Post on 11-Feb-2017
1
An L-fucose operon of probiotic Lactobacillus rhamnosus GG involved in 1
adaptation to gastrointestinal conditions 2
3
4
Jimmy E. Becerra, María J. Yebra and Vicente Monedero* 5
6
Laboratory of Lactic Acid Bacteria and Probiotics, Biotechnology Department, Institute of 7
Agrochemistry and Food Technology (IATA-CSIC), Paterna, Valencia, Spain 8
9
10
11
*Corresponding author. 12
E-mail: btcmon@iata.csic.es 13
Tlf: +34 963900022 14
Fax: +34 963636301 15
16
Running title: L-fucose utilization in L. rhamnosus GG 17
18
AEM Accepted Manuscript Posted Online 27 March 2015Appl. Environ. Microbiol. doi:10.1128/AEM.00260-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
2
ABSTRACT 19
L-fucose is a sugar present in human secretions as part of human milk oligosaccharides, 20
mucins and other glycoconjugates in the intestinal epithelium. The genome of the 21
probiotic Lactobacillus rhamnosus GG (LGG) carries a gene cluster encoding a putative 22
L-fucose permease (fucP), L-fucose catabolic pathway (fucI, fucK, fucU and fucA), and a 23
transcriptional regulator (fucR). The metabolism of L-fucose in LGG results in 1,2-24
propanediol production and their fucI and fucP mutants displayed a severe and mild 25
growth defect on L-fucose, respectively. Transcriptional analysis revealed that the fuc 26
genes are induced by L-fucose and subject to a strong carbon catabolite repression 27
effect. This induction was triggered by FucR, which acted as a transcriptional activator 28
necessary for growth on L-fucose. LGG utilized fucosyl-α1,3-N-acetylglucosamine and 29
contrarily to other lactobacilli, the presence of fuc genes allowed this strain to use the L-30
fucose moiety. In fucI and fucR mutants, but not in fucP mutant, L-fucose was not 31
metabolized and it was excreted to the medium during growth on fucosyl-α1,3-N-32
acetylglucosamine. The fuc genes were induced by this fucosyl-disaccharide in the wild-33
type and fucP mutant but not in a fucI mutant, evidencing that FucP does not participate 34
in the regulation of fuc genes and that L-fucose metabolism is needed for FucR 35
activation. The L-fucose operon characterized here constitutes a new example of the 36
many factors found in LGG that allow this strain to adapt to the gastrointestinal 37
conditions. 38
39
40
Keywords: Lactobacillus rhamnosus GG, intestinal microbiota, L-fucose, α-L-41
fucosidases, glycoconjugates 42
43
44
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
3
INTRODUCTION 45
46
L-fucose (6-deoxy-L-galactose) is one of the few hexoses with L configuration found in 47
nature. It forms part of many glycans present at the surface of eukaryotic cells such as H 48
and Lewis antigens, which are present not only in blood cells but also in epithelial cells at 49
different mucosal sites (1). It is also present at the highly glycosylated mucin proteins of 50
the intestinal mucosa and in a high proportion of the oligosaccharides present in human 51
milk (2, 3). These facts make L-fucose an important sugar in the microbial ecology of the 52
gastrointestinal tract. The importance of the fucosylation of mucosal glycoconjugates on 53
the intestinal ecology is reflected by the fact that the intestinal microbiota composition is 54
dependent on the secretor status of the individuals, which is defined by mutations in the 55
FUT2 gene coding for an α(1,2) fucosyltransferase that participates in the fucosylation of 56
mucosal glycans (4, 5). Owing to its elevated concentration found in the intestinal niche, 57
L-fucose can be used as a carbon source and its utilization has been identified as a key 58
factor for intestinal colonization in some bacteria. Thus, the pathogen Campylobacter 59
jejuni, primarily thought to be an asaccharolytic microorganism, was able to use L-fucose 60
and this provides it with a competitive advantage, as determined in a neonatal piglet 61
infection model (6). Also, a ΔfucAO mutant of the probiotic E. coli Nissle 1917 strain, 62
unable to use L-fucose, showed two orders of magnitude lower colonization level in 63
mouse intestine compared to the wild-type (7). 64
L-fucose metabolism has been extensively characterized in Escherichia coli (8-10). In 65
this bacterium L-fucose is transported by a permease and catabolized to fuculose-1-66
phosphate that is finally split into dihydroxyacetone-phosphate and L-lactaldehyde by a 67
specific aldolase. L-lactaldehyde can be further metabolized to 1,2-propanediol or lactate 68
and the dihydroxyacetone-phosphate enters glycolysis (10). A similar pathway has been 69
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
4
described in Bacteroides (11). However, C. jejuni or intestinal commensals like 70
Bifidobacterium rely on a different route for its catabolism, which involves L-fucose 71
dehydrogenase and L-fuconolactonase, although the corresponding genes and enzymes 72
have not been fully characterized (6). 73
L-fucose does not only serve as a carbon and energy source, but in some bacteria it acts 74
as a signaling molecule. In enterohaemorrhagic E. coli the two-component system 75
FusKR senses extracellular L-fucose and activates virulence and metabolic genes (12). 76
Streptococcus pneumoniae strains, although having all the genes which encode a 77
complete L-fucose pathway are not able to use it. The S. pneumoniae fuc genes are 78
clustered with genes encoding extracellular glycosidases that release fucosyl-79
oligosaccharides from Lewisy and type A and B histo-blood group antigens from the host 80
cell surface. These fucosyl-oligosaccharides are taken up by specific transporters 81
encoded in the same operon. The S. pneumoniae fuc genes are needed for virulence 82
and are induced by L-fucose but this sugar is not further metabolized (13). 83
Lactobacillus rhamnosus GG (LGG) is a bacterium marketed as probiotic (14). It was 84
derived from the intestinal habitat of a healthy human and its health benefits as probiotic 85
have been widely documented (14, 15). Genetic and biochemical studies have revealed 86
that LGG possesses many mechanisms of survival and persistence at the 87
gastrointestinal tract (16), which include bile salt resistance (17), proteic factors for 88
mucosal attachment (e.g. mucus binding pili (18)), glycosidases, sugar transporters and 89
catabolic enzymes needed to exploit the carbohydrate resources characteristic of the 90
intestinal habitat (19). LGG is able to use L-fucose as a carbon source and putative L-91
fucose utilization genes are annotated in its genome, but their functionality has never 92
been proved, and no data on L-fucose utilization by intestinal lactobacilli are available. In 93
this work the involvement of LGG fuc genes in L-fucose utilization has been established, 94
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
5
revealing a new trait that may be important in the persistence and colonization of the 95
intestinal habitat by LGG. 96
97
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
6
