was highly virulent on grape and LT12 was the only strain to
71
cause tumors on tobacco. The sizes of the Ti plasmids were equal or greater
than 120 kb, since the molecular weight of Til 5955 is known to be approximately
120 kb(Daniela etal., 1978).
The first objective of this study was to assess the relationship between
various isolates using genetic markers from the Ti plasmid and from the bacterial
chromosome. Throughout their evolution, A. vitis evidently experienced
significant rearrangements in their Ti plasmid. One event was the deletion of the
6a gene present in A. tumefaciens biotype I (Pournier et al., 1994). As was
expected, the primers specific for the 6a gene unique to A. tumefaciens amplified
a single and intense band with DNA from Til 5955 (Pig. 2.8). The size of the
band was consistent with the predicted fragment of 260 bp. However, when the
same primers were used with Ti plasmid DNA from all A. vitis strains, no
amplification was achieved. This clearly shows that the locally isolated strains
were true A. vitis, although some were similar to A. tumefaciens biotype I based
on a few biochemical tests. When primers specific for the pheA gene were used
with total DNA as template, multiple bands were amplified. The predicted band
of 199 bp was very difficult to assess, since the amplification of the band was not
reproducible. The pheA gene is a chromosomally located gene specific to A.
vitis. It encodes polygalacturonase, which is a pectic enzyme that induces root
decay. In this study, we were not able to use this gene as a marker using
polymerase chain reaction (PCR). This is probably due either to the lack of
72
appropriate conditions for the PCR or the significant genetic variation of the
bacterial chromosome.
The second objective was to assess the level of homology of the
oncogenic T-DNA region between A. vitis isolates using T-DNA probes pGV0153
and pGV201 (De Vos et al., 1981). These two probes are clones from the broad
host range Agrobacterium tumefaciens Ach5, a biotype I strain. Both pGV153
and pGV201 were used extensively to study DNA homology between virulent
strains of Agrobacterium. According to Paulus et al. (1989a), pGV153 will
hybridize with DNA from strains having a significant DNA sequence homology to
both T-DNA A region (TA) and T-DNA B region (TB) tryptophan monooxygenase
(iaaM) and indoleacetamide hydrolase (iaaH) genes, while pGV201 will hybridize
if the homology is significant at isopentenyladenosine phosphotransferase (ipt),
6b and cos genes.
Southern hybridization using the pGV0153 probe shows that all isolates
were homologous in TB and TA iaa genes (Fig. 2.7). This was expected since all
isolates were assumed to be virulent due to their presence in crown gall tissue
and detection of a large Ti plasmid. Hybridization using pGV201 revealed that all
isolates share a significant homology at the ipt, 6b and cos region with exception
of LT4, LT6 and LT17, indicating a major rearrangement at this region. This did
not result in loss of virulence as demonstrated before. Actually, the ipt gene is
not required by A. vitis strains for virulence (Bonnard et al., 1989), but it is
73
necessary to broaden the host range. This was demonstrated by introducing an
intact ipt gene from a WHR into a LHR strain, which expanded the host range
(Yanofsky, 1985b). The other genes 6b and cos are not known to play a role in
tumor formation, and that may explain why strains LT4, LT6 and LT17 remain
pathogenic. Purther analysis with pGV201 using three different restriction
enzymes (Eco Rl, Bam H I and Hind III) showed very low polymorphism in the
phytohormone genes among isolates. This indicates that A. vitis strains are
highly conserved at this region. In extensive studies, Otten and co-workers
demonstrated that the iaaM and iaaH genes of octopine, octopine/cucumopine,
nopaline and succinamopine Ti plasmids are strongly homologous (Otten et al.,
1992; Van Nuenen et al., 1993; Pournier et al.,1994). They also surveyed the
T-DNA region of five subclasses of o/c Ti plasmids and found that the existing
differences are predominantly due to insertion elements (IS), and that DNA
sequences outside the IS elements are more than 99.7% identical (Otten et al.
1992). Even phytohormone genes from A. tumefaciens biotype I are highly
homologous with their A. vitis counterparts. Comparing published sequences
from A. vitis and A. tumefaciens, iaaH genes had 89% DNA homology and iaaM
genes had 90% homology. Even the CAAT and TATA elements were conserved
at positions-98 and-57, respectively (Bonnard etal., 1991; Baker etal., 1983).
74
2.4 References
Ankenbauer, R.G., and Nester, E.W. 1990. Sugar mediated induction of Agrobacterium tumefaciens virulence genes: Structural specificity and activities of monosaccharides. J. Bacteriol. 172:6442-6446.
Baker, R.F., Idler, K.B., Thompson, D.V., Kemp, J.D. 1983. Nucleotide sequence of the T region from the Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2:335-350.
Belanger, C , Cantfield M.L., Moore, L.W., and Dion, P. 1995. Genetic analysis of nonpathogenic Agrobacterium tumefaciens mutants arising in crown gall tumors. J. Bacteriol. 177:3752-3757.
Bien, E., Lorenz, D., Eichhom, K., and Plapp, R. 1990. Isolation and characterization of Agrobacterium tumefaciens from the German vine region Rheinpalz. J. Plant Dis. Prot. 97:313-322.
Binns, A.N., and Thomashow, M.F. 1988. Cell biology of Agrobacterium infection and transformation of plants. Annu. Rev. Microbiol. 42:575-606
Bonnard, G. Vincent, P. and Otten, L. 1991. Sequence of Agrobacterium tumefaciens biotype III auxin genes. Plant Mol. Biol. 16:733-738.
Bonnard, G., Tinland, B., Paulus, P., Szegedi, E., and Otten, L.I989. Nucleotide sequence, evolutionary origin and biological role of a rearranged cytokinin gene isolated from a wide host range biotype III Agrobacterium strain. Mol.Gen.Genet 216:428-438.
Brisbane, P.G., and Kerr, A. 1983. Selective media for three biovars of Agrobacterium. J. Appl. Bacteriol. 54:425-431.
Brisset, M. N., Rodriguez-Palenzula, P., Burr, T.J. and Collmer, A. 1991. Attachment, chemotaxis, and multiplication of Agrobacterium tumefaciens biovar 1 and biovar 3 on grapevine and pea. Appl. Environ. Microbiol. 57:3178-3182.
Burr, T. J., Reid, C. L., Splittstoesser, D.P., and Yoshimura, M. 1996. Effect of heat treatments on grape bud mortality and survival of Agrobacterium vitis in vitro and in dormant grape cuttings. Am. J. Enol. Vitic. 47:119-123
Burr, T. 1988. Crown gall. In: Compendium of Grape Diseases, R.C. Pearson and A. C. Goheen (Eds.), pp. 41-42. APS Press, St Paul, MN.
75
Burr, T. J. and Katz, B. H. 1983. Isolation of Agrobacterium tumefaciens biovar from grapevine galls and sap and from vineyard soil. Phytopathology. 73:163-165.
Burr, T. J., Bishop, A. L, Katz, B. H., Blanchard, L. M., and Bazzi, C. 1988b. A root-specific decay of grapevine caused by Agrobacterium tumefaciens and A. radiobacter b\o\jar 3. Phytopthology 77: 1424-1427.
Burr, T. J., Katz, B. H., and Bishop, A. L. 1987. Population of Agrobacterium in vineyardand nonvineyard soils and grape roots in vineyards and nurseries. Plant Dis. 71:617-620.
Burr, T.J., Reid, C.L, Yoshima, M., Momol, E.A., and Bazzi, C. 1995. Survival and tumorigenicity of Agrobacterium vitis in living and decaying grape roots and cane in soil. Plant Dis. 78:677-682.
Burr, T.J., and Katz, B. H. 1984. Grapevine cuttings as potential sites of survival and means of dissemination of Agrobacterium tumefaciens. Plant Dis. 68976-978.
Collmer, A., and Keen, N. T., 1986. The role of pectic enzymes in plant pathogenesis. Ann. Rev. Phytopathology 24:383-409.
Daniela, S., Montoya, A.L., and Chilton, M.D. 1978. Fingerprints of Agrobacterium Ti plasmids. Plasmid 1:238-258.
De Vos, G., DE Beuckeleer, M., Van Montagu, M., and Schell, J. 1981. Restriction endonuclease mapping of the Octopine Tumor-inducing Plasmid pTiAch5 of Agrobacterium tumefaciens.