MATERIAL AND METHODS 98
99
Strains and growth conditions 100
Lactobacillus strains (Table 1) were grown in MRS medium (Difco) or in basal MRS 101
medium (10 g/liter Bacto peptone (Difco), 4 g/liter yeast extract (Pronadisa), 5 g/liter 102
sodium acetate, 2 g/liter triammonium citrate, 0.2 g/liter magnesium sulfate 7-hydrate, 103
0.05 g/liter manganese sulfate monohydrate, and 1 ml/liter Tween 80) supplemented with 104
0.5% L-fucose (30 mM) or 4 mM fucosyl-α1,3-N-acetylglucosamine (Fuc-α1,3-GlcNAc, 105
Carbosynth Ltd, Compton, Berkshire, UK) at 37ºC under static conditions. Bacterial 106
growth was determined in microtitre plates in a Polarstar Omega plate reader at 37ºC. 107
Each well (100 µl medium) was inoculated with bacteria grown in basal MRS without 108
sugars at an initial OD550nm of 0.1. The maximum growth rate (μ) was calculated by 109
following the OD550nm versus time. Three independent biological replicates for each 110
growth curve were obtained. Anaerobic and aerobic growth of LGG was carried out in 10 111
ml of basal MRS supplemented with 20 mM L-fucose or 20 mM glucose in anaerobic jars 112
(AnaeroGen, Oxoid) or in 50 ml Erlenmeyer flasks shaken at 200 rpm, respectively. The 113
medium was inoculated at an initial OD550nm of 0.1 and incubated at 37ºC for 24 h. E. coli 114
DH10B was used as cloning host and it was grown in LB at 37ºC under shaking at 200 115
rpm. Antibiotics used for plasmid selection were ampicillin at 100 μg/ml and 116
chloramphenicol at 20 μg/ml for E. coli and erythromycin at 5 μg/ml for LGG. 117
118
Construction of L. rhamnosus GG mutants in fuc genes 119
LGG mutants in fucP (LGG_02683) and fucI (LGG_02685) were constructed by replacing 120
the wild-type genes with mutated variants. The LGG chromosomal DNA was isolated 121
from 10 ml cultures with the DNA Isolation Kit for Cells and Tissues (Roche). The fucP 122
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
7
gene was amplified by PCR with Pfx DNA polymerase (Invitrogene) and the 123
oligonucleotide pair FucP1 (5’-GCCTTGCGATGGTCTATAG)/FucP2 (5’-124
GCTTCTTCTCAGTTGATCAAC) using the isolated chromosomal DNA as template. The 125
resulting 2187-bp fragment was digested with AclI and the 634- and 590-bp fragments 126
corresponding to 5’ and 3’ portions of fucP, respectively, were gel-isolated. These 127
fragments were ligated together with EcoRV-digested pRV300 (20), creating an 128
integrative plasmid carrying a fucP gene with an internal 963-bp in-frame deletion 129
(pRΔFucP). The fucI gene was amplified by PCR with oligonucleotides FucI1 (5’-130
ATTGGCGCGTTGAATGAAAG) and FucI2 (5’-ATAAGATCCGGCTGGTTTCC) and the 131
obtained fragment was digested with PstI. The generated 997-bp fragment was gel 132
isolated and ligated to pRV300 digested with EcoRV/PstI. The obtained plasmid was 133
digested with EcoRI, treated with Klenow and ligated, creating thus a frameshift in fucI as 134
was verified by sequencing (pRFucI plasmid). The plasmids containing the mutated fucP 135
and fucI genes were transformed by electroporation in LGG with a GenePulser apparatus 136
(Biorad) as previously described (21). Integrants obtained by single cross-over 137
recombination were selected on MRS agar plates containing erythromycin. Clones were 138
grown for about 200 generations in antibiotic-free MRS medium and plated on MRS. 139
Colonies that had undergone a second recombination event leading to an erythromycin-140
sensitive phenotype were selected by replica-plating and tested by PCR with 141
appropriated oligonucleotides for the replacement of the wild type genes by the mutated 142
copy. After confirmation of the mutations by sequencing, two clones were selected and 143
named BL394 (ΔfucP) and BL395 (fucI). 144
A 437-bp internal fragment of the fucR gene (LGG_02680) was amplified with 145
oligonucleotides FucR1 (5´-GGCGTGGCTTTGGATATG) and FucR2 (5´-146
CATCATCGCTCGCTTGAC) and cloned into pRV300 digested with EcoRV. The 147
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8
resulting plasmid (pRFucR) was used to transform L. rhamnosus GG selecting for 148
erythromycin resistance. One strain with disrupted fucR was selected and named BL396. 149
150
RT-qPCR analysis of fuc genes expression 151
L. rhamnosus strains were grown in MRS basal medium containing 0.5% glucose, 0.5% 152
L-fucose or 0.5% L-fucose plus 0.2% glucose to an OD550nm of 0.9-1. Bacterial cells from 153
9 ml cultures were recovered by centrifugation and washed with 9 ml of EDTA 50 mM pH 154
8. The cell pellets were resuspended in 1 ml or TRIzol reagent (Gibco) and one gram of 155
glass beads (0.1 mm diameter) were added. The bacteria were broken with a Mini 156
BeadBeater apparatus (Biospec Products, Bartlesville, OK) and total RNA was isolated 157
following the recommendations of the manufacturer of TRIzol. For experiments with Fuc-158
α1,3-GlcNAc, RNA was isolated from 1 ml cultures containing 4 mM sugar. One hundred 159
nanograms of RNA were digested with DNase I (RNase free, Fermentas), and cDNA was 160
obtained from 50 ng of DNase-treated RNA using the Maxima First Strand cDNA 161
synthesis kit (Fermentas). qPCR was performed in a LightCycler 480 II system (Roche) 162
with the LightCycler FastStart DNA Master SYBR Green I mix (Roche). Primers were 163
designed by using the Primer-BLAST service at the NCBI 164
(http://www.ncbi.nlm.nih.gov/tools/primer-blast) in order to generate amplicons ranging 165
from 70 to 100 bp in size. qPCR was performed for each cDNA sample with the primers 166
pairs 5´-TGGCTAAGCATGGGTTCCTG/5’-TCGCCATTGATCGTCTCTCG (fucI), 5´-167
CCGGAGAGCCAGTCAAAGTT/5’-CTCAACAGGCCCAGCTACAA (fucK), 5´-168
TTTGTCGGCTGACACGATGA/5’-GCCGGCGCTAATTCAGAAAG (fucP), 5´-169
GAGCAGATGGCCTGACAGTT/5’-ACTGGCGGTTCACCATTAGG (fucU), 5´-170
GAAGTTGCTGGTGCAAAGGG/5’-TCATCCGGGTATTCGCTGTG (fucA), and 5´-171
TCAGTTGTGCAGTGAGCAGT/5’-TTCAACGCCTGCATCTGCTA (fucR). The reaction 172
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
9
mixture (10 μl) contained 5 μl of 2X qPCR master mix, 0.5 μl of each primer (10 μM), and 173
1 μl of a 10-fold dilution of the cDNA synthesis reaction. Reaction mixtures without a 174
template were run as controls. The cycling conditions were as follows: 95°C for 10 min, 175
followed by 45 cycles of three steps consisting of denaturation at 95°C for 10 s, primer 176
annealing at 60°C for 20 s, and primer extension at 72°C for 20 s. For each set of 177
primers, the cycle threshold (crossing point [CP]) values were determined by the 178
automated method implemented in the LightCycler software (version 4.0; Roche). The 179
relative expressions were calculated using the software tool REST (relative expression 180
software tool) (22) and three LGG reference genes (pyrG (LGG_02546), recG 181
(LGG_01660) and leuS (LGG_00848)) were used simultaneously for the analysis. 182
Linearity and amplification efficiency were determined for each primer pair and every RT-183
qPCR reaction was performed at least in triplicate with two biologically independent 184