Deng, W.; Pu, X., Goodman, R.N., Gordon, M.P., and Nester, E.W. 1995. T-DNA genes responsible for inducing a necrotic response on grapevines. MPMI. 4:538-548.
Engler, G., Depicker, A., Maenhout, R., Villaroel, R., Van Montagu, M., and Schell, J. 1981. Physical mapping of DNA base sequence homologies between an octopine and nopaline Ti plasmid of Agrobacterium tumefaciens. J. Mol. Biol. 152:183-208.
Fournier, P., de Ruffray, P., and Otten, L. 1994. Natural instability of Agrobacterium vitis Ti plasmid due to unusual duplication of a 2.3 kb DNA fragment Mol. Plant-Microb. Interact 7:164-172.
76
Garfinkel, D., J., Simpson, R. B., Ream, L. W., White, P. P., Gordon, M. P., and Nester, E. W. 1981. Genetic analysis of crown gall: a fine structure map of the T-DNA by site-directed mutagenesis. Cell 27:143-153
Gillings, M. and Ophel-Keller K.1995. Comparison of strains of Agrobacterium vitis from grapevine source areas in Australia. Australian Plant Pathology 24:29-37.
Goodman, R.N., Butrov, D. and Tarbah, P. 1987. The occurrence of Agrobacterium tumefaciens in grapevine-propagating material and a simplified indexing system. Am. J. Enol. Vitic. 38:189-193.
Grimsley, N., Hohn, T., Davies, J.W., Hohn, B.I987. Agrobacterium mediated delivery of infectious maize streak virus into maize plants. Nature 325:117 79.
Herlache, T. C, Hotchkiss, JR. A. T., Burr, T. J., and Collmer. A., 1997. Charcterization of the Agrobacterium vitis pheA gene and comparison of the encoded polygalacturonase with homologous enzymes from Erwinia carotovora and Ralstonia solancearum. Applied and Envir. Microbiol. 63:338-346.
Hooykass, P.J., and Schilperoort, R.A. 1992. Agrobacterium and plant genetic engineering. Plant Molecular Biology 19:15-38.
Hooykass, P., den Dulk-Ras, H., and Schilperoort, R. 1988. the Agrobacterium tumefaciens T-DNA gene 6b is an one gene. Plant Mol. Biol. 11:791-794.
Joos, H., Inze, D., Caplan, A., Sormann, M., and Van Montagu, M. 1983. Genetic analysis of T-DNA transcripts in nopaline crown galls. Cell 32:1057-1067.
Kado, E. I., and Heskett, M. G. 1970. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas, and Xanthomonas. Phytopathology 60:969-976.
Kerr, A., and Panagopoulous, CG. 1977. Biotypes of Agrobacterium radiobacter var tumefaciens and their biological control. Phytopathol. Z. 90:172-179.
Knauf, V. C. Yanofsky, M., Montoya, A., and Nester, E. W. 1984. Physical and functional map of an Agrobacterium tumefaciens plasmid that confers a narrow host range. J. Bacteriol. 160: 564-568.
77
Knauf, V. C , Panagopoulous, CG, and Nester, E. W. 1982. Genetic factors controlling host range of Agrobacterium tumefaciens. Phytopathology. 12; 1545-1549.
Knauf, V. C , Panagopoulous, CG, and Nester, E. W. 1983. Comparison of Ti plasmids from three different biotypes of Agrobacterium tumefaciens isolated from grapevines. J. Bacteriol. 153:1535-1542.
Kuang-Hua Amy Hsu.1993. Molecular analysis of Agrobacterium Strains Isolated from Muscadine (Vitis Rotundifolia). Master Thesis, Mississippi State University.
Leemans, J., Deblarere, R., Willmizer, L., DeGreve, H., and Hernalsteens, J. P. 1982. Genetic identification of functions of TL-DNA transcripts in octopine crown galls. EMBO J. 1:147-152.
Martinez, E., Romero, D., and Palcios, R. 1990. the Rhizobium genome. Pages 59-93 in: Critical Reviews in Plant Sciences.
McGuire, R.G., Rodriguez-Palenzula, P., Collmer, A., and Burr, T.J. 1991. Polygalacturonase production by Agrobacterium tumefaciens biovar 3. Appl. Environ. Microbiol. 57:660-664.
Moore, L. W, Kado, C I., and Bouzar, H. 1988. Gram-negative bacteria. A. Agrobacterium. pp 16-36. In: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 2"^. ed. N.W. Schaad, ed. American Phytopathological Society, St. Paul, MN.
Narasimhulu, S.B., Deng, X.B., Sarria, R., and Gelvin, S.B. 1996. Early transcription of Agrobacterium T-DNA genes in tobacco and maize. Plant Cell 8, 873-886.
Ooms, G., Hooykaas, P. J.J., Noleman, G., and Schilperoort, R. A. 1981. Crown gall tumors of abnormal morphology induced by Agrobacterium tumefaciens carrying mutated octopine Ti plasmids: analysis of T-DNA functions. Gene 14:33-50
Ophel, K, and Kerr, A. 1990. Agrobacterium vitis sp. nov. for strains of Agrobacterium biovar 3 from grapevines. Int. Syst. Bacteriol. 40:236-241.
Otten, L., and Ruffray, P. 1994. Agrobacterium vitis nopaline Ti plasmid pTiAB4: relationship to other Ti plasmids and T-DNA structure.
78
otten, L., Canaday, J., Gerard, J-C, Crouzet, P., Paulus, P. 1992. Evolution of Agrobacteria and their Ti plasmids. A review. Mol. Plant-Microb. Interact. 5:279-287.
Paulus, P., Huss, B., Bonnard, G., Ride, M., Szegedi, E., Tempe J., Petit A., and Otten, L. 1989a. Molecular systematic of biotype III Ti plasmids of Agrobacterium tumefaciens. Mol Plant-Microb. Interact. 2:64-74.
Paulus, P., Ride, M., and Otten, L. 1989b. Distribution of two Agrobacterium tumefaciens insertion elements In natural isolates: Evidence for stable association between Ti plasmids and their bacterial hosts. Mol. Gen. Genet 219:145-152.
Pu, X. A., and Goodman, R. N. 1992. Induction of necrogenesis by Agrobacterium tumefaciens on grape explants. Physiol. Mol. Plant Pathol. 41:241-254.
Rodriguez-Palenzula, P., Burr, T.J., and Collmer, P. 1991. Polygalcturonase is a virulence factor in Agrobacterium tumefaciens biovar 3. J. Bacteriol. 173: 6547-6552.
Roy, M., and Sasser, M. 1983. A medium selective for Agrobacterium tumefaciens biotype 3. Phytopathology 73:810.
Sawada, H., leki, H., and Takikawa, Y. 1990. Identification of grapevine crown gall bacteria isolated in Japan. Ann. Phytopathol. Soc. Jpn. 56:199-206.
Schuiz, T.P., Bauer, C, Lorenz, D., Plapp, R., and Eichhorn, K.W. 1993. Studies on the evolution of Agrobacterium vitis as based on genomic fingerprinting and IS element analysis. System. Appl. Microbiol. 16, 322-329.
Slusarenko, A. J. 1990. A rapid miniprep for the isolation of total DNA from Agrobacterium tumefaciens. Plant Mol. Biol. Reporter 8:249-252.
Strover, E. W., Swatz, H., J., and Burr, T., J. 1997. Agrobacterium wY/s-lnduced electrolyte leakage in crown gall susceptible and resistant grape gentoypes. Am.J. Enol. Vitic, 2: 145-149.
Szegedi, E. 1985. Host range and specific L(+)-tartrate utilization of biotype 3 Agrobacterium tumefaciens. Acta Phytopathol Acad Sci Hung 20:17-22
Tarbah, P. A., and Goodman, R. N. 1986. Rapid detection of Agrobacterium tumefaciens in grapevine propagating material and the basis for an efficient indexing system. Plant Dis. 70:566-568.
79
Thomashow, L., Reeves, S., and Thomashow, M. 1984. Grown gall oncogenesis: Evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid. Proc. Natl. Acad. Sci. USA 81:5071-5075.
Van Nuenen, M., de Ruffray, P., Otten, L. 1993. Rapid divergence of Agrobacterium vitis octopine-cucumopine Ti plasmids from a recent common ancestor. Mol. Gen. Gent. 240:49-57.
Willmitzer, L., Simons, G., and Schell, J. 1982. The TL-DNA of octopine crown gall tumors codes for seven well defined polyadenylated transcripts. EMBO. J. 1:139-146.
Willmitzer, L., Dhaese, P., Schreider, P. H., Schmalenbach, W., Van Montagu, M. 1983. Size, location, and polarity of T-DNA encoded transcripts in nopaline crown gall tumors: evidence for common transcripts present in both octopine and nopaline tumors. Cell 32:1045-1056.
Yanofsky, M., Lowe, B., Montoya, A., Rubin, R., Krul, W., Gordon, M., and Nester, E. W. 1985b. Molecular and genetic analysis of factors controlling host range in Agrobacterium tumefaciens. Mol. Gen. Genet. 201:237-246.
Yanofsky, M., Montoya, A., Knauf, V., Lowe, B., Gordon M.P., and Nester, E.W. 1985a. Limited-host-range plasmid of Agrobacterium tumefaciens: Molecular genetic analyses of transferred DNA. J. Bacteriol. 163:341-348.
80
Table 2.1. List of Agrobacterium isolates
Isolates Designation LT1 LT2 LT3 LT4 LT5 LT6 LT7 LT8 LT9 LT10 LT11 LT12 LT13 LT14 LT15 LT16 LT17 LT18 ATCC 49767 ATCC 15955 CG49 CG56 CG101 CG415 CG98 CG108 CG78 CG475 CG81 CG450
Biotype A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. tumefaciens A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis
Host Unknown Unknown Unknown Unknown Merlot Merlot Sauv. Blanc Sauv. Blanc Sauv. Blanc CBSV Shardonnay Shardonnay Shardonnay Sauv. Blanc Sauv. Blanc Shardonnay Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown
Source Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas ATCC ATCC New York Michigan Virginia New York Virginia New Mexico New York New Mexico Michigan New York
81
v>
B 15 o E a> sz o o io o
• . »
(0 c "ro k .
tn E
ni
o <
10 (U M c o QL (0 (D Q:
0) .O (0
u 3
O 'c o
S o . u o
= (0 (0 -c . ^ (0
"c
(D
g
E o P c: * : .c
< a> u> o k . o 3
y ' k .
a3 Li.
0) C CO o .b •c b
O CO
"o n Z
0) (A
2 c
+ • " I I I + + + 1 + I + I I 1 + + • I I I I I I
I I I I I ' > + l + l + l + + l , + + , , , , I I I I I
+ + + + + + + + + + + + + + , + + + + I + + + + + , + + +
+ + + + + + + + + + + +,+ ,+ , + +,^^^^^_^_ ^ ^ ^
+ + + + + + + • + • + . + . + • 1 + + + .
+ + + + + + + ! I I + . + I + , + . , + , , I l l +
+ + + + + + + . , . + + + . + + + , , + , , ^ . ^ _^
+ + + + + + + + + + + + . + ^ + + + + ^ + _J + + + , + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + . + + + + + + + + +
+ + + + + + • I I l + l + i + . + , , + + + + , , + + +
- ' - ' - - ' - i - - i - i - i - i - i - i - i _ i _ i _ i _ j _ j - j I _ i ' * ^ 0 0 0 0 0 0 0 0 0 0
82
Table 2.3. Virulence of Agrobacterium strains on selected host and opine utilization.
Virulence on Strain Tomato Sunflower Tobacco Grape
Opine Utilized
LT1 LT2 LT3 LT4 LT5 LT6 LT7 LT8 LT9 LT10 LT11 LT12 LT13 LT14 LT15 LT16 LT17 LT18 49767 15955 CG49 CG56 CG101 CG415 CG98 CG78 CG108 CG475 CG81 CG450
-
-
-
-
-
+
+--
-
-
+ -
+ -
+ + +
HR HR HR
HR
HR HR +
++ +
+ + + + +
+: virulent; -: avirulent; ++: supervirulent; HR: hypersensitive +/- weak virulence; Vit: vitopine; O/C: octopine cucumopine; Oct: octopine; N/D: not determined.
+ + + + + + + + ++ + + + +/-+ +/-+ + + + +/-+ + + + + + + ++ + +
jnsitive lopine;
Oct Oct N/D Oct Oct Oct Oct Oct Oct N/D Oct Oct Oct Oct Oct N/D Oct Oct Oct Oct Nop Nop Vit O/C Vit Vit O/C O/C Vit Vit
f response Nop: Nopaline
83
A B C D E F G H I J K P M N O
Fig 2 1. Tumor induced by Agrobacterium strains on tobacco. A: LT1; B: LT2; C: LT3; D: LT4; E:LT5; F:LT6; G:LT7; H:LT8; l:LT9; J:LT10; K:LT11; P:LT12; M:LT13; N:LT14; 0:LT15; a:LT16; b:LT17; c:LT18; d:ATTC49767; e:ATTC15955; f:CG49; g:CG56; h:CG78; l:CG81; j:CG98; k:CG101; l:CG108; m:CG415; n:CG450; o:CG475.
84
A ^ B C p E F G H I J K P M N O -It.
1 > ^
y x •/."'?•,
1 ? if i r • I i I I I
Fig. 2.2. Tumor induced by Agrobacterium strains on tomato. A: LT1 • B-LT2; C: LT3; D: LT4; E:LT5; F:LT6; G:LT7; H:LT8; l:LT9; J:LT'IO; K:LT11; P:LT12; M:LT13; N:LT14; 0:LT15; a:LT16; b:LT17; c:LT18-d:ATTC49767; e:ATTC15955; f:CG49; g:CG56; h:CG78; l:CG81 ' j:CG98; k:CG101; l:CG108; m:CG415; n:CG450; o:CG475
85
A B C D E F G H I J K P M N O
Fig. 2.3. Tumor induced by Agrobacterium strains on sunflower A" LT1 B LT2; C: LT3; D: LT4; E:LT5; F:LT6; G:LT7; H:LT8; l:LT9; JiLTIo' K:LT11; P:LT12; M:LT13; N:LT14; 0:LT15; a:LT16; b:LT17 cLT18-d.ATTC49767;e:ATTC15955;f:CG49;g:CG56;h:CG78- ICG81 ' j:CG98; k:CG101; l:CG108; m:CG415; n:CG450; o:CG475
86
Fig. 2.4. Tumor types induced by Agrobacterium vitis strains on grape
87
1 2 3 4 5 6 7 8 9 10 11 121314 15
TI
1617 18 19 20 21 22 23 24 25 26 27 28 29 30
Fig. 2.5. Agarose gel electrophoresis showing Ti plasmids of Agrobacterium strains. Lanes: 1: LT1; 2: LT2; 3: LT3;4: LT4; 5:LT5; 6:LT6; 7:LT7; 8:LT8; 9:LT9; 10:LT10; 11:LT11; 12:LT12; 13:LT13; 14:LT14; 15:LT15; 16:LT16; 17:LT17; 18:LT18; 19:ATTC49767; 20:ATTC15955; 21:CG49; 22:CG56; 23:CG78; 24:CG81; 25:CG98; 26:CG101; 27:CG108; 28:CG415; 29:CG450; 30:CG475.
88
C ^ v ^ v 'i CS C ^ <S'^ C^ v * v "* v "
^ 5 ^ ^ ^
.f^m^.- ^iSlgtl0 ^^«uii
V ? ^ Ci * v " v ^ v ^ v ^ v ''' v * 0-- ^
T*!*. ' '--* *'
Fig. 2.6. Southern hybridization analysis of Eco Rl digest of TI plasmid using pGV201 probe
89
<^ \^ v ' v ^ vS C ^ C i C * C<
v ^ v^^^^ ' v^^W^^^ v^^W^^* .> ..v
Fig. 2.7. Southern hybridization analysis of Eco Rl digest of Ti plasmid using pGV153 probe
90
M 20
Fig. 2.8. PCR amplification of 260 bp fragment from A. tumefaciens. Lanes: M: molecular Marker (Hind III X)', 20: Ti 15955 amplified with primer pair 6a.