samples. 185
186
Sugar and metabolite analysis 187
The concentration of L-fucose and Fuc-α1,3-GlcNAc in the supernatants was determined 188
by high-pH anion-exchange chromatography with pulsed amperometric detection in an 189
ICS3000 chromatographic system (Dionex) using a CarboPac PA100 column (Dionex). A 190
combined gradient of 100 to 300 mM NaOH and 0 to 150 mM acetic acid was used for 20 191
min at a flow rate of 1 ml/min. 1,2-propanediol and lactic acid were determined by HPLC 192
with a Jasco PU-2080Plus system coupled to refractive index (Jasco RI-2031Plus) or UV 193
(210 nm) detectors with Rezex RCM-Monosaccharide and Rezex ROA-Organic Acid 194
columns, respectively. Flow rates were 0.6 ml/min and 0.5 ml/min in water or 5 mM 195
H2SO4, respectively. 196
197
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
10
Sequence analysis 198
The sequences of the LGG fuc genes were retrieved from the GenBank database (acc. 199
No FM179322.1) and homology searches were performed with BLAST at the National 200
Center for Biotechnology Information (NCBI; 201
http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi). Genomic context analysis was 202
performed on genomes deposited at the Microbial Genome Database for Comparative 203
Analysis (http://mbgd.genome.ad.jp/) (23). Transcriptional terminators in the fuc gene 204
cluster were searched with ARNold (http://rna.igmors.u-psud.fr/toolbox/arnold/). 205
206
Statistical analysis 207
Statistical analysis was performed using GraphPad Software (San Diego, CA). Student’s 208
t-test was used to detect statistically significant differences between growth rates from 209
the wild type strain and the mutant strains. Statistical significance was accepted at P < 210
0.05. 211
212
213
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
11
RESULTS 214
The L. rhamnosus GG fuc operon 215
An L-fucose operon is annotated in the genome of LGG (LGG_02680 to LGG_02685) 216
which codes for the enzymes that would comprise a complete pathway for L-fucose 217
catabolism (Figure 1). The genes fucI, fucK, fucP and fucU would code for an L-fucose 218
isomerase, L-fuculose kinase, an L-fucose/H+ symporter of the major facilitator 219
superfamily (MFS) and L-fucose mutarotase, an enzyme which accelerates the 220
conversion of the β anomer of L-fucose into the α anomer, the substrate for FucI (24). 221
The divergently transcribed fucR gene codes for a transcriptional regulator of the DeoR 222
family, whereas fucA, codes for an L-fuculose-1-phosphate aldolase which splits L-223
fuculose-1-phosphate into dihydroxyacetone-phosphate and L-lactaldehyde, and it is 224
transcribed in the opposite direction to fucIKPU. In E. coli the L-lactaldehyde formed 225
during L-fucose catabolism is detoxified by the action of an L-1,2-propanediol 226
oxidoreductase encoded by a gene in the fuc cluster, fucO, with the concomitant 227
production of 1,2-propanediol (10). No fucO homologue is found in the LGG fuc cluster 228
but two genes which encode proteins with 50% (LGG_00757) and 42% identity 229
(LGG_02124) to E. coli FucO are present at another location in the LGG chromosome. 230
Alternatively, in E. coli L-lactaldehyde can be transformed into lactic acid by the action of 231
lactaldehyde dehydrogenase, encoded by the aldA gene (9). In LGG the gene 232
LGG_02286 codes for a protein with 32% identity to E. coli AldA, which possesses the 233
typical motifs of NAD(+)-dependent aldehyde dehydrogenases. 234
fuc clusters encoding similar catabolic pathways are found in the genomes of some 235
intestinal commensals and pathogens although the genetic structure varies and fucO and 236
fucU genes are not always present (Figure 2). A second type of transcriptional regulator, 237
with N-terminal DNA binding domain of the GntR superfamily and a C-terminal ligand-238
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
12
binding domain of the sugar-binding domain of ABC transporters, replaces the DeoR-239
family FucR in Bacteroides (11). Furthermore, the fuc operons from S. pneumoniae 240
strains are more complex and they lack the gene for an L-fucose/H+ symporter 241
permease, which is replaced by genes encoding phosphoenolpyruvate: sugar 242
phosphotransferase systems (PTS) of the mannose-class or sugar ABC-type 243
transporters, and contain genes for intracellular and extracellular glycosyl hydrolases 244
(Figure 2) (13). 245
Genome inspection in the rest of Lactobacillus species revealed that fuc clusters are 246
exclusively found in some L. rhamnosus isolates (e.g. GG, HN001, LRHMDP2 and 247
LRHMDP3 strains), Lactobacillus casei and Lactobacillus zeae (only one sequenced 248
representative strain is available for these species: strains ATCC393 and ATCC15820, 249
respectively). According to this, ATCC15820 strain was able to ferment L-fucose (data 250
not shown). By the contrary, ATCC393 strain did not form acid from L-fucose (data not 251
shown). This inability is probably due to the presence of a frame-shift in the fucK gene of 252
this strain (resulting in two different annotated genes: LBCZ_2453 and LBCZ_2454) that 253
gives truncated L-fuculose kinases lacking the N-terminal 328 and C-terminal 181 amino 254
acids, respectively. Among the rest of lactobacilli, homologues to some fuc genes were 255
only found in the draft genomes of newly described species: Lactobacillus 256
shenzhenensis LY-73T, Lactobacillus composti JCM14202 and Lactobacillus herbinensis 257
DSM16991 (data not shown). However, they were not grouped in an identifiable fuc 258
cluster. It seems therefore that within Lactobacillus the presence of a complete set of fuc 259
genes organized in an operon structure is exclusive for L. rhamnosus and L. casei / 260
zeae. Despite of the elevated number of sequenced strains of Lactobacillus paracasei 261
(25), no fuc genes were found in this species, which forms part of the phylogenetically-262
related L. casei / paracasei / rhamnosus group. 263
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
13
Another remarkable feature of the LGG fuc region was the presence of an adjacent set of 264
genes (LGG_02687 to LGG_02692) encoding an L-rhamnulose-1-phosphate aldolase, L-265
rhamnose isomerase, L-rhamnose mutarotase, L-rhamnulokinase, a MFS permease and 266
a transcriptional regulator of the AraC family, which would constitute a complete pathway 267
for L-rhamnose (6-deoxy-L-mannose) utilization, analogous to the L-fucose catabolic 268
pathway. Therefore, it appears that this chromosomal region in LGG consist of genes for 269
the catabolism of L-deoxy-sugars. 270
271
The mutation in fuc catabolic genes impairs growth on L-fucose 272
In order to prove the involvement of fuc genes in L-fucose catabolism we constructed 273
mutants in fucI and fucP (Figure 1A). The fucI strain failed to acidify the growth medium 274
when it was supplemented with L-fucose, whereas in the fucP mutant acidification was 275