91
CHAPTER III
ANTISENSE RNA MEDIATED RESISTANCE EXPRESSION
TO GROWN GALL IN TOBACCO
3.1 Introduction
Agrobacterium is a soil-inhabiting. Gram-negative pathogen. It causes
crown gall disease in many woody and herbaceous plants. The host range of
Agrobacterium includes 600 plant species from 331 genera (DeCleene and
DeLey, 1976). The tumor formation is the result of the transfer and expression of
T-DNA genes in the plant host genome.
Agrobacterium evolved a two-component signal transduction pathway by
which the process of infection is regulated. This system is composed of VirA and
VirG proteins. The VirA acts as the environmental sensor and VirG is the
response regulator that binds to the promoter regions of wr operons. The
activation of virulence operons leads to the transfer and integration of the T-DNA
into the host genome. It is the expression of the T-DNA, mainly phytohormone
genes, that lead to the tumor formation. Auxin and cytokinin are the two main
phytohormones produced by Agrobacterium T-DNA genes. The ipt gene
encodes an isopentenyl transferase that catalyses the formation of the cytokinin
isopentenyl-AMP from isopentenyl pyrophosphate and AMP. The auxin
biosynthesis is a two-step pathway. The iaaM gene encodes a tryptophan 2-
monooxygenase which catalyzes an oxidative decarboxylation of tryptophan into
92
3-indoleacetamide (lAM), while the iaaH gene encodes indoleacetamide
hydrolase that converts lAM into 3-indoleacetic acid (IAA). It is important to note
that auxin biosynthesis in Agrobacterium tumefaciens is very similar to many
other hormone-producing bacteria such as A. rhizogenes and Pseudomonas
syringae. Although the organization and mode of expression of phytohormone
genes are different between microorganisms, significant similarities between the
amino acid sequences were reported (Camilleri and Jouanin 1991; Yamada et al.
1985). This indicates that hormonal genes from phytopathogenic bacteria are
genetically conserved, which explains their vital role in virulence.
Crown gall is very important disease. It affects a wide range of
economically important crops, including pome and stone fruit trees, nuts,
brambles, and grapes (Agrios, 1988). It also affects nursery trees, young
plantings and ornamentals. The financial impacts of losses due to crown gall
were estimated to reach $23 million on fruits and nuts alone (Kennedy and
Alcron, 1980). With the increased acreage of fruit and nuts crops during last two
decades, the economic losses are probably much higher than this previous
estimation.
Among the most susceptible crops to Agrobacterium is grape, especially
in a climates with severe cold (Burr, 1988). Crown gall disease in grape is
associated mainly with A. vitis that can exist systemically in healthy grapevines
(Stover et al.. 1997; Burr and Katz, 1983; Lehoczky, 1971). Burr and Katz (1984)
reported that a significant portion of grape nursery stock in the USA is
93
systemically infected with A. vitis. Many techniques are used to eradicate or
control A. vitis, including shoot tip culture (Burr et al., 1988), heat treatment of
dormant cuttings (Ophel et al., 1990) and biological control using nonpathogenic
strains (Burr and Reid, 1993). In spites of all these efforts, A. vitis remains a
major destructive pathogen for grape. One possible approach for protecting
plants against Agrobacterium infection involves the use of antisense RNA
sequences to inhibit gene expression. The basic principle of antisense
technology is that the introduction of an antisense copy of a gene under
constitutive expression or similar transcriptional control as the target gene results
in reducing the expression of that gene.
The use of antisense technology has been successful in protecting plants
against virus infection by RNA viruses (Cuzzo et al., 1988; Hemenway et al.,
1988). Expressing an antisense gene that inhibits ethylene biosynthesis in
transgenic tomato plants prolonged shelf life of the tomato fruit by delaying
ripening (Hamilton et al., 1990; Bird et al., 1991). There are also several reports
on the success of this approach in manipulating biochemical pathways in plants
(Elomaa et al., 1993; Mate et al., 1993; Riesmeier et al., 1994).
The objectives this study were to clone and construct T-DNA auxin
biosynthesis genes in an antisense orientation, transform these constructs into
tobacco and test for tumor formation when transgenic plants are challenged with
wild \ype-Agrobacterium.
94
3.2 Materials and Methods
3.2.2 Construction of chimeric iaaM and iaaH antisense
3.2.2.1 Isolation of/aa/W and iaaH genes
The iaaM and iaaH genes were isolated from the Agrobacterium
tumefaciens pT115955 using polymerase chain reaction (PCR). The Ti plasmid
was isolated and purified as previously described in Section 2.2.4. Using 1 i l of
the plasmid DNA as a template, a PCR reaction was performed in a volume of 50
pi using Taq DNA polymerase (Fisher Scientific, Piano, TX). The oligonucleotide
primers were designed according to the published sequences of the iaaM and
iaaH genes (Baker et al. 1982). The primers flanked the entire coding region for
both genes. For iaaM, the 5' primer was (5'TTCTAACAATGTCAGCTTCA3') and
the 3' primer was (3TGATCTTTAATCAGATACCT5'). For the iaaH, the 5' primer
(5'CTCAGAGAGATGGTGGCCATT3') was used and the 3' primer
(3'AACGGCCAAATGGGTTAATTT5') was used. The reaction conditions were
95°C for 1 min, 50°C for 30 seconds and 72°C for 1 min. This reaction was
repeated for 32 cycles.
3.2.2.2 TA Cloning
One microliter of the amplified PCR product was ligated into pGEM-T
(Promega Corporation, Madison, Wl) using T4 DNA ligase. The pGEM-T vector
has a single deoxy-T-overhang at each 3'end that is complementary to the
95
deoxy-A overhangs created in the PCR product by Taq polymerase, allowing an
efficient ligation. The pGEM-T also has an ampicillin resistance gene for
selection, as well as T7 and SP6 universal primers for sequencing. Two
microliters of the ligation reaction were used to transform competent E. coli strain
DH5a. Cells were then plated on LB plates with 5-bromo-4-chloro-3-indolyl-p-D-
galactoside (X-gal). White colonies were selected for plasmid Isolation, and the
plasmids were digested with Not I to check for the presence of the insert. The
pGEM-T has a recognition site for Not I flanking the insertion site. Plasmids with
inserts that correspond to the expected length of iaaM and iaaH were sequenced
using automated sequencer. The pGEM-T plasmids containing the full-length
coding sequences were designated as pGEMT-/aa/W and pGEMT-/aa/-/
respectively. Plasmid isolation from E. coli was performed by the boiling method
according to Maniatis et al., (1982).
3.2.2.3 Construction of iaaM and iaaH antisense constructs
Antisense iaaM (Pigure 3.1) was made by ligating the Eco Rl iaaM
fragment from pGEM-T-/aa/W into the Eco Rl site of the expression vector pRTL3
to make pRTL3-As-/aa/W. The pRTL3-As-/aa/W plasmid was digested with Sph I
and blunt-ended by the Klenow fragment of E. coli DNA polymerase I. The DNA
fragment was then ligated into the blunt-end Hind III site of the binary vector
pCGN 1578, creating pCGN-AS-/aa/W. The pGEM-T-/aaH plasmid (Figure 3.2)
was cut with Not I and blunt-ended. The purified fragment was then ligated into
96
the blunt-end Xho I site of pRTL-3 to create pRJl-As-iaaH. The expression
cassette was isolated by digesting pRTL-As-/aaH with Hind III and ligating it into
the Hind III site of pCGN 1578 to create pCGN-As-/aaH.
The pRTL3 plasmid is similar to pRTL2 except that it lacks the TEV leader
sequence. The pRTL3 plasmid contains a Cauliflower mosaic virus (CaMV) 35S
promoter with a duplicated enhancer region, a CaMV 35S 3' terminator, and a
polyadenylation signal which cause over-expression of the insert.
3.2.3 Development of Transgenic Tobacco
3.2.3.1 Transformation of Agrobacterium cells
The chimeric antisense gene constructs pCGN-As-/aa/W and pCGN-As-
iaaH were mobilized into A. tumefaciens strain EHA 101 by direct transformation.
Cells were grown overnight in 50ml MG/L medium (Appendix D) containing 50
pg/ml of kanamycin at 30°C in a shaking incubator (250 rpm). One ml of over
night grown EHA cells was inoculated into 50 ml of MG/L media with no
antibiotics and grown for six hours at 30°C. Cells were then collected by
centrifugation for 10 min at 12,000 rpm and resuspended in 2 ml of fresh MG/L
media. One pg of the purified plasmid with chimeric construct was mixed with
200 pi of pelleted cells. The mixture was then frozen immediately in liquid
nitrogen, thawed at 37°C for 5 min, and transferred to 1 ml of MG/L to grow for 2
hours at 30°C in a shaking incubator. The culture was plated onto MG/L plates
97
containing 100 pg/ml of gentamycin and grown at 30°C. Transformant colonies
were grown in MG/L liquid media (supplied with 200 pi of LB) with 100 pg/ml of
gentamycin and 50 pg/ml of kanamycin. Plasmids were recovered using a
modified alkaline lysis method. Two pg/ml lysozyme were added to the
resuspension solution. Plasmids were analyzed by restriction analysis and
Southern blotting.
3.2.3.2 Agrobacfer/tym-mediated tobacco transformation
Tobacco (Nicotiana tabacum cv Xanti) leaf disk inoculation was performed
according to Horsch et al. (1985). Fully expanded, healthy leaves from 3-month-
old tobacco plants were collected, disinfected in 14% chlorox for 5 min. and
washed 5 times with sterile water. A number 7 cork borer was used to make leaf
disk punches 1.5 cm in diameter. The leaf disks were immersed for 5 min in the
Agrobacterium solution that contained the chimeric antisense construct, blotted
on sterile 3M paper and placed upside down on MSA nutrient plates (Appendix
VI) for 2 days to allow infection to occur. They were then transferred to MSB
plates (Appendix VI) containing hormones and antibiotics that promoted growth
of callus and shoot formation. Shoots that were formed from calluses were cut
and transferred to MSC plates (Appendix D) for root formation. Once visible
roots were developed, plantlets were transferred into Magenta boxes with sterile
98
potting soil and slowly acclimated prior to potting in two-gallons containers in the
greenhouse.
3.2.4 Characterization of Transgenic Tobacco Plant
3.2.4.1Tobacco DNA and RNA Extraction
Plant DNA was isolated from expected transgenic tobacco according to
Dellaporta et al. (1983), with one exception, the starting plant tissue was 3 grams
of leaf tissue instead of 0.75 g. Plant DNA was used to amplify the chimeric
antisense gene using PCR. The PCR reaction and conditions were as described
before (Section 3.2.2).
Total RNA was extracted from transgenic and wild-type tobacco plant
using PUREscript (Promega Corporation, Madison, Wl). Leaf discs were
collected from fully expanded leaves of approximately two-months-old tobacco
plants and placed in foil pouches, frozen in liquid nitrogen and stored at-80 °C.
Discs were placed in micro-centrifuge tubes and ground. Once the discs were
powdery, 300 pi of cell lysis solution were added and the discs were ground for
5-10 more strokes. Then 100 pi of protein-DNA precipitation solution were
added, and the tubes were inverted 10 times and placed on ice for 10 min. After
the tubes were spin for 10 min at 4 °C, the supernatant was collected in a new
tube and 400 pi of isopropanol was added and mixed. Total RNA was
precipitated at -20 °C for ten hours. After a 5-min spin at 4 °C, pellets were
99
washed with 400 pi of 70% EtOH. Samples were dried in a Speedvac for 15 min
after the EtOH was discarded. Fifty pi of RNA rehydration solution was added to
the dry pellet. Samples were vortexed, incubated on ice for 30 min and stored at
-80 °C. The total RNA samples were quantified at 260 nm by using a Shimadzu
UV160U spectrophotometer. The total RNA isolated by this method was used for
Northern blots.
Northern blotting and hybridization analysis was done by using 15 )ig of
total RNA electrophotically separated on 1% agarose gels containing 20%
formaldehyde, in a IX MOPS buffer (0.2 M MOPS, 8 mM NaOAc, ImM EDTA,
pH 7.0). The gels containing the RNA were soaked in 75 mM sodium hydroxide
for 30 min, washed in water for 15 min, washed in 20X SSPE (3 M NaCI, 0.2 M
NaH2P04, 20 mM EDTA, pH 8.0) for 40 min and transferred to nitrocellulose
membranes using 20X SSPE as a transfer buffer according to Maniatis at al.
(1982). The nitrocellulose membranes were dried at 82 °C for 3-4 hours in a
vacuum oven and stored in plastic containers. The membranes were
prehybridized for 2 hours at 42 °C in a solution containing 50% (v/v) formamide,
2X Denhardt's solution (IX Denhardt's is 0.02% PVP, 0.02% Picoll, 0.02% BSA),
0.1% SDS and 5x SSPE. Hybridization was carried out in the same buffer
solution plus the denatured ^^P-labeled probe (As-/aa/Wand As-/aaH fragments)
at 40 °C. The membrane was washed with 2X, IX and 0.5X SET (3 M NaCI, 0.4
M Tris pH 7.8 and 20 mM EDTA) for 30 min at 60 °C. X-ray film was exposed to
the dried membrane at -80 °C for 24 hours.
100
3.2.4.2 Reverse transcriptase polymerase chain reaction
In order to quantify the expression of the antisense gene in tobacco,
reverse transcriptase polymerase chain reaction (RT-PCR) was performed. The
total RNA used for RT-PCR was isolated from powder of frozen tobacco leaf
disks using the acid guanidinium thiocyanate method (Chomczynski and Sacchi,
1987).
First-strand cDNA was synthesized from total RNA isolated from
transgenic and wild-type tobacco using Moloney murine leukemia virus reverse
transcriptase and oligo dT (Promega, Madison, Wl) as primer. Using 2 pi of the
first-strand cDNA as template, a PCR reaction was performed in a volume of
50 pi using Taq DNA polymerase. The primers and the PCR reaction were as
previously described (Section 2.2.4) with one exception: the PCR reaction was
extended for 35 cycles. Visualization of the cDNA amplification was performed
by running the PCR product on 1.3 % agarose gel at 40 volts for 3 hours.
3.2.4.3 Evaluation of tobacco plant expressing antisense iaaM
and iaaH genes
At anthesis, fully expanded leaves from transgenic and wild-type tobacco
were harvested from the greenhouse, and washed three times with deionized
water and lightly blotted dry. Leaves were then soaked in 10 % chlorox for 15
101
minutes and transferred to sterile deionized water for 2 min. This step was
repeated three times. Leaves were cut into sections of approximately 1.5 cm^ in
Petri dishes containing 1 ml of wild-type Agrobacterium tumefaciens culture.
Plant pieces were then blotted on autoclaved paper towels and transferred to
one-half strength MS medium plates. After 2 days, plant pieces were transferred
to the same medium containing mefoxin at 500 mg/L. Three weeks later, plant
tissue was phenotypically evaluated for resistance to Agrobacterium
tumefaciens. The resistance was evaluated in terms of tumor size and number
of tumors per tissue surface area. In addition to transgenic tobacco plants
expressing the antisense iaaM and iaaH genes, three other controls were
evaluated, a transgenic tobacco plant expressing glutathione S-transferase gene
(transformed using the same binary vector as As-iaaM and As-iaaH) and two
wild-type tobacco plants, one generated by tissue culture and the other
germinated from seed. Tumor diameter was measured with an electronic caliper.
This experiment was designed as a completely randomized trial with 6 genotypes
and six replications. For comparison between means, least-significant-difference
(LSD) test (P= 0.05) was used. To evaluate the response of the whole plant,
stems of mature transgenic and wild-type tobacco were wounded with a sterile
needle and freshly cultured Agrobacterium strains were applied to the wound.
102
3.3 Results and Discussion
Auxin biosynthesis genes from Agrobacterium tumefaciens ATCC15955
were used to test the effectiveness of antisense technology to block tumor
development. Agrobacterium tumefaciens ATCC^5955 was used because it is
highly virulent, has a wide host range, and its T-DNA has already been
sequenced. A. tumefaciens iaaM and iaaH genes were amplified using PCR.
The bands amplified corresponded to the expected size of the coding sequences
of both genes (Figure 3.3): iaaM is 2.2 kb and iaaH is 1.4 kb. The -- 700 bp band
corresponded to another phytohormone gene called ipt. The iaaM and iaaH PCR
products were cloned into the pGEM-T plasmid. This plasmid was chosen
because of many advantages. It has a single deoxy-T overhang at each 3' end
complementary to the deoxy-A overhangs created in the PCR product by Taq
DNA polymerase. Sequencing using T7 and SP6 as primers showed that the
cloned fragments were identical to the previously published sequences of iaaM
and iaaH (Baker et al. 1983) data not presented. This indicates that PCR is a
reliable technique to directly clone bacterial phytohormone genes.