slower compared to the wild type (data not shown). Under our experimental conditions, 276
LGG showed a slow growth in non-supplemented basal MRS medium, probably due to 277
the consumption of residual carbon sources present in this complex medium, as has 278
been described earlier (26). When the medium was supplemented with L-fucose the wild-279
type strain showed a growth rate (0.114 ± 0.022 h-1), compatible with L-fucose utilization, 280
whereas the fucI mutant strain displayed a growth rate significantly lower than that of the 281
wild type (0.077 ± 0.007 h-1, P = 0.048) and lower ODs were reached (Figure 3A). In the 282
fucP mutant L-fucose was only able to sustain a reduced growth rate (0.078 ± 0.006 h-1, 283
P = 0.048), but the attained ODs were higher compared to the fucI strain (Figure 3B), 284
suggesting that, although FucP is the main L-fucose transporter in LGG, in the absence 285
of this permease L-fucose is probably entering the cells by alternative and less efficient 286
transporter(s). In order to determine if, similar to E. coli (10), the fate of L-fucose in LGG 287
depends on the oxygen availability, the wild-type supernatants were analyzed after 288
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
14
growth under anaerobic or aerobic conditions. The analysis evidenced the production of 289
1,2-propanediol when cells were grown with L-fucose under anaerobiosis (Table 2). This 290
compound was not detected in supernatants of glucose-grown cells. This confirmed that 291
in LGG the L-lactaldehyde formed by the action of the L-fuculose-1-phosphate aldolase 292
on L-fuculose-1-phosphate can be metabolized by an L-1,2-propanediol oxidoreductase 293
as occurs in E. coli. Lactate production from L-fucose under anaerobic conditions was 294
lower compared to cells grown with glucose. Aerobic conditions did not have a strong 295
impact on lactic acid production or growth with glucose. However, these conditions did 296
not favor L-fucose utilization, which was very inefficient and incomplete after 24 h (Table 297
2). 298
299
The fucR gene codes for a transcriptional activator of the fuc cluster 300
To ascertain the role of the product of fucR in the regulation of the fuc operon a disrupted 301
mutant was constructed (Figure 1A). Similar to the fucI mutant, the fucR mutant strain 302
displayed a growth rate (0.067 ± 0.013 h-1, P = 0.032) significantly lower than that of the 303
wild type. Thus, fucR mutant failed to grown with L-fucose as a carbon source (Figure 304
3C), supporting the role of FucR as a transcriptional activator of fuc genes. Gene 305
expression analysis of the fuc operon revealed that all fuc genes were induced by the 306
presence of L-fucose by a factor ranging from 12 (fucR) to 9400 (fucU) compared to 307
growth on glucose (Figure 4). According to the gene structure of the LGG fuc cluster 308
(Figure 1A), at least three different promoters are necessary for the transcription of all 309
genes. Our results show that the three promoters are responsive to L-fucose and 310
suggested that FucR autoregulates its own transcription, although fucR displayed the 311
lower level of induction compared to the rest of fuc genes. 312
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
15
The presence of glucose in addition to L-fucose caused a strong carbon catabolite 313
repression of all fuc genes, whose expression was restored to levels close to those found 314
during growth on glucose, with a factor of repression (fold-change in L-fucose/fold-315
change in L-fucose plus glucose) ranging from 30- to 4400-fold. In agreement with this 316
observation catabolite responsive element (cre) sites which fitted the consensus 317
sequence defined for Lactococcus lactis (WGWAARCGYTWWMA, (27) were found 318
upstream of fucI (-86TGAAAGCGCTTATT, two mismatches) or fucA and fucR (-319
57TGCAAGCGCTTACG, one mismatch; the numbering is relative to fucR). These sites 320
are the target for binding of the global transcriptional regulator CcpA, which controls 321
carbon catabolite repression in Low-G+C Gram-positive bacteria (28). 322
Growth of L. rhamnosus GG with a fucose-containing disaccharide 323
A previous work has shown that Lactobacillus casei BL23 is able to utilize the fucosyl-324
disaccharide fucosyl-α1,3-N-acetylglucosamine (Fuc-α1,3-GlcNAc), which is transported 325
by a specific permease of the PTS class and split into L-fucose and N-acetylglucosamine 326
by the α-L-fucosidase AlfB (29). However, this strain is not able to use L-fucose and only 327
the N-acetylglucosamine moiety of Fuc-α1,3-GlcNAc is catabolized, while L-fucose is 328
quantitatively expelled to the growth medium. LGG was also able to grow with 4 mM Fuc-329
α1,3-GlcNAc (Figure 5) and, in agreement with the presence of an L-fucose catabolic 330
pathway, no L-fucose was found in the supernatants. By the contrary, compared to the 331
wild type the LGG fucI and fucR mutants reached a lower final OD on Fuc-α1,3-GlcNAc 332
(Figure 6). In these experiments 110±6.1 % (fucI mutant) and 70.8±1.4 % (fucR mutant) 333
of the theoretical L-fucose from Fuc-α1,3-GlcNAc (4 mM) was detected in the bacterial 334
supernatants at the stationary phase. This was consistent with the fact that only the N-335
acetylglucosamine moiety of the disaccharide was efficiently metabolized in these 336
mutants. The fucP mutant, deficient in the L-fucose permease, showed a growth pattern 337
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16
on Fuc-α1,3-GlcNAc similar to the wild type (Figure 5) and only 3.1±0.3 % of the 338
theoretical L-fucose generated from Fuc-α1,3-GlcNAc was detected in supernatants. 339
These data indicated that the L-fucose intracellularly generated, possibly by the action of 340
an AlfB homologue (coded by LGG_02652), was metabolized, and that FucP was not 341
fully necessary for this process. In agreement with this, growth on Fuc-α1,3-GlcNAc 342
induced expression of all fuc genes, although the use of lower concentrations of 343
disaccharide (4 mM) led to lower induction levels (Figure 6) compared to growth with 344
0.5% (30 mM) L-fucose (Figure 4). Also, under these conditions the fucR gene showed a 345
downregulation compared to cells grown with glucose. In the ΔfucP strain expression of 346
the fuc cluster after growth with fuc-α1,3-GlcNAc was comparable to that found in the 347
wild type, further supporting the fact that fucP is dispensable for Fuc-α1,3-GlcNAc 348
metabolism. In the fucI and fucR mutants no induction of fuc genes was observed after 349
growth on Fuc-α1,3-GlcNAc (Figure 6), which was in agreement with the observed 350
excretion of L-fucose in these strains when cells were grown on the fucosyl-disaccharide. 351
352
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
17
DISCUSSION 353
L. rhamnosus GG (LGG) is widely used as probiotic and this strain has the ability to 354
survive and transiently colonize the gastrointestinal tract in animal models and humans 355
(16, 19). In this context, the presence in LGG of genes involved in the utilization of host-356