Both coding sequences were inserted into pRTL3. This plasmid was
developed in Dr. Allen Randy laboratory at Texas Tech University. It was made
to specifically express antisense constructs. The pRTL3 is similar to pRTL2.
Both have the cauliflower mosaic virus (CaMV) 35S promoter, a CaMV 35S 3'
terminator, and a polyadenylation signal that cause overexpression of the
inserted DNA. The pRTL3, however, lacks the TEV leader sequence allowing an
103
efficient antisense effect. The orientation of the inserts were checked first by
restriction mapping followed by sequencing. The antisense constructs were
inserted into the binary vector pCGN 1578. This plasmid contains the left and
right T-DNA border sequences that are necessary for plant transformation.
Using PCR and Southern hybridization, six independent antisense iaaM
and four independents antisense iaaHsNere identified. Southern hybridization
was performed using ^^P-labelled iaaM and /aa/^ fragments as probe. However,
several transgenic plants showed very unusual growth resembling permanent
nitrogen deficiency compare to the control. Those plants were discarded from
this study. Transgenic tobacco plants that expressed the antisense constructs
were identified by Northern blot analyses using ^^P-labelled iaaM and iaaH
fragments as probes. Figure 3.4A and B show that transgenic tobacco plants
accumulated high levels of antisense mRNA compare to the control. To further
evaluate the expression level of both constructs, RT-PCR was used. Figure 3.5
shows the strong expression of the antisense genes from both transgenic plants.
However, the level of antisense iaaH was much higher than antisense iaaM.
Although, the expected bands were amplified from both transgenic plants, a
small-sized band of approximately 350 bp was amplified from antisense iaaH
plants. This is probably due to the primers recognizing an untargeted cDNA
fragment.
Transgenic tobacco plants were evaluated phenotypically by challenging
leaf tissue with wild type A. tumefaciens. No plants showed a complete
104
resistance to the bacteria (Figures 3.6 and 3.7), indicating that the auxin is not
the only virulence factor in tumor development. Resistance was estimated in
terms of frequency of tumor galls formed per 2 cm^ of tissue and the morphology
of the tumor. Table 3.1 shows that the expression of both constructs affected the
frequency and the morphology of the induced tumor. The controls had more
galls per surface area and relatively larger tumors than transgenic plants,
indicating a significant interaction at the level of gene expression. No significant
differences were detected between controls in terms of tumor frequency,
however control II (tobacco plants generated from tissue culture) had smaller
tumor galls than the other controls. This is probably due to a microenvironment
effect rather than an inherited trait. The expression of antisense iaaM reduced
gall size by 46% and gall frequency by 45% and antisense iaaH by 16% and 36%
respectively. However, 60% of samples from antisense iaaH plants formed roots
in response to Agrobacterium infection (Table 3.1), while 16% of antisense iaaM
had roots. These roots can be considered as tumorous tissue, since other
Agrobacterium species induce tumors in the form of roots. Actually,
Agrobacterium tumefaciens induced roots on stems of Kalanchoe
diagremontiana stem (data not shown).
Agrobacterium tumefaciens causes tumors in plants by inducing the
production of high and unbalanced levels of auxin and cytokinin. Two genes of
the T-DNA from A. tumefaciens encode enzymes for auxin biosynthesis: the
iaaM gene which encodes tryptophan monooxygenase and the iaaH gene
105
encodes indoleactamlde hydrolase. In an attempt to block the tumor formation,
the antisense of iaaM and IaaH were expressed In transgenic tobacco plants.
Although the frequency and morphology of tumors were reduced, both transgenic
plants formed tumors after infection. This indicates that the unbalanced ratio
between auxin and cytokinin still exist at least in the antisense iaaM plants. This
means that auxin biosynthesis was not completely inhibited. Other genes on the
T-DNA may complement the suppression of the iaaM or iaaH genes. Gene5 and
6b have been implicated in auxin and cytokinin regulation (Winans, 1992).
Tinland et al. (1990) reported that gene 6b has an auxin-like effect on plants,
while geneS modulates auxin responses in plants by autoregulating the synthesis
of an auxin antagonist, indole-3-lactate (Korber et al., 1991). The behavior of
gened is not yet known when auxin biosynthesis is inhibited. All of these findings
suggest that there are other factors involved in auxin regulation besides iaaM
and iaaH. It will be interesting to clone the entire T-DNA in the antisense
orientation, expressing it into plants and evaluate them for resistance. This will
eliminate the problem of complementation between various genes. The fact that
antisense iaaH expressing plants formed roots when infected with A. tumefaciens
indicates that the antisense construct had the opposite effect, since roots are
Induced when the ratio of auxin to cytokinin is high. The antisense iaaH plants
probably blocked the conversion of lAM to IAA, which led to an accumulation of
lAM in plant tissue. Although lAM has been shown to be an inactive compound
in plants (Klee et al. 1987), plant cells may converts it into IAA. The ability of
106
plant cells to hydrolyze lAM has been reported (Klee et al., 1987). These studies
in combination with our observations show that manipulating the iaaH gene to
acquire resistance to Agrobacterium may not be efficient. However, the first step
in auxin biosynthesis seems promising, assuming that all T-DNA genes are well
characterized.
107
3.4 References
Agrios, G. 1988. Plant Pathology. 3ed edition. Academic Press. New Yorlc. pp.558-564.
Baker, R.F., Idler, K.B., Thompson, D.V., Kemp, J.D. 1983. Nucleotide sequence of the T region from the Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2:335-350.
Bird, C.R., Ray. J.A., Fletcher, J.D. 1991. Using antisense RNA to study gene function inhibition on cartenoid biosynthesis in transgenic tomatoes.Bio/Tech. 9:635-639.
Burr, T. J., and Reid, C. L., 1993. Biological control of grape crown gall with nontumorigenic Agrobacter/ty/77 vitis strain F2/5. Am. J. Enol. and Vitic 45:213-219.
Burr, T. J., Katz, B. H, Bishop, A. L., Meyers, C.A. and Mittak. 1988b. Effects of shoot age and tip culture propagation of grapes on systemic infestations by Agrobacterium tumefaciens Biovar 3. Am.J.Enol.Vitic. 39:67-70.
Burr, T. 1988a. Crown gall. In: Compendium of Grape Diseases, R.C. Pearson and A. C. Goheen (Eds.), pp. 41-42. APS Press, St. Paul, MN.
Burr, T.J., and Katz, B. H. 1984. Grapevine cuttings as potential sites of survival and means of dissemination of Agrobacterium tumefaciens. Plant Dis. 68976-978.
Burr, T. J. and Katz, B. H. 1983. Isolation of Agrobacterium tumefaciens biovar from grapevine galls and sap and from vineyard soil. Phytopathology. 73:163-165.
Camilleri C, Jouanin, L. 1991. The TR-DNA region carrying the auxin synthesis genes of A.rhizogenes agropine type plasmid pRiA4: nucleotide sequence analysis and introduction into tobacco plants. Mol Plant Microb Interact 4:155-162.
Chomczynski, P., and Sacchi, N. 1987. Single step method of RNA extraction by Acid Guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159
Cuzzo, M., O'Connel, K.M., Kaniewski, W., Pang, R.X., Chua, N.H., Tumer, N.E. 1988. Viral protection in transgenic tobacco plants expressing the
108
cucumber mosaic virus coat protein or its antisense RNA. Bio/Tech. 6:549 557.
DeCleene, M., and DeLey J. 1976. The host range of crown gall. Bot. Rev. 42:389-466.
Dellaporta, S.L., Wood, J.,and Hicks, J.B. 1988. A plant DNA minipreparation: Version II. Plant Mol. Biol. Reporter 1:19-21.
Elomaa, P., Honkanen, J., Puska, R. 1993. Agrobacter/t/m-mediated transfer of antisense chalcone synthase cDNA to Gerbera hybrida inhibits flower pigmentation. Bio?Tech. 11:508-511.
Hamilton, A.J., Kycett, G.W., and Grierson, D. 1990. Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346:284 287.