derived glycans constitutes a competitive advantage for its persistence in the gut. LGG 357
codes for about 40 putative glycosidases, many carbohydrate transporters and catabolic 358
enzymes that would allow it to take advantage of the carbohydrate resources of the 359
mucosa (19, 30). Thus, LGG is able to grow with mucin as a carbon source (31) and it 360
possesses extracellular factors that upregulate the production of mucin in the colonic 361
epithelium (32). Some authors have reported that LGG, although being able to use 362
mucus-derived glycans, was not capable of fermenting L-fucose (31). However, results 363
obtained by others (30) and those presented here showed that LGG ferments L-fucose. 364
The explanation for this may derive from differences in isolates of LGG from different 365
laboratories. Thus, it has been reported that LGG isolates from diverse commercial 366
probiotic products present heterogeneity in their genome sequences, which include point 367
mutations and deletions of big portions of the chromosome (33). 368
In this work we have established that the fuc genes present in the LGG genome are 369
indeed responsible for the observed L-fucose fermenting capacity of this strain. The 370
presence of specific fuc genes, mutant analysis and the fact that 1,2-propanediol was 371
detected in culture supernatants of LGG grown with L-fucose, supports the idea that the 372
utilization of this sugar in LGG follows the same pathway to that described in E. coli. 373
Depending on the growth conditions (anaerobic or aerobic), E. coli directs the 374
lactaldehyde resulting from L-fucose catabolism towards 1,2-propanediol (FucO activity) 375
or lactate (AldA activity) (10). Although the LGG genes responsible for lactaldehyde 376
metabolism have not been identified yet, it is possible that the redox status dictates its 377
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
18
metabolism towards these two compounds in L. rhamnosus. However, we showed that L-378
fucose catabolism in LGG was only favored under anaerobic conditions, which suggests 379
that lactaldehyde conversion to L-lactate is not efficient in this strain. 380
The utilization of carbohydrate resources typically found in the gastrointestinal niche is a 381
characteristic of members of the intestinal microbiota, such as Bacteroides or 382
Bifidobacterium but also of intestinal lactobacilli. Consequently, the genomes of species 383
such as Lactobacillus acidophilus, Lactobacillus johnsonii or Lactobacillus gasseri carry 384
genes encoding many carbohydrate catabolic pathways, although they lack sialidases, α-385
fucosidases or N-acetylglucosaminidases which are typical in other intestinal 386
commensals or pathogens (34-36). In this respect, the L. casei / paracasei / rhamnosus 387
group present unique features, as they are the only lactobacilli where α-fucosidades and 388
genes for the utilization of L-fucose are present. A recent analysis of 100 L. rhamnosus 389
strains isolated from several sources showed that they can be clustered on the basis of 390
their sugar fermenting capacity (30). Strains having an L-fucose fermenting phenotype 391
were derived from the oral and intestinal habitat, whereas strains from dairy origin are L-392
fucose negative. This is in agreement with the hypothesis that lactobacilli evolved by 393
gene loss and acquisition driven by the particular niches they inhabit. In some cases this 394
resulted in genome reduction after adaptation to less complex environments such as milk 395
(25). Whether the L. rhamnosus fuc cluster was present in the ancestor of the L. casei / 396
paracasei / rhamnosus species and it was most recently lost in L. paracasei and in some 397
strains of L. rhamnosus or it represents a recent acquisition remains to be elucidated. 398
Interestingly, the fuc locus of LGG is located in a chromosomal region which seems 399
dedicated to the catabolism of L-deoxy-sugars, as it also contains a cluster with genes 400
(rha) putatively involved in L-rhamnose catabolism, the sugar from which the species 401
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
19
name is derived. However, previous data and our own results (data not shown) showed 402
that LGG was not able to utilize L-rhamnose (19, 30). 403
The LGG fuc genes are subject to a dual regulation: induction by growth on L-fucose 404
triggered by FucR and catabolite repression probably dependent on the CcpA 405
transcriptional regulator. In B. thetaiotaomicron L-fucose is the inducer of the fuc genes 406
through its binding to a GntR-superfamily transcriptional repressor (11). Transcriptional 407
analysis in LGG grown with Fuc-α1,3-GlcNAc, which leads to the intracellular generation 408
of L-fucose, excludes the fact that L-fucose itself could be the effector of FucR, as it 409
failed to induce the fuc genes in a mutant deficient in the first step of the catabolic route 410
(fucI). Furthermore, FucP does not participate in the regulation of fuc genes. Genetic 411
studies in E. coli pointed to fuculose-1-phosphate as the inducer molecule of the fuc 412
operon via FucR. The same situation probably exists for L. rhamnosus, as the regulators 413
of both species belong to the same DeoR class. FucR DNA binding sites have not been 414
experimentally established for E. coli or other bacteria. In Enterobacteria a consensus 415
sequence for binding can be derived from the alignment of several fuc promoters, 416
resulting in a 36-bp imperfect inverted repeated sequence. Inspection of the LGG fuc 417
promoters did not reveal similar sequences but two tandem repetitions of the sequence 418
TGAAGAAAA separated by 14 bp are present in the fucI promoter and another similar 419
sequence is present in the fucA-fucR intergenic region. Whether these sequences are 420
the target for FucR has to be verified. 421
L. casei BL23 and LGG are the only lactobacilli described so far able to use fucosylated 422
oligosaccharides (29, 37). Both strains share the same set of α-L-fucosidases (AlfA, AlfB 423
and AlfC) which can act on specific oligosaccharides derived from glycoconjugates 424
present at mucosal surfaces, such as the LewisX antigen core, but also human milk 425
oligosaccharides (37). In addition, the alfRB-EFG operon, responsible for the uptake and 426
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
20
hydrolysis of Fuc-α1,3-GlcNAc, is present in both strains (29). However, BL23 does not 427
possess a pathway for L-fucose and, similar to LGG mutants in fucI and fucR, expels the 428
L-fucose moiety of Fuc-α1,3-GlcNAc. A minimal amount of the L-fucose derived from 429
Fuc-α1,3-GlcNAc was detected in the supernantants of the LGG fucP mutant (3%), while 430
this sugar was totally absent in the supernatants from the wild type under the same 431
conditions. This suggests that part of the intracellularly generated L-fucose is diffusing to 432
the extracellular medium and that in the absence of FucP this released sugar cannot re-433
enter the cell for being metabolized. In accordance to the activating role of FucR, no 434
induction of the fuc genes was detected in the fucR mutant when grown with Fuc-α1,3-435
GlcNAc. In this mutant only 30% of the intracellular L-fucose from the disaccharide was 436
utilized, which suggests that the basal transcription of the fuc catabolic genes in the 437
absence of activator allows a limited L-fucose metabolism when this sugar is produced 438
intracellularly. 439
Intestinal bacteria belonging to Bifidobacterium and Bacteroides are well adapted to 440
exploit the intestinal carbohydrate resources and they possess α-L-fucosidases which 441
allow them to scavenge L-fucose from the mucosa (38, 39). However, intestinal 442
commensals such as E. coli, that do not express α-L-fucosidases, depend on other 443
bacterial groups for L-fucose release from fucose-containing glycans. The LGG fuc 444
genes studied here probably represent an adaptation of this strain to dwell in the 445
particular niche of the gastrointestinal tract. However, as LGG α-L-fucosidases are 446
intracellular enzymes, this strain must probably rely on the fucosidase and glycosidase 447
activities from other members of the intestinal microbiota for the cross-feeding of L-448
fucose and fucosyl-oligosaccharides. 449
450
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
21
Acknowledgements 451
This work was supported by the Spanish Ministry of Economy and Competitiveness 452
(MINECO)/FEDER through project AGL2010-18696 and by the Valencian Government 453
through project ACOMP/2012/030. J.E. Becerra was recipient of a Santiago Grisolía 454
Fellowship from the Generalitat Valenciana. 455
456
457
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22
References 458
459
1. Becker DJ, Lowe JB. 2003. Fucose: biosynthesis and biological function in 460
mammals. Glycobiology 13:41R-53R. 461
2. Bode L. 2009. Human milk oligosaccharides: prebiotics and beyond. Nutr Rev 67 462
Suppl 2:S183-191. 463
3. Coyne MJ, Reinap B, Lee MM, Comstock LE. 2005. Human symbionts use a host-464
like pathway for surface fucosylation. Science 307:1778-1781. 465
4. Wacklin P, Makivuokko H, Alakulppi N, Nikkila J, Tenkanen H, Rabina J, Partanen 466
J, Aranko K, Matto J. 2011. Secretor genotype (FUT2 gene) is strongly associated with 467
the composition of Bifidobacteria in the human intestine. PLoS One 6:e20113. 468
5. Kashyap PC, Marcobal A, Ursell LK, Smits SA, Sonnenburg ED, Costello EK, 469
Higginbottom SK, Domino SE, Holmes SP, Relman DA, Knight R, Gordon JI, 470
Sonnenburg JL. 2013. Genetically dictated change in host mucus carbohydrate 471
landscape exerts a diet-dependent effect on the gut microbiota. Proc Natl Acad Sci USA 472
110:17059-17064. 473
6. Stahl M, Friis LM, Nothaft H, Liu X, Li J, Szymanski CM, Stintzi A. 2011. L-fucose 474
utilization provides Campylobacter jejuni with a competitive advantage. Proc Natl Acad 475
Sci USA 108:7194-7199. 476
7. Autieri SM, Lins JJ, Leatham MP, Laux DC, Conway T, Cohen PS. 2007. L-fucose 477
stimulates utilization of D-ribose by Escherichia coli MG1655 ΔfucAO and E. coli Nissle 478
1917 ΔfucAO mutants in the mouse intestine and in M9 minimal medium. Infect Immun 479
75:5465-5475. 480
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
23
8. Chen YM, Zhu Y, Lin EC. 1987. The organization of the fuc regulon specifying L-481
fucose dissimilation in Escherichia coli K12 as determined by gene cloning. Mol Gen 482
Genet 210:331-337. 483
9. Chen YM, Zhu Y, Lin EC. 1987. NAD-linked aldehyde dehydrogenase for aerobic 484
utilization of L-fucose and L-rhamnose by Escherichia coli. J Bacteriol 169:3289-3294. 485
10. Baldoma L, Aguilar J. 1988. Metabolism of L-fucose and L-rhamnose in 486
Escherichia coli: aerobic-anaerobic regulation of L-lactaldehyde dissimilation. J Bacteriol 487
170:416-421. 488
11. Hooper LV, Xu J, Falk PG, Midtvedt T, Gordon JI. 1999. A molecular sensor that 489
allows a gut commensal to control its nutrient foundation in a competitive ecosystem. 490
Proc Natl Acad Sci USA 96:9833-9838. 491
12. Pacheco AR, Curtis MM, Ritchie JM, Munera D, Waldor MK, Moreira CG, 492
Sperandio V. 2012. Fucose sensing regulates bacterial intestinal colonization. Nature 493
492:113-117. 494
13. Higgins MA, Suits MD, Marsters C, Boraston AB. 2014. Structural and functional 495
analysis of fucose-processing enzymes from Streptococcus pneumoniae. J Mol Biol 496
426:1469-1482. 497
14. Saxelin M, Tynkkynen S, Mattila-Sandholm T, de Vos WM. 2005. Probiotic and 498
other functional microbes: from markets to mechanisms. Curr Opin Biotechnol 16:204-499
211. 500
15. Yan F, Polk DB. 2012. GG: An Updated Strategy to Use Microbial Products to 501
Promote Health. Funct Food Rev 4:77-84. 502
16. Lebeer S, Vanderleyden J, De Keersmaecker SC. 2010. Adaptation factors of the 503
probiotic Lactobacillus rhamnosus GG. Benef Microbes 1:335-342. 504
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
24
17. Koskenniemi K, Laakso K, Koponen J, Kankainen M, Greco D, Auvinen P, Savijoki 505
K, Nyman TA, Surakka A, Salusjarvi T, de Vos WM, Tynkkynen S, Kalkkinen N, 506
Varmanen P. 2011. Proteomics and transcriptomics characterization of bile stress 507
response in probiotic Lactobacillus rhamnosus GG. Mol Cell Proteomics 10:M110 508
002741. 509
18. Reunanen J, von Ossowski I, Hendrickx AP, Palva A, de Vos WM. 2012. 510
Characterization of the SpaCBA pilus fibers in the probiotic Lactobacillus rhamnosus GG. 511
Appl Environ Microbiol 78:2337-2344. 512
19. Kankainen M, Paulin L, Tynkkynen S, von Ossowski I, Reunanen J, Partanen P, 513
Satokari R, Vesterlund S, Hendrickx AP, Lebeer S, De Keersmaecker SC, Vanderleyden 514
J, Hamalainen T, Laukkanen S, Salovuori N, Ritari J, Alatalo E, Korpela R, Mattila-515
Sandholm T, Lassig A, Hatakka K, Kinnunen KT, Karjalainen H, Saxelin M, Laakso K, 516
Surakka A, Palva A, Salusjarvi T, Auvinen P, de Vos WM. 2009. Comparative genomic 517
analysis of Lactobacillus rhamnosus GG reveals pili containing a human- mucus binding 518
protein. Proc Natl Acad Sci USA 106:17193-17198. 519
20. Leloup L, Ehrlich SD, Zagorec M, Morel-Deville F. 1997. Single-crossover 520
integration in the Lactobacillus sake chromosome and insertional inactivation of the ptsI 521
and lacL genes. Appl Environ Microbiol 63:2117-2123. 522
21. De Keersmaecker SC, Braeken K, Verhoeven TL, Perea Velez M, Lebeer S, 523
Vanderleyden J, Hols P. 2006. Flow cytometric testing of green fluorescent protein-524
tagged Lactobacillus rhamnosus GG for response to defensins. Appl Environ Microbiol 525
72:4923-4930. 526
22. Pfaffl MW, Horgan GW, Dempfle L. 2002. Relative expression software tool 527
(REST) for group-wise comparison and statistical analysis of relative expression results 528
in real-time PCR. Nucleic Acids Res 30:e36. 529
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
25
23. Uchiyama I, Higuchi T, Kawai M. 2010. MBGD update 2010: toward a 530