Hemenway , C. Fang, R.X., Kaniewski, K.W., Chua, N.H., Tumer, N.E. 1988. Analysis of the mechanism of protection in transgenic plants expressing the potato virus X coat protein or its antisense RNA. EMBO J. 7:1273 1280.
Horsch, R.B., Fry, J.E., Hofman, N.J., Eicholtz, D., Rogers, S.C, Praley, R.T. 1985. A simple and general method for transferring genes into plants. Science 227-119-123.
Kennedy, B. and Alcron, S. 1980. Estimates of U.S. crop looses to prokaryotic plant pathogens. PI. Disease 64:674-676.
Klee, H.,J., Horsh, R.B., Hinchee, M.A., Hein, M.B., and Hoffmann, N.,L. 1987. The effect of overproduction of two Agrobacterium tumefaciens T-DNA auxin biosynthesis gene products in transgenic petunia plants. Genes Dev. 1:86-96.
Korber, H., strizhov, N., Staiger, D. and Koncz, C. 1991. T-DNA gene 5 of Agrobacterium modulates auxin response by autoragulated syntheis of a growth hormone antagonist in plants. EMBO J. 10:3983-3991.
Lehoczky, J. 1971. Further evidence concerning the systemic spreading of Agrobacterium tumefaciens in the vascular system of grapevines, vitis 10:215-221.
109
Maniatis, T., Fritsch, E.F., and Sambrook, J. 1982. Molecular cloning: A laboratory manual. Cold Spring Harbor, NY. Cold Spring Harbor Laboratory.
Mate, C.J., Hudson, G.S., Von Caemmerer, S., Evans, J.R., Andrews, T.J. 1993. Reduction of ribulose bisphosphate carboxylase activase levels in tobacco (Nicotiana tabacum) by antisense RNA reduces ribulose bisphosphate carboxylase carbamylation and impairs photosynthesis. PI. Physiol. 102:1119-1128.
Ophel, K., Nicholas, P.R., Magarey, P.A., and Bass, A.W. 1990. Hot water treatment of dormant grape cuttings reduces crown gall incidence in a field nursery. Am.J. Enol. Vitic, 41: 325-329.
Riesmeier, J.W., Willmitzer, L., Frommer, W.B. 1994. Evidence for an essential role of the sucrose transporter in phloem loading and assimilate partioning. EMBO J. 13:1-7.
Strover, E. W., Swatz, H., J., and Burr, T., J. 1997. Agrobacterium wY/s-lnduced electrolyte leakage in crown gall susceptible and resistant grape gentoypes. Am.J. Enol. Vitic, 2: 145-149.
Tinland, B., Rohfritsch, O., Michler, P., and Otten, L. ^990.Agrobacterium tumefaciens T-DNA gene 6b stimulate rol-induced root formation, permits growth at high auxin concentration and increase root size. Mol. Gen. Gent. 223:1-10
Winans, S.C. 1992. Two-way chemical signaling in Agrobacterium-plant interactions. Microbiol. Rev. 56:12-31.
Yamada T., Plam C.J., Brooks B., Kosuge T. 1985. Nucleotide sequences of the Pseudomonas savastoni indolacetic acid gene show homology with Agrobacterium tumefaciens T-DHA. Proc Natl. Acad. Sci. USA 82:6522 6526.
110
Table 3.1. Tumor size, number, and frequency of tumor formation in transgenic and wild type tobacco plants after infection by Agrobacterium tumefaciens.
Tumor Sample Size (cm) number
% rooting
Control 1
Control Ii
Control III
Antisense iaaM
Antisense iaaH
0.44±0.16a
0.34±0.12bc
0.41±0.15ab
0.2±0.10d
0.31±0.12c
10±4.4a
11±5.0a
12±2.7a
6±3.0b
7±4.0b
0
11
0
16
60
Values with the same letters are not significantly different at 0.05 probability level
111
Table 3.2. Reduction in tumor size and number due to the expression of the antisense iaaM and iaaH genes in tobacco plants
% reduction in tumor Sample Size (cm) number
Antisense 46 45 iaaM
Antisense 16 36 iaaH
112
PCR
J_ iaaM
Ligate
T IaaM
I pGEM-T-iaaM I
I pGEM-T I
EcoRI
Digest with EcoRi
EcoRI
EcoRI Promoter _ L ^ Term
Promoter I pRTL3 j V y Digest with EcoRI
pRTL3-AS-iaaM
Digest with SphI Blunt
P~H wgg/ iTT
Hindill
Ligate
me!
Promotei^r " ^ ^ Term
Digest with Mindiil Blunt
Fig. 3.1. Strategy for the development of the antisense iaaM construct
113
PCR
i IaaH
Ligate
T IaaH
NotI ^ ^ ^ ^ ^ ^ N o t l
f\ I pGEM-T-iaaH I
I pGEM-T I
Digest with NotI Blunt
Xho! P r o m o t e r i ^ ^ P e r m
I pRTL3
i HBB!
Digest with Xhol Blunt
Promoter
Hindill
pRTL3-AS-iaaH
Digest with Hindill
I P L^JdrnZDnZ
Hindill
Ligate
Heei
Promoter^^ " ' ^ T e r m
Digest with Hindill Blunt
Fig. 3.2. strategy for the development of the antisense iaaH construct
114
RTH M
Fig. 3.3. PCR amplification of phytohormone genes from the Ti plasmid of Agrobacterium tumefaciens. Lanes: R: X DNA Eco Rl/ Hind II marker, size on kb; T: amplification of the ipt gene; H: amplification of iaaH gene and M: amplification of iaaM gene.
115
MC
Fig. 3.4. Total RNA and Northern blot analysis of iaaM and IaaH antisense in tobacco. AM: The total RNA from tobacco expressing antisense iaaM; AC: The Total RNA from wild-type tobacco; AH: The Total RNA from tobacco expressing antisense IaaH. BM: antisense /aa/W transcripts hybridize with ^^P-labelle /aa/W gene and BH: antisense /aa/^ transcripts hybridize with ^^P-labelled iaaH gene
116
Fig. 3.5. RT-PCR analysis of iaaM and iaaH antisense transcripts. Lane: R: 1 kb DNA ladder; M: amplification of/aa/W cDNA; H: amplification of iaaH cDNA.
117
Fig. 3.6. Tumor morphology induced by Agrobacterium tumefaciens on tobacco leaf tissue, a; wild-type Xanthi grown from seed; b; wild type Xanthi generated from tissue culture and c; transgenic tobacco expressing glutathione S-transferase gene.
118
Fig. 3.7. Tumor morphology induced by Agrobacterium tumefaciens on trangenic tobacco leaf tissue, a; transgenic tobacco expressing iaaM antisense and b; transgenic tobacco expressing iaaH antisense.
119
CHAPTER IV
CONCLUSIONS
The main objectives of this study were first to characterize the local
isolates of Agrobacterium vitis and test the possibility of using antisense
technology to induce resistance to Agrobatreium infection in transgenic plants. A
vitis is a pathogen, well associated with crown gall disease in grape. The
destruction of several vineyards around Lubbock,TX, was due to high infestation
of Agrobacterium vitis.
Significant variation was obsen/ed at the level of the biochemical tests.
However, local isolates had a narrow host range and most of them had an
octopine-cucumopine Ti plasmid. The T-DNA region containing phytohormone
genes was well conserved among the isolates. This indicates that the local
population of A. vitis is probably of a clonal origin. Since, A. vitis can survive
systemically in healthy grapevine, the introduction of A. vitis into Lubbock area
was probably via plant material from other parts of the country. This indicates
that introduced material from other grape growing areas should be indexed
before planting. This study also showed that the level of infestation varied
between grape cultivars and that the systemic behavior of A. vitis can be
influenced by both the host and the environment.
Tobacco was used as a model to test whether transgenic plants with T-
DNA auxin biosynthetic genes in an antisense orientation would block tumor
120
morphology. The expression of iaaM antisense RNA resulted in an
approximately 46% reduction in the number of tumors. The iaaM anfisense also
affected tumor morphology by reducing tumor size. Plants expressing iaaH
antisense had fewer tumors than the control, but more than 60% of samples
formed roots when infected with Agrobacterium. The incomplete suppression of
tumor formafion may be due to the presense of other loci on the T-DNA that are
also involved in auxin biosynthesis. Although a complete inhibifion of
tumorigenesis was not achieved, the fact that both tumor frequency and
morphology changed, indicate that further manipulation of phytohormone genes
using antisense technology may result in complete resistance to Agrobacterium
tumefaciens species in transgenic plants. It will be interesting to test if the
expression of the entire T-DNA in anfisense orientation will result in a complete
resistance, since gene complementaion will not occur.