comprehensive resource for exploring microbial genome diversity. Nucleic Acids Res 531
38:D361-365. 532
24. Higgins MA, Boraston AB. 2011. Structure of the fucose mutarotase from 533
Streptococcus pneumoniae in complex with L-fucose. Acta Crystallogr Sect F Struct Biol 534
Cryst Commun 67:1524-1530. 535
25. Broadbent JR, Neeno-Eckwall EC, Stahl B, Tandee K, Cai H, Morovic W, Horvath 536
P, Heidenreich J, Perna NT, Barrangou R, Steele JL. 2012. Analysis of the Lactobacillus 537
casei supragenome and its influence in species evolution and lifestyle adaptation. BMC 538
Genomics 13:533. 539
26. Landete JM, Ferrer S, Monedero V, Zuñiga M. 2013. Malic enzyme and malolactic 540
enzyme pathways are functionally linked but independently regulated in Lactobacillus 541
casei BL23. Appl Environ Microbiol 79:5509-5518. 542
27. Zomer AL, Buist G, Larsen R, Kok J, Kuipers OP. 2007. Time-resolved 543
determination of the CcpA regulon of Lactococcus lactis subsp. cremoris MG1363. J 544
Bacteriol 189:1366-1381. 545
28. Deutscher J, Ake FM, Derkaoui M, Zebre AC, Cao TN, Bouraoui H, Kentache T, 546
Mokhtari A, Milohanic E, Joyet P. 2014. The bacterial phosphoenolpyruvate:carbohydrate 547
phosphotransferase system: regulation by protein phosphorylation and phosphorylation-548
dependent protein-protein interactions. Microbiol Mol Biol Rev 78:231-256. 549
29. Rodriguez-Diaz J, Rubio-del-Campo A, Yebra MJ. 2012. Lactobacillus casei 550
ferments the N-Acetylglucosamine moiety of fucosyl-alpha-1,3-N-acetylglucosamine and 551
excretes L-fucose. Appl Environ Microbiol 78:4613-4619. 552
30. Douillard FP, Ribbera A, Kant R, Pietila TE, Jarvinen HM, Messing M, Randazzo 553
CL, Paulin L, Laine P, Ritari J, Caggia C, Lahteinen T, Brouns SJ, Satokari R, von 554
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
26
Ossowski I, Reunanen J, Palva A, de Vos WM. 2013. Comparative genomic and 555
functional analysis of 100 Lactobacillus rhamnosus strains and their comparison with 556
strain GG. PLoS Genet 9:e1003683. 557
31. Sanchez B, Saad N, Schmitter JM, Bressollier P, Urdaci MC. 2010. Adhesive 558
properties, extracellular protein production, and metabolism in the Lactobacillus 559
rhamnosus GG strain when grown in the presence of mucin. J Microbiol Biotechnol 560
20:978-984. 561
32. Wang L, Cao H, Liu L, Wang B, Walker WA, Acra SA, Yan F. 2014. Activation of 562
EGF Receptor Mediates Mucin Production stimulated by p40, a Lactobacillus rhamnosus 563
GG-derived Protein. J Biol Chem 289:20234-20244. 564
33. Sybesma W, Molenaar D, van IW, Venema K, Kort R. 2013. Genome instability in 565
Lactobacillus rhamnosus GG. Appl Environ Microbiol 79:2233-2239. 566
34. Azcarate-Peril MA, Altermann E, Goh YJ, Tallon R, Sanozky-Dawes RB, Pfeiler 567
EA, O'Flaherty S, Buck BL, Dobson A, Duong T, Miller MJ, Barrangou R, Klaenhammer 568
TR. 2008. Analysis of the genome sequence of Lactobacillus gasseri ATCC 33323 569
reveals the molecular basis of an autochthonous intestinal organism. Appl Environ 570
Microbiol 74:4610-4625. 571
35. Pridmore RD, Berger B, Desiere F, Vilanova D, Barretto C, Pittet AC, Zwahlen 572
MC, Rouvet M, Altermann E, Barrangou R, Mollet B, Mercenier A, Klaenhammer T, 573
Arigoni F, Schell MA. 2004. The genome sequence of the probiotic intestinal bacterium 574
Lactobacillus johnsonii NCC 533. Proc Natl Acad Sci USA 101:2512-2517. 575
36. Altermann E, Russell WM, Azcarate-Peril MA, Barrangou R, Buck BL, McAuliffe O, 576
Souther N, Dobson A, Duong T, Callanan M, Lick S, Hamrick A, Cano R, Klaenhammer 577
TR. 2005. Complete genome sequence of the probiotic lactic acid bacterium 578
Lactobacillus acidophilus NCFM. Proc Natl Acad Sci USA 102:3906-3912. 579
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
27
37. Rodriguez-Diaz J, Monedero V, Yebra MJ. 2011. Utilization of natural fucosylated 580
oligosaccharides by three novel alpha-L-fucosidases from a probiotic Lactobacillus casei 581
strain. Appl Environ Microbiol 77:703-705. 582
38. Sela DA, Garrido D, Lerno L, Wu S, Tan K, Eom HJ, Joachimiak A, Lebrilla CB, 583
Mills DA. 2012. Bifidobacterium longum subsp. infantis ATCC 15697 alpha-fucosidases 584
are active on fucosylated human milk oligosaccharides. Appl Environ Microbiol 78:795-585
803. 586
39. Sakurama H, Tsutsumi E, Ashida H, Katayama T, Yamamoto K, Kumagai H. 2012. 587
Differences in the substrate specificities and active-site structures of two alpha-L-588
fucosidases (glycoside hydrolase family 29) from Bacteroides thetaiotaomicron. Biosci 589
Biotechnol Biochem 76:1022-1024. 590
591
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
28
592
Table 1. Strains and plasmids used in this study 593
strain or plasmid characteristics origin
L. rhamnosus GG wild type ATCCa50103
L. rhamnosus BL394 LGG with an 963-bp in-frame deletion in fucP this work
L. rhamnosus BL395 LGG with a frameshift at the fucI EcoRI site this work
L. rhamnosus BL396 LGG with an insertion of a pRV300-derivative at
the fucR gene; EryRb
this work
L. casei ATCC393 wild type ATCC
L. zeae KCTC3804 wild type; very similar to L. casei isolates ATCC15820
E. coli DH10B F- endA1 recA1 galE15 galK16 nupG rpsL
ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697
mcrA Δ(mrr-hsdRMS-mcrBC) λ-
Invitrogene
pRV300 non-replicative plasmid for Lactobacillus. AmpRd,
EryR
(20)
pRΔFucP pRV300 with a 1221-bp fragment containing fused
5’ and 3’ fucP fragments
this work
pRFucI pRV300 with a 997-bp fucI fragment containing a
frame-shift at the EcoRI site
this work
pRFucR pRV300 with a 437-bp fucR internal fragment
cloned at EcoRV site
this work
aAmerican Type Culture Collection; bErythromycin resistance; cChloramphenicol resistance; 594 dAmpicillin resistance 595
596
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
29
597
598
Table 2. Product formation and growth characteristics of LGG with L-fucose 599 or D-glucose under different conditions 600 anaerobica aerobica
L-fucose D-glucose L-fucose D-glucose
1,2-Propanediolb 10.0 ± 0.1 NDc 1.3 ± 0.1 ND
Lactateb 10.0 ± 1.3 33.8 ± 1.3 0.7 ± 0.1 35.7 ± 6.7
Residual sugarb 0.10 ± 0.06 ND 12.73 ± 0.63 ND
Final OD550nm 1.20 ± 0.14 1.75 ± 0.07 0.75 ± 0.06 1.65 ± 0.07
Final pH 5.36 ± 0.01 5.02 ± 0.01 7.09 ± 0.14 5.09 ± 0.01 aGrowth was carried out in basal MRS medium supplemented with 20 mM L-fucose or 601 20 mM D-glucose for 24 h at 37ºC; bresults are in mM; cND; not detected. 602
603
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
30
Figure legends 604
605
Figure 1. L-fucose metabolism in L. rhamnosus GG. (A) Schematic 606
representation of the fuc gene cluster in LGG. Stem-loops represent putative 607
rho-independent transcriptional terminators and their calculated ΔG values are 608
given. The genetic structures of the different fuc mutants generated are shown; 609
(B) proposed catabolic pathway for L-fucose utilization in LGG. L-lactaldehyde 610
can follow two different routes, leading to the production of L-1,2-propanediol or 611
L-lactate. In LGG the route producing L-1,2-propanediol is more efficient 612
(anaerobic growth; see text). 613
614
Figure 2. L-fucose catabolic gene clusters in bacteria. A schematic representation of 615
different gene clusters for L-fucose catabolism is shown. In S. pneumoniae strains two 616
different fuc clusters (type 1 and type 2) have been described. Genes encoding 617
glycosylhydrolases (GH) are shown with the GH family number. 618
619
Figure 3. Growth of L. rhamnosus GG on L-fucose. (A) fucI mutant; (B) fucP mutant; 620
(C) fucR mutant. In all graphs the growth profile of the wild-type strain is represented for 621
a better comparison. L-fucose concentration was 0.5% (30 mM). Data presented are the 622
means from three determinations. SD did not exceed 15% 623
624
Figure 4. Expression of fuc genes in L. rhamnosus GG. LGG wild-type strain was 625
grown with 0.5% L-fucose or 0.5% L-fucose plus 0.2% glucose and expression of fuc 626
genes was determined by RT-qPCR. The relative expression is referred to bacterial cells 627
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
31
grown with 0.5 % glucose. The LGG pyrG (LGG_02546), recG (LGG_01660) and leuS 628
(LGG_00848) genes were used as reference. 629
630
Figure 5. Growth of L. rhamnosus GG with fucosyl-α-1,3-N-acetylglucosamine. (A) 631
fucI mutant; (B) fucP mutant; (C) fucR mutant. In all graphs the growth pattern of the wild-632
type strain is represented for a better comparison. Fucosyl-α-1,3-N-acetylglucosamine 633
was used at 4 mM. Data presented are the means from three determinations. SD did not 634
exceed 15%. 635
636
637
Figure 6. Expression of fuc genes in L. rhamnosus GG grown in fucosyl-α-1,3-N-638
acetylglucosamine. LGG wild-type, fucP, fucI and fucR strains were grown in the 639
presence of 4 mM fucosyl-α-1,3-N-acetylglucosamine and expression of fuc genes was 640
monitored by RT-qPCR. For each bacterial strain the relative expression is referred to the 641
expression in the same strain grown with 4 mM glucose. Expression in wild type in the 642
presence of 4 mM L-fucose is also shown. The LGG pyrG (LGG_02546), recG 643
(LGG_01660) and leuS (LGG_00848) genes were used as reference. 644
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
fucI fucK fucP fucU fucA fucR
DfucP
fucR::pRV300
LGG BL394 BL395 BL396
A
B
L-fucose FucP
b-L-fucose
L-fuculose L-fuculose-1-P
LGG_02685 LGG_02684 LGG_02683 LGG_02682 LGG_02681 LGG_02680
dihydroxyacetone-P L-lactaldehyde
glycolysis
ATP ADP
NADH NAD+
L-1,2-propanediol
FucK FucA
FucI FucU
a-L-fucose
-10.13 kcal/mol -9.9 kcal/mol -10.9 kcal/mol
NAD+
NADH L-lactate
fucI
Figure 1. L-fucose metabolism in L. rhamnosus GG. (A) Schematic
representation of the fuc gene cluster in LGG. Stem-loops represent putative rho-
independent transcriptional terminators and their calculated ΔG values are given.
The genetic structures of the different fuc mutants generated are shown; (B)
proposed catabolic pathway for L-fucose utilization in LGG. L-lactaldehyde can
follow two different routes, leading to the production of L-1,2-propanediol or L-
lactate. In LGG the route producing L-1,2-propanediol is more efficient (anaerobic
growth; see text)
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
fucI fucK fucP fucU fucA fucR
E. coli
fucO fucA fucP fucI fucK fucU fucR
fucR fucI fucO fucA fucK fucP
B. fragilis
fucR fucI fucK fucU fucA fucP
H. influenzae
fucR fucI fucA fucK fucP
B. thetaiotaomicron
L. casei/rhamnosus
S. pneumoniae type 1
and type 2 fuc operons
GH95 GH98
GH98 GH29 GH36 GH36
fucR fucK fucA fucU mannose-class PTS fucI
fucR fucK ABC-transporter fucA fucI
Figure 2. L-fucose catabolic gene clusters in bacteria. A schematic representation of different gene clusters for L-
fucose catabolism is shown. In S. pneumoniae strains two different fuc clusters (type 1 and type 2) have been
described. Genes encoding glycosylhydrolases (GH) are shown with the GH family number.
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
0 10 20 30 40 500.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
wild type L-fucose
fucI L-fucose
wild type no sugar
fucI no sugar
time (h)
OD
55
0n
m
0 10 20 30 40 500.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
wild type L-fucose
fucP L-fucose
wild type no sugar
fucP no sugar
time (h)
OD
55
0n
m
0 10 20 30 40 500.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9wild type L-fucose
fucR L-fucose
wild type no sugar
fucR no sugar
time (h)
OD
55
0n
m
A
C
B
Figure 3. Growth of L. rhamnosus GG on L-fucose. (A) fucI mutant; (B) fucP
mutant; (C) fucR mutant. In all graphs the growth profile of the wild-type strain is
represented for a better comparison. L-fucose concentration was 0.5% (30 mM).
Data presented are the means from three determinations. SD did not exceed 15%.
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
L-fucose L-fucose + glucose
-2
0
2
4
6
8
10
12
14
16fucI
fucK
fucP
fucU
fucA
fucR
rela
tive e
xp
ressio
n (
log
2)
Figure 4. Expression of fuc genes in L. rhamnosus GG.
LGG wild-type strain was grown with 0.5% L-fucose or 0.5%
L-fucose plus 0.2% glucose and expression of fuc genes
was determined by RT-qPCR. The relative expression is
referred to bacterial cells grown with 0.5 % glucose. The
LGG pyrG (LGG_02546), recG (LGG_01660) and leuS
(LGG_00848) genes were used as reference.
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
A
C
B
Figure 5. Growth of L. rhamnosus GG with fucosyl-α-1,3-N-acetylglucosamine. (A) fucI
mutant; (B) fucP mutant; (C) fucR mutant. In all graphs the growth pattern of the wild-type strain
is represented for a better comparison. Fucosyl-α-1,3-N-acetylglucosamine was used at 4 mM.
Data presented are the means from three determinations. SD did not exceed 15%.
0 10 20 30 40 500.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9wild type Fuc1,3NAG
fucI Fuc1,3NAG
wild type no sugar
fucI no sugar
time (h)
OD
55
0n
m
0 10 20 30 40 500.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9wild type Fuc1,3NAG
fucP Fuc1,3NAG
wild type no sugar
fucP no sugar
time (h)
OD
55
0n
m
0 10 20 30 40 500.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9wild type Fuc1,3NAG
fucR Fuc1,3NAG
wild type
fucR
time (h)
OD
55
0n
m
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from
wt L-fuc wt fuc1,3NAGfucP fuc1,3NAGfucI fuc1,3NAGfucR fuc1,3NAG
-6
-4
-2
0
2
4
6
8
10fucI
fucK
fucP
fucU
fucA
fucR
rela
tive e
xp
ressio
n (
log
2)
wt Fuc wt Fuc1,3NAG fucP Fuc1,3NAG fucI Fuc1,3NAG fucR Fuc1,3NAG
Figure 6. Expression of fuc genes in L. rhamnosus GG grown in fucosyl-α-1,3-N-
acetylglucosamine. LGG wild-type, fucP, fucI and fucR strains were grown in the
presence of 4 mM fucosyl-α-1,3-N-acetylglucosamine and expression of fuc genes was
monitored by RT-qPCR. For each bacterial strain the relative expression is referred to
the expression in the same strain grown with 4 mM glucose. Expression in wild type in
the presence of 4 mM L-fucose is also shown. The LGG pyrG (LGG_02546), recG
(LGG_01660) and leuS (LGG_00848) genes were used as reference.
on April 9, 2018 by guest
http://aem.asm
.org/D
ownloaded from