121
APPENDIX A
SELCTIVE MEDIA FOR AGROBACTRIUM BIOTYPING
I.D-1 media Per liter
Mannitol 15.0g NaNOs 5.0g LiCI 6.0g Ca(N03)2.4H20 0.002g K2HPO4 2.0g MgS04.7 H2O 0.2g Bromthymol blue O.lg Agar 15.0g The pH is adjusted to 7.2 after autoclaving and should apper dark blue
II.Medium 1A
L(-) arabitol 3.04g NH4NO3 0.16g K2HPO4 1.04g KH2PO4 0.54g Sodium taurochlate 0.29g MgS04.7 H2O 0.25g Agar 15g Crystal violet, 0.1% (w/v) aqueous 2ml Autocleave, cool to about 50 C, then add filter-sterilized cycloheximide: 1.0 ml of 2% solution and Na2Se03: 6.6 ml of 1% solution.
III. Medium 2E
Erythritol 3.05g NH4NO3 0.16g KH2PO4 0.54g K2HPO4 1.04g Yeast extract, 1 % (w/v) aqueous 1 ml Sodium taurochlate 0.29g MgS04.7 H2O 0.25g Agar 15g Malchite green, 0.1% (w/v) aqueous 5ml
122
Autocleave, cool to about 50 C, then add filter-sterilized cycloheximide: 1.0 ml of 2% solution and Na2Se03 : 6.6 ml of 1% solufion.
IV. Rov-Sasser medium
Adonitol NH4NO3 KH2PO4 K2HPO4 Yeast extract, 1 % (w/v) aqueous MgS04.7 H2O Nad H3B03 Agar Chlorothalonil (Bravo 500), 4% (w/v)
4.0g 0.16g 0.7g 0.9g 0.14g 0.2g 0.2g I.Og 15.0g 0.5 ml
Adjust to pH 7.2 before adding agar, autoclave, cool to 50 C and add aseptically after dissolving seoparately in 3 ml of distilled water and after sterilizing: Triphenyltertrazolium chloride 80mg D-cycloserine 20mg Trimethoprim (add 1 drop HCI) 20mg
123
APPEMDIX B
BIOCHEMICAL TESTS
3-Ketolactose test
Inoculate bacterial strains over 1.0 cm-diameter spot on media containing 1% a-lactose, 0.1 yeast extract, and 2% agar. Incubate the plate at 27 C for 2 days. Then flood the agar surface with a shallow layer of Benedict's reagent and place at room temperature. In approximately 1 hour, a yellow ring of Cu20 will form around the cell if 3-Ketolactose is present. Benedict's reagent: 173 g of sodium citrate and lOOg of anhydrous sodium carbonate is disolved in 600 ml of disfilled water with heating. Dissolve 17.3 g of curpric sulfate in 150 ml disfilled water. Slowly add the curpic sulfate solution into a large beaker containing the sodium citrate carbonate solution, while stirring constantly. Dilute to 1 liter.
Growth in ferric ammonium citrate broth
A liter solufion contains (Ferric ammonium citrate lOg, MgS04.7H20 0.5g, K2HP04 0.5g and Cacl2 0.2g). Adjust to pH 7.0 then autoclave. Inoculate the culture tubes and incubate in a stafionary posifion. Biovar 1 strain will produce a reddish brown pellicle at the surface of the medium.
Acid production from Eryhtritol. Melezitose and Sucrose
A liter of basal medium contains (MgS04.7H20 0.2g, K2HP04 1 .Og ,KCI 0.2g, yeast extract I.Og Bromthymol blue, 1% (w/v) in 50% ethanol 3.0 ml) Adjust the pH to 7.1 with 1M NaOH then add 1.5g Agar and autoclave. Add one part of filter-sterilized 10% (w/v) Eryhtritol, Melezitose or Sucrose solufion to 9 parts steril and cooled basal media, then dispense asepfically about 4 ml of medium to sterile tubes. The production of a yellow color in the medium indicates production of acid from oxidafion of Eryhtritol, Melezitose and Sucrose.
Growth in 2% Nad
Inoculate NYB plates containing 2% (w/v) Nad and check for growth
124
Citrate utilization
A liter of basal medium conatins ( NaCI S.Og, MgS04.7H20 0.2g, K2HP04 1.0g, NH4H2P04 1.0g, sodium citrate 2.0g, bromthymol blue, 1% (w/v) in 50% ethanol 15 ml) adjust to pH 6.8 and add 20g of Agar. Dispense the medium in test-tubes, autoclave at 121 C for 15 minutes and slant the tubes to cool. After 24-48 hours, the inoculated medium turns to a deep Prussian blue if citrate has been utilized.
Alkali production from malonic acid
A liter of medium conatins (NaCI 2.0g, K2HP04 1.0g, KH2P04 0.4g, (NH4)2S04 2.0g, yeast extract O.lg, malonic acid, sodium salt 3.0g, bromthymol blue, 1%. Adjust to pH 7.0, dispense 3-4 ml of medium in test tube before autoclaving. Inoculate the medium and incubate at 27 C. the media will turn blue when alkali is produced.
Alkali production from mucic acid, propionic acid and L-tartaric acid
A liter of medium conatins (NaNH4P04 0.5 g, K2HP04 I.Og, KH2P04 0.4g, KCI 0.2g, bromthymol blue, 1%. Adjust to pH 7.0, dispense 3-4 ml of medium in test tube before autoclaving. Then aseptically add 0.5 ml of filter sterilized 1% solution of either L-tartaric acid, mucic acid, or propionic acid previously neutralized with NaoH. After inoculation, incubate at 27 C for about two weeks. The medium will turn blue when alkali is produced.
Opine utilization
A liter of basal medium contains (K2HP04 7.2.0g, KH2P04 2.8g, MgS04.7H20 0.2g, Cad2.2H20 11mg, FeS04 5mg, MnCI2.4H20 2mg) Adjust to pH 7.2 and add 5g of gelrite and autocleave. Then aseptically add 5Mm of the filter sterilized opine tested.
125
APPENDIX C
LIST OF CROWN GALL SAMPLES, HOST AND LOCATION
T a b l e d . Collected galls
Crown gall Culfivars Vinyard
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Unknown Unknown Unknown Unknown Merlot Merlot Shardonnay Shardonnay Sauvignian Blanc Shardonnay Shardonnay Shardonnay Sauvignian Blanc Sauvignian Blanc CBSV Shardonnay Shardonnay Shardonnay Sauvignian Blanc Sauvignian Blanc Shardonnay Unknown Unknown
Pheasant Ridge Pheasant Ridge Pheasant Ridge Pheasant Ridge Bill Brown Bill Brown Bill Brown Bill Brown Morris Morris Morris Morris Morris Morris Bobby young Bobby young Bobby young Bobby young Brownfield Brownfield Brownfield Lubbock Lubbock
126
APPENDIX D
TRANSFORMATION AND TISSUE CULTURE MEDIA
MG/L medium
To 800 ml of deionized water, add: 0.5g Mannitol; I.Og L-glutamic acid or 1.15gsodium glutamate; 5.0 tryptophane; 2.5g yeast extract; 0.25g KH2P04; O.lg NaCI; O.lg MgS04.7H20. Mix well and adjust the pH to 7.0 with 1 M NaoH. Adjust the volume to 1L. Add 2.0g Phytagel. Autoclave.
MSA Plates for inoculafion
To 800 ml of deionized water, add 1 bag of Murashige and Skoog BasalSalt, 30g sucrose, 1ml 1000X vitamins B-5, 10 ul ng/ml NAA, 200 ul 5mg/ml BA. Mix well, adjust pH to 7.0. Adjust volume to 1 L. Add 2.0 g phytagel. Autoclave. Pour into 10x200 fissue culture plates.
MSB Plates for shoot and callus formafion
Same a MSA except for the addifion of antibiotics as follows: 50 ug/ml Kanamycin 300 ug/ml Cefotaxime 300 ug/ml Carbenicillin
MSC Plates for root formation
Same as MSB except that no NAA or BA hormones were added. The concentrations of the antibiotics is the same.
127